CN111549001B

CN111549001B - Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

Info

Publication number: CN111549001B
Application number: CN202010466093.2A
Authority: CN
Inventors: 陈平; 李娜; 王暄; 张婷婷; 杨文清; 李娅芳; 张利娟
Original assignee: Jia Ming Guan Biotechnology Co ltd
Current assignee: Jia Ming Guan Biotechnology Co ltd
Priority date: 2020-05-28
Filing date: 2020-05-28
Publication date: 2024-04-19
Anticipated expiration: 2040-05-28
Also published as: CN111549001A

Abstract

The application discloses a hybridoma cell strain secreting an African swine fever virus p34 protein monoclonal antibody, the monoclonal antibody and application, wherein the preservation number of the hybridoma cell strain is CCTCC NO: C202042, and the preparation method of the hybridoma cell strain comprises the following steps: 1) Expressing to obtain African swine fever virus p34 protein; 2) Obtaining immune spleen cells from the immunized animal; 3) Cell fusion and screening positive hybridoma cell strains; 4) Screening positive hybridoma cell strains secreting monoclonal antibodies; wherein p34 protein prepared by transfecting HEK293 cells with CHO-S cells, SF9 insect cells and recombinant adenovirus vectors is used for screening positive hybridoma cell strains. The p34 antigen protein is prepared by adopting a mammalian cell CHO expression system, so that the folding and glycosylation of the protein are more similar to those of the natural protein; and the hybridoma cell strain is screened through antigens prepared by the three expression systems, so that the obtained hybridoma cell strain can stably secrete monoclonal antibodies, and has stronger specificity.

Description

Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

Technical Field

The invention belongs to the field of genetic engineering and recombinant vaccines, and particularly relates to a hybridoma cell strain secreting an African swine fever virus p34 protein monoclonal antibody, the monoclonal antibody and application.

Background

African swine fever (AFRICAN SWINE FEVER, ASF) is a highly contagious swine virus disease that can result in nearly 100% high mortality in domestic swine. ASF is caused by ASF Virus (ASFV), which is a large double-stranded DNA Virus that replicates mainly in the cytoplasm of macrophages, has a structure of a plus 20-sided body, a diameter of about 175-215 nm, and a genome of 170-190 kb in length, contains 151 open reading frames, can encode 150-200 proteins, and has a capsule. As structural proteins constituting the virus particles, there are proteins such as P72, P54, pp62, and P220, wherein pp62 and pp220 are two multimeric protein precursors of ASFV, and are encoded by the CP530R and CP2475L genes, respectively. The pp62 protein is a late viral replication protein, which is processed post-translationally by proteases to produce two structural proteins, P35 and P15.pp220 protein is a membrane-bound protein of cytosol, and the main components P150, P37, P34 and P14 proteins of the virus particles generated after protease processing are all present in the nucleocapsid of the mature virus particles, accounting for about 30% of the total protein component of ASFV, play an important role in the assembly process of the nucleocapsid, and play an important role in the packaging of viral inner core proteins. P34 has better immunogenicity and can be used as an antigen for vaccine development. So far, due to the complexity of AFSV genome, the diversity of African swine fever protein structure has not been developed yet, and development and research on an African swine fever virus vaccine method are lacked.

Serological tests are the most common diagnostic test for ASF because of simple handling, relatively low cost, and no special equipment is required, but because there is no commercial vaccine against ASF, which means that the presence of anti-ASFV antibodies is indicative of infection, furthermore, anti-ASFV antibodies occur soon 7-10 days after infection and last months to years, but pigs and wild boars infected with virulent strains usually die before specific antibody immune responses are generated, and serological tests are critical for determining recovery and asymptomatic infected animals in defined ASFV infected areas when attenuated and low virulent viruses circulate.

Disclosure of Invention

Based on the defects of the prior art, the invention aims to provide a hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody and the monoclonal antibody so as to lay a foundation for detecting the African swine fever virus.

As a first aspect of the application, the application provides a hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody.

Preferably, the collection number of the hybridoma cell strain is CCTCC NO: C202042.

As a second aspect of the application, the application provides a preparation method of a hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody.

Preferably, the preparation method comprises the following steps:

1) Expressing to obtain African swine fever virus p34 protein;

2) Obtaining immune spleen cells from the immunized animal;

Taking African swine fever virus p34 protein as an antigen, and immunizing a BALB/c mouse to obtain an immunized spleen cell;

3) Cell fusion and screening positive hybridoma cell strains;

Fusing 1X 10 ⁸ immune spleen cells and 1X 10 ⁷ myeloma cells, performing ELISA detection on cell culture supernatant after 10-14 days of fusion, and screening to obtain positive hybridoma cell strains;

4) Screening of monoclonal antibody-secreting positive hybridoma cell lines:

Screening the positive hybridoma cell strain obtained in the step 3) by taking the African swine fever virus p34 protein as an antigen, subcloning the hybridoma cell strain for stably secreting the monoclonal antibody, identifying the subtype as IgG1, taking the positive subclone strain for preservation, and obtaining the hybridoma cell strain for secreting the African swine fever virus p34 protein monoclonal antibody.

Preferably, in the step 4), the positive hybridoma cell strain is screened by using african swine fever virus p34 protein prepared by CHO-S cell expression, african swine fever virus p34 protein prepared by SF9 insect cell expression and african swine fever virus p34 protein prepared by HEK293 cell transfection by recombinant adenovirus vector, and monoclonal antibodies generated by the hybridoma cell strain obtained by screening can be identified by african swine fever virus p34 antigen prepared by CHO-S cell, SF9 insect cell and HEK293 cell transfection by recombinant adenovirus vector.

Preferably, the preparation method of the African swine fever virus p34 protein prepared by CHO-S cell expression comprises the steps of connecting a gene sequence for expressing the African swine fever virus p34 protein to pSecTag-2B to obtain an expression vector pSecTag-2B-p34, transfecting CHO-S cells by using the pSecTag-2B-p34 expression vector, carrying out induced expression and purifying to obtain the African swine fever virus p34 protein;

The preparation method of the African swine fever virus p34 protein prepared by SF9 insect cell expression comprises the following steps: connecting a gene sequence for expressing the African swine fever virus p34 protein to a shuttle plasmid pFastBac of Bacmid to obtain an expression vector pFastBac-p34, using a competent cell DH10Bac of Bacmid to convert pFastBac-p34 into the expression vector, extracting a viral genome to obtain Bacmid-p34, transfecting SF9 cells with the Bacmid-p34, and carrying out induced expression and purification to obtain the African swine fever virus p34 protein;

The preparation method of the African swine fever virus p34 protein prepared by transfecting HEK293 cells with the recombinant adenovirus vector comprises the following steps: the recombinant adenovirus vector pAd5-p34 is inoculated into HEK293 cells, induced to express and purified to obtain the African swine fever virus p34 protein.

