CN113897390A

CN113897390A - Recombinant adenovirus vaccine for African swine fever and construction method thereof

Info

Publication number: CN113897390A
Application number: CN202110762389.3A
Authority: CN
Inventors: 李娜; 陈平; 张婷婷; 钟鑫涛; 张风苹