As a third aspect of the application, the application provides an African swine fever virus p34 protein monoclonal antibody.

Preferably, the monoclonal antibody is secreted by a hybridoma cell strain with a preservation number of CCTCC NO: C202042.

As a fourth aspect of the present application, the present application provides an application of the african swine fever virus p34 protein monoclonal antibody of the third aspect in detecting african swine fever virus.

As a fifth aspect of the present application, the present application provides the use of the african swine fever virus p34 protein monoclonal antibody of the third aspect in preparing an immunoassay tool for detecting african swine fever virus.

Preferably, the immunoassay kit is a reagent, a kit, a test strip or a biochip.

As a fifth aspect of the application, the application provides a kit for detecting the presence and/or level of african swine fever virus in a sample.

Preferably, the kit comprises the african swine fever virus p34 protein monoclonal antibody of the third aspect.

Preferably, the kit also comprises an African swine fever virus cell culture or an enzyme-labeled plate coated by an African swine fever virus p34 protein, an HPR marked goat anti-mouse secondary antibody, a washing solution, a sealing solution, an antibody dilution solution, a chromogenic solution and a stop solution.

The application has the beneficial effects that:

1) The p34 antigen protein is prepared by adopting a mammalian cell CHO expression system, so that the folding and glycosylation of the protein are more similar to those of the natural protein;

2) According to the application, the hybridoma cell strains capable of secreting monoclonal antibodies are screened through antigens prepared by three expression systems, the obtained hybridoma cell strains can stably secrete the monoclonal antibodies against the African swine fever virus p34 protein, the prepared monoclonal antibodies are stronger in specificity, and various detection works can be more applicable;

3) The monoclonal antibody can be applied to detection of p34 protein packaged by adenovirus, fills the blank of a domestic detection kit because the p34 antibody is not sold in the market, and can be better applied to detection of antigens packaged by mammalian cells.

Drawings

FIG. 1 is an electrophoretogram of p34 protein amplification;

FIG. 2 is a diagram showing the result of agarose gel electrophoresis of the digested product, lane 1 is the recovered p34 fragment, and lanes 2 and 3 are the digested product of the vector;

FIG. 3 is a diagram showing the result of PCR verification of pSecTag-2B-p34 recombinant vector colonies, wherein the vectors corresponding to lanes 17, 20, 21, 22 are selected for enzyme digestion verification;

FIG. 4 is a graph showing the results of digestion of the vectors corresponding to lanes 17, 20, 21, and 22 of FIG. 3;

FIG. 5 is a schematic diagram of Ni column purification;

FIG. 6 shows the detection result of gradient imidazole elution SDS-PAGE;

FIG. 7 shows the quantitative detection results of BSA after ultrafiltration concentration of p 34;

FIG. 8 is a graph of experimental results of an immune response of a monoclonal antibody to adenovirus-packaged p34 protein;

FIG. 9 is a graph showing the result of amplification of a p34 gene fragment according to an embodiment of the present invention;

FIG. 10 is a vector map of recombinant shuttle plasmid pS5E1-p34 according to the example of the present invention;

FIG. 11 is a graph showing the result of XhoI cleavage of the recombinant adenovirus vector pAd5-p34 of the presently filed embodiment;

FIG. 12 is a vector map of recombinant adenovirus vector pAd5-p34 of an embodiment of the invention.

FIG. 13A is a graph showing agarose gel electrophoresis results of CMV-MCS fragment and SV40earlypolyA fragment, M is 2000marker,1 is CMV-MCS fragment, and 2 is SV40-earlypolyA fragment; FIG. 13B is a graph showing agarose gel electrophoresis results of a CMV-MCS-SV40earlypolyA fusion fragment, a PUC fragment, an Ad5 right arm and an Ad5 left arm, M being 2000marker,1 being a CMV-MCS-SV40earlypolyA fusion fragment, 2 being PUC,3 being an Ad5 right arm, 4 being an Ad5 left arm; FIG. 13C is a graph showing agarose gel electrophoresis results of colony PCR amplification of CMV-MCS-SV40 polyA and Ad5 left arm; FIG. 13D is a graph showing the results of single cleavage verification of shuttle plasmid pS5E 1.

The hybridoma cell strain is preserved in China center for type culture collection (CHINA CENTER for Type Culture Collection, abbreviated as CCTCC), and the preservation address is: the storage date of the eight-path 299 university of Wuhan in Wuhan district of Hubei province is: the preservation number is CCTCC NO: C202042, and the classification name is: AYP34-83.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. It should be understood that the embodiments described are exemplary only and are not intended to limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the technical solution of the present invention without departing from the spirit and scope of the invention, but these changes and substitutions fall within the scope of the present invention.

In the present invention, unless otherwise specified, the methods employed in the examples are general techniques in the art, and all equipment, raw materials, etc. are products commonly used in the industry and are commercially available.

Example 1 preparation of p34 antigen

1. Construction of pSecTag-2B-p34 vector

1. Primer synthesis

p34-HindIII-F cccAAGCTTATGGGGAATCGCGGGTCTTCTA(SEQ ID No.1)

p34-Tb-NotI-R atttGCGGCCGCGCTGCCGCGCGGCACCAGGCCCTTTTT

GGCGCAGCTGTT(SEQ ID No.2)

2. PCR amplification of p34 Gene fragment

PCR reaction system: q5 Mix 25. Mu.L, primer F & R2. Mu.L, template 0.5. Mu.L (synthetic), make-up to 50. Mu.L; reaction conditions: 98 ℃ for 10s (98 ℃ for 10s,60 ℃ for 30s,72 ℃ for 1 min) multiplied by 35, and 72 ℃ for 4min,4 ℃ and infinity; as a result of amplification, an amplified band was generated at 1100bp, as shown in FIG. 1.

3. Single enzyme cutting of target fragment and carrier

Enzyme digestion reaction system: 3 mug of vector and target fragment, 1 mug of NotI; 10X cutsmart buffer. Mu.L; moisturizing to 50 mu L; among them, pSecTag 2B vector was purchased from Invitrogen corporation.

Reaction conditions: 37 ℃ for 1h; inactivating at 65deg.C for 20 min.

4. Purifying the PCR clean-up kit, enzyme cutting after purifying, and enzyme cutting the product of the gel recovery kit

Enzyme digestion reaction system: 3. Mu.g of vector and 1. Mu.L of HindIII each; 10X cutsmart buffer. Mu.L; the water was made up to 50. Mu.L.

Reaction conditions: 37 ℃ for 1h; inactivating at 65deg.C for 20 min. The cleavage results are shown in FIG. 2.

5. Ligation vectors and fragments

The connection system is as follows: pSecTag-2B (100 ng) vector 1. Mu.L; p34 (63 ng) fragment 0.75. Mu.L; 1. Mu.L of T4 DNA ligase; 10 Xligase buffer 1. Mu.L; water was added to 10 μl.

Reaction conditions: at room temperature, 50min.

The recombinant vector pSecTag-2B-p34 was transferred into NEB10bete competent cells, coated with LB solid medium (Amp-resistant) and cultured overnight at 37 ℃.

6. Vector construction verification

The monoclonal colony is selected for PCR and double enzyme digestion verification, and sequencing and identification are carried out, the results of the colony PCR verification and enzyme digestion verification of the pSecTag-2B-p34 recombinant vector are shown in the figure 3 and the figure 4, the vector construction corresponding to lanes 17, 20, 21 and 22 is accurate, and the pSecTag-2B-p34 recombinant vector with accurate construction is selected.

2. P34 protein expression and purification:

1. Electrotransfection

1) Day1, CHO-S cells were prepared and inoculated into a flask at 5X 10 ⁶ cells/mL;

2) Day2, the correct pSecTag-2B-p34 expression vector will be identified and the plasmid transfected according to Celetrix instructions (200. Mu.L for maximum electric stun volume, 10. Mu.g plasmid per time and up to 1X 10 ⁷ cells per time in 30mL medium)

Shock transfection conditions were v=1100V T =30 ms p=1;

3) And (3) harvesting samples after 96-120 hours (when the cell viability is reduced to about 80%), taking cell supernatants for protein level detection, identifying by using Western Blot, and revising a detection operation flow by referring to SOP-Western Blot (Western Blot).

2. Purification

Sample treatment:

1. collecting cells with cell viability of about 80%, centrifuging at 4000rpm for 30min, and retaining supernatant;

2. removing cells, and filtering the supernatant with a 0.45 μm filter membrane;

3. the purification is carried out by a Ni column, wherein the purification schematic diagram of the Ni column is shown in FIG. 5, and the purification process of the Ni column is as follows:

1) Opening the connection of the purifier and the computer to ensure that the pipeline connection is not leaked, and performing parameter setting;

2) The liquid inlet pipelines A, B are all placed in ultrapure water, and initial parameters are set: the flow rate is 3mL/min, the component B is 50%, the absorbance of 280mm is opened, the rest is closed, and the absorbance value is reset to zero; the maximum pressure limit is set to 0.3MPa; starting A, B the pump for cleaning;

3) Observing that the conductivity and absorbance value tend to zero and are stable when the A, B pump is cleaned, and connecting the columns (if the absorbance value change range is too large, checking the reason, and judging whether bubbles or other impurities exist in the pipeline;

4) Connecting columns: firstly, opening the peak head on the column to remove possible bubbles, wherein the equipment still operates to discharge liquid (the operation is performed at a low flow rate, the flow rate is 1 mL/min), and the upper end of the column is connected and the end socket at the lower end of the column is rapidly opened to discharge the liquid; the lower end is connected with the equipment, so that bubbles do not enter the pipeline;

5) Balance column: flushing the column with ultrapure water at a flow rate of 3mL/min, discharging the ethanol protection liquid therein for at least 3 times of column volume, and simultaneously feeding (setting the component B as 50%) balance buffer liquid through a A, B pipeline when the conductivity and the absorption peak value are close to zero and stable, wherein the conductivity rises to a stable level, the absorbance slightly rises (< 10) and is kept stable, and then feeding is started;

6) Loading: the whole process of the sample uses a B pipeline to feed liquid, the A pipeline is placed in a balance buffer solution, the flow speed is 1ml/min, the conductivity can be reduced for a section after the sample is stabilized, and the absorbance can be rapidly increased to a stable value;

7) Flushing: after the sample is finished, the liquid inlet of the pipeline B is continuously used, the pipeline B is invaded into the balance buffer solution to wash the column, the conductivity can be increased to a value at the time of balance after the flow rate is 3mL/min and is stable, the absorbance can be reduced to be towards zero (the existence of a certain background absorbance value is more than 10 and can be considered as normal);

8) Eluting: after washing until absorbance is stable, changing the pipeline B into an elution buffer solution (the remaining balance buffer solution can be pumped in a pump B by a syringe, so that the pipeline is filled with the elution buffer solution), starting to elute with 5%, 10%, 20%, 30%, 35%, 40%, 50% and 100% of the component B, and collecting peaks sequentially at a flow rate of 1mL/min (if absorbance is rapidly increased, the absorbance range of a display interface can be adjusted to a small range so as to reduce the volume of the collected liquid);

9) Flushing a pipeline: after the effluent liquid under each elution peak is collected, placing the A, B pipeline into pure water, setting the B component to be 50%, and the flow rate to be 3mL/min, flushing the column with pure water until the absorbance and the conductivity tend to be zero and stable, placing the A, B pipeline into 20% ethanol, flushing the column until the column is preserved, setting the B component to be 50%, and the flow rate to be 3mL/min, and setting the volume of the column to be about 3;

10 Disassembly of the column): preserving the column, disassembling the connection between the column and the equipment, running the equipment at a low flow rate of 1mL/min during the disassembly, plugging the lower end enclosure to be screwed up, preventing liquid leakage, and rapidly disassembling the upper end enclosure and screwing up;

11 Save data, clean the device and shut down.

Samples eluted by each gradient were collected separately and protein content was detected by Western blot and SDS-PAGE: and the target protein collected under the elution peak is subjected to ultrafiltration concentration, and is quantified by BSA to determine the concentration. The SDS-PAGE results are shown in FIG. 6, which shows that the p34 gene can be correctly expressed in CHO-S cells with good yield, and the BSA quantitative detection results are shown in FIG. 7, which show that the expressed p34 protein is at 55kDa and the total amount of protein is about 2 mg.

Example 2 preparation of hybridoma cells

(One) preparation of immune spleen cells

1. P34 protein immunized mice

The African swine fever virus p34 protein prepared in example 1 is used as an antigen to immunize a BALB/c mouse, after the antigen is completely emulsified by adding the equivalent Freund's complete adjuvant for the first immunization, the mouse is subcutaneously injected into the abdomen, the dosage is 100 mug/mouse, and negative serum is collected for standby before immunization. The two-way-immunity after 14 days is injected into mice after the two-way-immunity is mixed and emulsified by using the same dose of antigen and the same amount of Freund's incomplete adjuvant, the dose is 50 mug/immunization, and the two-way-immunity is immunized once every 7 days after each interval. After 5 times of immunization, the tail vein of the mice is sampled, serum is separated, the serum antibody titer is detected by ELISA, and the antibody titer detection method is as follows:

1) Coating p34 antigen 100 mu L/hole, and standing overnight at 4 ℃ with the antigen concentration of 2 mu g/mL;

2) The next day, wash 3 times with PBST, block with 2% bsa, overnight at 4 ℃;

3) The third day is washed 3 times by PBST, the serum is dried by beating, diluted p34 immune serum, negative mouse serum and PBS are added, 100 μl is added, and the temperature is 37 ℃ for 45min;

4) Washing with PBST for 3 times, beating, adding 100 μl of goat anti-mouse (HRP-labeled secondary antibody) and standing at 37deg.C for 45min;

5) Washing with PBST for 3 times, drying, adding 100 μl of TMB color development liquid, and developing at 37deg.C for 20min;

6) OD450 values were read after addition of stop solution (2 MH ₂SO₄). The experimental results are shown in the following table:

Dilution degree	1:2000	1:4000	1：8000	1:16000	1:32000	1:64000	1:128000	1:256000	1:512000	PBS
											Mouse 1	3.3091	3.2757	3.2484	3.2542	3.3244	2.8511	1.6995	0.9812	0.5606	0.201
Mouse 2	3.1974	3.2446	3.4045	3.2521	3.1295	1.9727	1.0324	0.6045	0.3988	0.2911
											Mouse 3	3.2101	3.1763	3.2443	2.6272	1.4269	0.7637	0.4855	0.3198	0.2899	0.2001
Negative mice	0.4318	0.4327	0.2929	0.3063	0.3029	0.2563	0.2844	0.2803	0.2943	0.2523

ELISA results show that the antibody titer of three mice is above 1:64000, the highest antibody titer of the mouse 1 is 1:512000, and finally spleen cells of the mouse 1 are selected for cell fusion.

2. Immune spleen cell collection

1) Euthanasia of mice by cervical dislocation;

2) Placing the whole mouse into a 200ml beaker containing 70% ethanol to disinfect epidermis, fixing on a paraffin plate after 5min, and taking out spleen aseptically;

3) Placing the spleen into a culture dish containing 5mL RPMI1640+10%FBS; the spleen was then transferred to a new petri dish of 1mL RPMI1640+10%FBS, fat and connective tissue were trimmed, and the spleen was then cut into small pieces;

4) Using sterile forceps, one piece of spleen was gripped with one forceps while cells were "squeezed" from one piece of spleen into the medium;

5) Multiple washes with 2-3mL culture medium, move cells into 50mL centrifuge tubes; blowing and sucking the cells for several times by using a pipette, and then standing until larger tissue blocks fall to the bottom of the tube;

6) Collecting cell suspension, placing into a new 50mL centrifuge tube, and centrifuging at 900-1000rpm for 5min;

7) Cell supernatants were collected and spleen cells were resuspended with 20mL RPMI1640+10% fetal bovine serum;

8) Counting spleen cells;

3. fusion of immune spleen cells and myeloma cells

1) Mixing spleen cells 1×10 ⁸ and myeloma cells 1×10 ⁷, centrifuging at 900-100rpm for 5min, discarding supernatant, washing with 25ml RPM 1640 culture medium (without additive), centrifuging again, discarding supernatant;

2) Slowly adding 1.5mL PEG1500 to every 3×10 ⁸ cells, incubating at 37deg.C for 1min, slowly adding 20mL RPM 1640, centrifuging, and discarding supernatant;

3) Calculating the total amount of HAT screening medium required, and resuspending cells with HAT screening medium;

4) The cells were then directly added to feeder cells plated 96-well plates for screening culture at 100 μl per well.

4. Screening of clones

1) After 10-14 days of cell growth in 96-well plates, the clones were visible to the naked eye, and part of the well medium began to yellow, and the supernatant was detected by ELISA;

2) After 3 days, gram Long Tiaochu positive was detected using ELISA;

3) After the cells grew, positive clones were picked again using ELISA assay, and 25 positive clones were picked in total.

4) The 25 positive clones were subjected to ELISA screening by three different systems.

Example 3 selection of hybridoma cells

The hybridoma cell screening capable of secreting monoclonal antibodies is carried out by using antigens prepared by three expression systems, wherein the three antigens are p34 antigen prepared by CHO-S cell expression, p34 antigen prepared by SF9 insect cell expression and p34 antigen prepared by transfecting HEK293 cells with recombinant adenovirus vector pAd5-p 34.

Wherein, the process of preparing p34 antigen by SF9 insect cell expression is as follows:

Connecting the gene sequence of the P34 protein of the African swine fever virus to a shuttle plasmid pFastBac of the Bacmid to obtain an expression vector pFastBac-p34, using a competent cell DH10Bac of the Bacmid to convert the pFastBac-p34 into the expression vector, extracting a viral genome to obtain the Bacmid-p34, transfecting SF9 cells with the Bacmid-p34, and carrying out induced expression and purification to obtain the P34 protein of the African swine fever virus. The Bacmid system was purchased from Invitrogen, and the amplification of the p34 gene, vector cleavage, ligation, transfection and purification of the p34 protein were the same as in example 1.

Wherein, the process of preparing p34 antigen for coating by transfecting HEK293 cells with recombinant adenovirus vector pAd5-p34 is as follows:

Inoculating recombinant adenovirus vector pAd5-p34 into HEK293 cells (T225), blowing and sucking the cells into a 50ml centrifuge tube before the lesions float after 2-3 days, collecting the cells at 1200rpm for 5min, re-suspending the cells with 3-5ml PBS, repeatedly freezing and thawing for 2 times, centrifuging to remove cell fragments, re-suspending the supernatant with a pH9.6 carbonate buffer solution, performing coating treatment on an ELISA plate, coating antigen 100 mu L/hole, standing overnight at 4 ℃, and obtaining antigen concentration (2 mu g/ml); blank 293 cells were prepared as negative controls in the same manner;

Closing: the next day the coating was discarded, washed 3 times with PBST, and after rinsing, 100. Mu.L of 2% BSA (PBS dilution) was added to each well and blocked overnight at 4 ℃.

Incubating the antibody:

1) Thirdly, discarding the sealing solution, washing 3 times by using PBST, and directly loading 100 mu L of hybridoma supernatant in each hole after beating to dryness;

2) Negative and positive sera were diluted 1:1000 with PBS, 100. Mu.L/well;

3) Incubating for 45min at 37 ℃;

4) Washing 3 times with PBST, adding 100 mu L/well diluted goat anti-mouse HRP-labeled secondary antibody, and incubating at 37 ℃ for 45min for color development:

5) Washing 3 times by PBST, adding 100 mu L/well TMB color development liquid into each well, and developing for 20min;

6) The OD450 values were then read by a microplate reader after 100. Mu.L/Kong Zhongzhi of liquid (2M H ₂SO₄) per well.

The method of coating, blocking and incubating the antibodies with the p34 antigen prepared by CHO-S cell expression and the p34 antigen prepared by SF9 insect cell expression, respectively, was further the same as described above, with 100 μl/well of the coating antigen.

Monoclonal antibodies secreted by hybridoma cells were detected using the following method:

western blotting for hybridoma monoclonal antibody detection:

1. Preparing a sample:

For example, pAd5-p34 diseased virus is inoculated into HEK293 cells, after 2-3 days of disease, the cells are taken out and blown into a centrifuge tube, 12000rpm,5min, the cells are collected, 160 mu LPBS is added and mixed evenly with 40 mu L of 5 Xprotein Loading Buffer, and the HEK293 blank cells are boiled in boiling water and synchronous as a control operation;

2. Western Blot: the detection protocol was revised with reference to SOP-Western Blot (Western Blot).

(II) detection of antibody ascites and part of hybridoma supernatant were performed simultaneously by ELISA and Western blotting:

ELISA: the same operation is carried out;

western blotting: the detection protocol was revised with reference to SOP-Western Blot (Western Blot).

ELISA experimental results are shown in the following Table:

Three clones (numbers 747, 696 and 411, underlined in the table) were screened by ELISA and detected simultaneously by three systems of antigen proteins expressed, wherein the 747 clone was selected as the dominant positive clone for subcloning to obtain subclones encoding 83, identified as IgG1 by subtype, designated AYP34-83.

Further, the monoclonal antibody ascites is prepared by AYP34-83, the BALB/c mice are intraperitoneally injected by AYP34-83, ascites is collected and purified, the pAd5-P34 protein packaged by adenovirus is used for WB detection, the result is shown in figure 8, and the figure shows that a band appears at the corresponding size position, which shows that the prepared monoclonal antibody can have obvious immune reaction with the P34 protein, has better reaction characteristics, and shows that the monoclonal antibody can be applied to the detection of the P34 protein packaged by adenovirus.

The application successfully induces and expresses the African swine fever virus p34 protein, and screens and identifies 1 strain of hybridoma cell capable of secreting monoclonal antibody against p34, wherein the hybridoma cell can secrete monoclonal antibody against the African swine fever virus p34, and the monoclonal antibody has higher stability and specificity, can be used for preparing preparations, kits, test strips or biochips for detecting the African swine fever virus, and lays a foundation for rapidly and conveniently realizing qualitative and quantitative detection of the African swine fever virus.

Wherein, the preparation process of the recombinant adenovirus vector pAd5-p34 of one embodiment is as follows:

Construction of recombinant shuttle plasmid pS5E1-p34

1. According to the African Swine Fever (ASFV) p34 gene sequence in GenBank, the p34 gene sequence is shown in SEQ ID No.3, and the gene fragment is synthesized by the biological company.

ATGGGGAATCGCGGGTCTTCTACCTCCTCTCGCCCCCTGCCCTCCTCCGAAGCCAATATCTATGCCAAGCTGCAGGACCATATCCAGCGCCAGACCCGCCCCTTCTCCGGAGGAGGATACTTTAACGGAGGCGGCGACAAAAACCCCGTGCAGCACATCAAGGACTACCACATCGACAGCGTGAGCTCCAAAGCCAAGCTCAGAATCATCGAAGGAATTATCCGCGCCATCGCCAAGATCGGCTTTAAGGTGGACACAAAACAGCCCATCGAAGACATCCTCAAGGACATCAAGAAACAGCTGCCCGACCCCCGCGCCGGCTCTACCTTTGTGAAGAACGCCGAAAAACAGGAAACCGTCTGCAAGATGATTGCCGACGCCATCAACCAGGAATTCATCGACCTGGGCCAGGACAAGCTGATCGACACCACCGAAGGGGCCGCCTCCATCTGCCGCCAGATCGTCCTCTATATCAATAGCCTGACCCACGGACTGCGGGCCGAATACCTGGACGTGCACGGCAGCATCGAGAACACCCTGGAAAACATCAAACTGCTGAACGACGCCATCAAACAGCTGCACGAACGGATGGTGACCGAAGTGACCAAGGCCGCCCCCAACGAGGAAGTGATTAACGCTGTGACAATGATCGAAGCCGTGTACCGCCGCCTGCTCAACGAGCAGAACCTCCAGATCAACATCCTCACCAACTTCATCGACAACATCCTGACCCCCACCCAGAAAGAACTGGACAAGCTCCAGACCGACGAAGTCGACATCATCAAACTCCTCAACGACACCAACAGCGTCCTCGGCACCAAAAACTTCGGCAAAGTGCTGAGCTACACCCTCTGCAACCTGGGCATCGCCGCCAGCGTCGCCAACAAGATCAACAAGGCCCTCCAGAAAGTGGGACTGAAGGTGGAGCAGTATCTCCAGAGCAAGAACTGGGCCGAATTCGACAAAGAACTCGACCTGAAACGCTTCTCCGGCCTGGTGAGCGCCGAGAACATCGCCGAATTCGAGAAGGCTGTGAACCTGCTGAGGCAGACCTTCAACGAAAGGCACAAGATCCTGGAGAACAGCTGCGCCAAAAAGGGCTACCCCTACGACGTGCCCGACTATGCCTGA(SEQ ID No.3)

2. The upstream and downstream primers of p34 were designed based on the African Swine Fever (ASFV) p34 gene sequence in GenBank, which was synthesized by biological company, and the primer sequences are shown below.

p34-BamHI-F:CGCggatccgccaccATGGGGAATCGCGGGTCTTCTAC(SEQ ID No.4)；

p34-EcoRV-R：CGgatatcTCAGGCATAGTCGGGCACGTCGT(SEQ ID No.5)；

The underlined portions of the upstream primer P34-BamHI-F and the downstream primer P34-EcoRV-R, respectively, were introduced with the cleavage sites BamHI and EcoRV, respectively.

3. The synthesized p34 gene fragment is used as a template, the p34-BamHI-F/p34-EcoRV-R is used as a primer, the p34 gene is amplified, and the p34 target gene fragment is obtained, and the amplification result is shown in figure 9.

4. The amplified p34 target gene fragment was subjected to PCR product purification using an Axygen PCR purification kit (see the description for specific procedures).

5. Double enzyme digestion is carried out on the purified product of the step 4 by using restriction enzymes BamHI and EcoRV to obtain a linearized p34 gene fragment; the shuttle plasmid pS5E1 was double digested with restriction enzymes BamHI and EcoRV to obtain pS5E1 vector fragment, and the double digestion system was as follows:

P34 Gene fragment or pS5E1 vector (2. Mu.g)	4-8μL
		10×Buffer	5μL
BamHI	1μL
		EcoRV	1μL
ddH₂O	Complement to
		Totals to	50μL

Reaction conditions: the temperature was 37℃for 30 minutes;

6. Performing gel recovery and purification on the linearized p34 gene fragment obtained in the step 5 and the pS5E1 vector fragment by using an Omega gel recovery and purification kit, and connecting the purified products of the p34 gene fragment and the pS5E1 vector fragment in a connection ratio of p34 gene fragment to pS5E1 vector fragment (molar ratio) =1: 3, obtaining pS5E1-p34, transforming into competent DH5a (competent preparation and transformation method see third edition of Experimental guidelines for molecular cloning, coating on Amp-resistant plates, and carrying out positive clone screening, wherein the connection system is as follows:

Target gene p34 fragment	2-5μL
		Vector pS5E1-p34 fragment	2-4μL
10×T4 Buffer	1μL
		T4 ligase	1μL
Sum up	10μL

Connection conditions: connecting at normal temperature for 60 minutes;

7. And (3) performing colony PCR screening on the positive colonies obtained in the step (6), picking the screened positive clones in 5ml of LB liquid medium (containing Amp resistance), performing overnight shaking culture, extracting plasmids, performing BamHI and EcoRV digestion verification, sequencing by a biological company after the verification is correct, and completely matching with expected gene sequences through sequence comparison, wherein the construction of the recombinant shuttle plasmids pS5E1-p34 is successful, and the map of the pS5E1-p34 vectors is shown in figure 10.

Construction of (II) recombinant adenovirus vector pAd5-p34

1. The recombinant shuttle plasmid pS5E1-p34 obtained above was subjected to single cleavage with restriction enzyme PacI to obtain linearized recombinant shuttle plasmid pS5E1-p34, and the single cleavage system was as follows:

recombinant shuttle plasmid pS5E1-p34 (2-3 ug)	10-12μL
		Restriction enzyme PacI	1μL
10×Buffer	4μL
		Distilled water	Complement to
Totals to	40μL

Reaction conditions: the temperature was 37℃for 30 minutes; inactivating at 65 ℃ for 20 minutes;

Further, the adenovirus backbone vector pAd5 (human adenovirus type 5 vector) was subjected to single cleavage with restriction enzyme SwaI to give linearized pAd5, the single cleavage system was as follows:

adenovirus backbone vector pAd5 (2-3 ug)	10-15ul
		Restriction enzyme SwaI	1ul
10×Buffer3.1	4ul
		Distilled water	Complement to
Totals to	40μL

Reaction conditions: the temperature is 25 ℃ for 30 minutes; inactivating at 65 ℃ for 20 minutes;

2. The linearized recombinant shuttle plasmid pS5E1-p34 and the adenovirus backbone vector pAd5 obtained in the step 1) are respectively subjected to dephosphorylation, and the dephosphorylation system is shown as follows:

Linearized recombinant shuttle plasmid pS5E1-p34 or linearized adenovirus backbone vector pAd5	40μL
		Dephosphorylase enzyme	1μL
Dephosphorylase Buffer	5μL
		Distilled water	4μL
Sum up	50μL

Reaction conditions: the temperature is 37 ℃ for 60 minutes; inactivating at 65 ℃ for 5 minutes;

3. Purifying the product after the dephosphorylation in the step 2) by using a phenol chloroform isoamyl alcohol (PCI) method;

4. Co-transforming BJ5813 competent cells (purchased from Bomaid biotechnology Co., ltd.) with 100ng of purified recombinant shuttle plasmid pS5E1-p34 and 100ng of purified adenovirus skeleton vector pAd5, coating the transformed product with LB plate containing Kan, and culturing at 37 ℃ for 12-16 h;

5. Selecting colony for PCR identification positive colony in 5mL LB liquid medium containing Kan, and shake culturing at 37 ℃ for 12-16 h;

6. extracting plasmid, carrying out plasmid PCR identification and single enzyme digestion identification of PacI and XhoI on plasmid, picking up recombinant positive plasmid, and obtaining recombinant adenovirus vector pAd5-p34 for subsequent experiments. The XhoI cleavage results of the recombinant adenovirus vector pAd5-p34 are shown in FIG. 11, wherein lanes M are 15000DNA markers, lanes 1 and 2 are pAd5-p34 XhoI single cleavage, and lane 3 is pAd5 XhoI single cleavage, which indicates that the vector construction is accurate. The vector map of recombinant adenovirus vector pAd5-p34 is shown in FIG. 12.

The construction method of the shuttle plasmid pS5E1 in one embodiment is as follows:

The backbone of the shuttle plasmid pS5E1 adopts basic elements (2796 bp) such as puc origin, amp and the like, and the partial sequence of the ITR of the left arm of Ad5 (355 bp), the partial sequences of the PIX and PIVa2 of the right arm (2100 bp) and the SV40early polyA of CMV-MCS (944 bp) (160 bp).

(One) Gene Synthesis: the pS5E1 skeleton (2796 bp), CMV promoter, MCS, SV40 early polyA terminator (957 bp) were synthesized by Bomeide company, and the base sequence of pS5E1 skeleton is shown in SEQ ID No. 6.

GAATTCCGTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCCGCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCGTAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTTCCGCACCCCGGAAATGGTCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCATTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCTTATCGAAA(SEQ ID No.6).

(II) primer design

puc-Ad5-right arm-F：

TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT(SEQ ID No.7)；

Ad5-right arm-CMV-R：

ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATATAAG(SEQ ID No.8)；

CMV-F：GTATCTGCTCCCTGCTTGTG(SEQ ID No.9)；

CMV-SV40-R：TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG(SEQ ID No.10)；

SV40-F：CTTCGCCCACCCCAACTTGT(SEQ ID No.11)；

SV40-R：AGAGGTCGACGGTATACAGAC(SEQ ID No.12)；

SV40-Ad5-left arm-F：

TGTCTGTATACCGTCGACCTCTCCGGGCCCTAGACAAATATTA(SEQ ID No.13)；

Ad5-left arm-puc-R：

ACACTATAGAATACACGGAATTCTTAATTAAATCATCAATAATATACCTTATTTTG(SEQID No.14)；

puc-F：GAATTCCGTGTATTCTATAGTGT(SEQ ID No.15)；

puc-R：TTTCGATAAGCCAGCTGCATTA(SEQ ID No.16)；

(III) amplification of the fragment of interest

1. The CMV promoter MCS fragment of the pS5E1 shuttle plasmid was amplified using pCDNA3.1 (+) as template (this plasmid was purchased from Sieimer), CMV-F and CMV-SV40-R as primers;

Amplification system: 50ng of pCDNA3.1 (+) plasmid, 1. Mu.L of 10. Mu.M CMV-F primer, 1. Mu.L of 10. Mu.M CMV-SV40-R primer and 20. Mu.L of Q5 high-fidelity enzyme; moisturizing to 40 mu L; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 1min,35 cycles; 72℃for 5min.

2. Amplifying the SV40-earlypolyA fragment of the pS5E1 shuttle plasmid by using pCDNA3.1 (+) as a template and SV40-F and SV40-R as primers;

Amplification system: 50ng of pCDNA3.1 (+) plasmid, 1. Mu.L of 10. Mu.M SV40-F primer, 1. Mu.L of 10. Mu.M SV40-R primer, 20. Mu.L of Q5 high-fidelity enzyme, and water was added to 40. Mu.L; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃,10 sec,35 cycles; 72 ℃ for 5min;

3. the fragments were purified using the Axygen gel recovery kit.

4. PCR amplification of pS5E1 shuttle plasmid skeleton PUC with pS5E1 skeleton synthesized by Bomeid company as template and PUC-F and PUC-R as primers;

amplification system: 50ng of pS5E1 backbone plasmid, 1 mu L of 10 mu M puc-F primer, 1 mu L of 10 mu M puc-R primer, 20 mu L of Q5 high-fidelity enzyme, and water supplementing to 40 mu L; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 1min20sec,35 cycles; 72℃for 5min.

5. Amplifying the left arm of the pS5E1 shuttle plasmid by using pAd5 plasmid as a template and SV40-Ad5-left arm-F and Ad5-left arm-puc-R as primers;

Amplification system: 50ng of pAd5 plasmid, 1. Mu.L of 10. Mu.M SV40-Ad5-left arm-F primer, 1. Mu.L of 10. Mu.M Ad5-left arm-puc-R primer, 20. Mu.L of Q5 high-fidelity enzyme, and 40. Mu.L of water are added; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 20s,35 cycles; 72℃for 5min.

6. Amplifying the right arm of the pS5E1 shuttle plasmid with pAd5 plasmid as template and puc-Ad5-right arm-F and Ad5-right arm-CMV-R as primers;

Amplification system: 50ng of pAd5 plasmid, 1. Mu.L of 10. Mu.M puc-Ad5-right arm-F primer, 1. Mu.L of 10. Mu.M Ad5-right arm-CMV-R primer, 20. Mu.L of Q5 high-fidelity enzyme, and water to 40. Mu.L; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 15s,35 cycles; 72℃for 5min.

7. The CMV-MCS-SV40 earlypolyA fragment of the pS5E1 shuttle plasmid was amplified using the gel recovery product CMV-MCS as template and CMV-F and SV40-R as primers;

Amplification system: 50ng of pAd5 plasmid, 1. Mu.L of 10. Mu.M CMV-F primer, 1. Mu.L of 10. Mu.M SV40-R primer, 20. Mu.L of Q5 high-fidelity enzyme, and water to 40. Mu.L; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 40s,35 cycles; 72 ℃ for 5min;

The agarose gel electrophoresis results of the CMV-MCS fragment and the SV40 earlypolyA fragment are shown in FIG. 13A; the agarose gel electrophoresis results of the CMV-MCS-SV40 earlypolyA fusion fragment, the PUC fragment, the Ad5 right arm and the Ad5 left arm are shown in FIG. 13B.

Ligation transformation of fragments (IV): purifying fragments by using an Axygen gel recovery kit, connecting the four fragments of pS5E1 framework PUC fragment, ad5 left arm, ad5 right arm and CMV-MCS-SV40earlypolyA by using a Bomad corporation seamless cloning kit, wherein the connecting system is that the fragment of pS5E1 framework PUC 50ng, the fragment of Ad5 left arm 50ng, the fragment of Ad5 right arm 50ng, the fragment of CMV-MCS-SV40 polyA 50ng are connected by 2X Smealess Cloning Mix mu L, pS, the fragment of CMV-MCS-SV40 polyA 50ng are added with water to 20 mu L, and the mixture is incubated for 40 minutes at 50 ℃; the ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

And (fifth) plasmid verification:

1. Colony PCR verification: the agarose gel electrophoresis results of the CMV-MCS-SV40 polyA and Ad5 left arm amplified by using the primer CMV-F, ad-left arm-puc-R as the primer colony PCR are shown in FIG. 13C, and the results show that the fragment size is basically consistent with the expected theoretical molecular weight, and the plasmid construction is successful, positive clone is selected, plasmid is extracted, and enzyme digestion is performed for further verification.

2. And (3) enzyme digestion verification: the positive clone is selected and placed in 5mL LB liquid medium containing ampicillin resistance for culturing for 12-15 hours, the plasmid is extracted for enzyme digestion verification, the experimental result is shown in FIG. 13D, wherein M is 15000bp marker, lanes 1-6 on the left side of the graph are NcoI single enzyme digestion, lanes 1-6 on the right side of the graph are PacI single enzyme digestion, and the accurate construction of the shuttle plasmid pS5E1 can be seen.

The construction method of the adenovirus skeleton vector pAd5 of one embodiment is as follows:

In A549 cells ] Amplification of wild type human adenovirus type 5 in CCL-185) (/ >VR-5), gene sequence AC_ 000008.1), collecting and concentrating virus liquid, extracting adenovirus genome by HirtVirual DNA Extract method, constructing linear hAD5 gene into circular supercos-Ad5 vector plasmid by cosmid method, cutting hAD5 adenovirus E1 region by CRISPR/cas9, designing gRNA as follows:

hAD5-E1 upstream gRNA:

GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E1 downstream gRNA:

GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

Designing gRNA sites on the upstream and downstream of the hAD 5E 1 region, cutting, recovering a large fragment vector, designing primers, respectively inserting ITR and PIX sequences on the upstream and downstream by fusion PCR, introducing SwaI enzyme cutting sites, then performing seamless cloning on the fused fragments and the vector to obtain an E1 knocked-out supercos-Ad5 delta E1 adenovirus vector, then performing E3 region excision on the supercos-Ad5 delta E1 plasmid, and designing gRNA as follows:

hAD5-E3 upstream gRNA:

GCGGGACAUUUCAGAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E3 downstream gRNA:

GUAAGGGUACUGCUAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

gRNA sites are designed on the upstream and downstream of the hAD 5E 3 region, large fragment vectors are recovered after cutting, primers are designed, fusion PCR is carried out on Fiber with excessive excision on the upstream and downstream of E3 and pVIII sequences, a seamless cloning mode is used for connection, and the E3 knockout vector is obtained and named pAd5.

It will be appreciated that the recombinant adenovirus vector pAd5-p34 can also be prepared by methods commonly used in the art, and the application is not limited thereto.

The foregoing description is only of a preferred embodiment of the invention, and is not intended to be exhaustive of all embodiments of the invention. The above-described embodiments are not intended to limit the invention, and various modifications and variations of the invention will be apparent to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Jiaming (solid Ann) Biotech Co., ltd

<120> Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 1

cccaagctta tggggaatcg cgggtcttct a 31

<210> 2

<211> 51

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

atttgcggcc gcgctgccgc gcggcaccag gccctttttg gcgcagctgt t 51

<210> 3

<211> 1131

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

atggggaatc gcgggtcttc tacctcctct cgccccctgc cctcctccga agccaatatc 60

tatgccaagc tgcaggacca tatccagcgc cagacccgcc ccttctccgg aggaggatac 120

tttaacggag gcggcgacaa aaaccccgtg cagcacatca aggactacca catcgacagc 180

gtgagctcca aagccaagct cagaatcatc gaaggaatta tccgcgccat cgccaagatc 240

ggctttaagg tggacacaaa acagcccatc gaagacatcc tcaaggacat caagaaacag 300

ctgcccgacc cccgcgccgg ctctaccttt gtgaagaacg ccgaaaaaca ggaaaccgtc 360

tgcaagatga ttgccgacgc catcaaccag gaattcatcg acctgggcca ggacaagctg 420

atcgacacca ccgaaggggc cgcctccatc tgccgccaga tcgtcctcta tatcaatagc 480

ctgacccacg gactgcgggc cgaatacctg gacgtgcacg gcagcatcga gaacaccctg 540

gaaaacatca aactgctgaa cgacgccatc aaacagctgc acgaacggat ggtgaccgaa 600

gtgaccaagg ccgcccccaa cgaggaagtg attaacgctg tgacaatgat cgaagccgtg 660

taccgccgcc tgctcaacga gcagaacctc cagatcaaca tcctcaccaa cttcatcgac 720

aacatcctga cccccaccca gaaagaactg gacaagctcc agaccgacga agtcgacatc 780

atcaaactcc tcaacgacac caacagcgtc ctcggcacca aaaacttcgg caaagtgctg 840

agctacaccc tctgcaacct gggcatcgcc gccagcgtcg ccaacaagat caacaaggcc 900

ctccagaaag tgggactgaa ggtggagcag tatctccaga gcaagaactg ggccgaattc 960

gacaaagaac tcgacctgaa acgcttctcc ggcctggtga gcgccgagaa catcgccgaa 1020

ttcgagaagg ctgtgaacct gctgaggcag accttcaacg aaaggcacaa gatcctggag 1080

aacagctgcg ccaaaaaggg ctacccctac gacgtgcccg actatgcctg a 1131

<210> 4

<211> 38

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

cgcggatccg ccaccatggg gaatcgcggg tcttctac 38

<210> 5

<211> 31

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

cggatatctc aggcatagtc gggcacgtcg t 31

<210> 6

<211> 2796

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

gaattccgtg tattctatag tgtcacctaa atcgtatgtg tatgatacat aaggttatgt 60

attaattgta gccgcgttct aacgacaata tgtacaagcc taattgtgta gcatctggct 120

tactgaagca gaccctatca tctctctcgt aaactgccgt cagagtcggt ttggttggac 180

gaaccttctg agtttctggt aacgccgttc cgcaccccgg aaatggtcag cgaaccaatc 240

agcagggtca tcgctagcca gatcctctac gccggacgca tcgtggccgg catcaccggc 300

gccacaggtg cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct 360

cgccacttcg ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc 420

gggggactgt tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac 480

ggcctcaacc tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga 540

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 600

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 660

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcattcacc gtcatcaccg 720

aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 780

ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 840

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 900

atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 960

attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 1020

gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 1080

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 1140

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 1200

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 1260

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 1320

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 1380

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 1440

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 1500

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 1560

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 1620

aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 1680

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 1740

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 1800

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 1860

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 1920

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 1980

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 2040

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 2100

ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 2160

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 2220

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 2280

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 2340

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 2400

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 2460

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 2520

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 2580

ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 2640

accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 2700

gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 2760

gttggccgat tcattaatgc agctggctta tcgaaa 2796

<210> 7

<211> 42

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

taatgcagct ggcttatcga aacgtggaat gcgagaccgt ct 42

<210> 8

<211> 46

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

acacacaagc agggagcaga tacaagggtg ggaaagaata tataag 46

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

gtatctgctc cctgcttgtg 20

<210> 10

<211> 44

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

taaacaagtt ggggtgggcg aagtgatcag cgggtttaaa cggg 44

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 11

cttcgcccac cccaacttgt 20

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 12

agaggtcgac ggtatacaga c 21

<210> 13

<211> 43

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 13

tgtctgtata ccgtcgacct ctccgggccc tagacaaata tta 43

<210> 14

<211> 56

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 14

acactataga atacacggaa ttcttaatta aatcatcaat aatatacctt attttg 56

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 15

gaattccgtg tattctatag tgt 23

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 16

tttcgataag ccagctgcat ta 22

Claims

1. A hybridoma cell strain secreting a monoclonal antibody of an African swine fever virus p34 protein is characterized in that the preservation number of the hybridoma cell strain is CCTCC NO: C202042.

2. A monoclonal antibody to the p34 protein of african swine fever virus, wherein the monoclonal antibody is secreted by the hybridoma cell line of claim 1.

3. Use of the african swine fever virus p34 protein monoclonal antibody of claim 2 in the preparation of an immunoassay tool for detecting african swine fever virus.

4. The use according to claim 3, wherein the immunoassay means is a reagent, a kit, a test strip or a biochip.

5. A kit for detecting the presence and/or level of african swine fever virus in a sample, comprising the african swine fever virus p34 protein monoclonal antibody of claim 2.

6. The kit according to claim 5, wherein the kit further comprises an African swine fever virus cell culture or an African swine fever virus p34 protein coated ELISA plate, an HPR-labeled goat anti-mouse secondary antibody, a washing solution, a blocking solution, an antibody dilution solution, a color development solution and a stop solution.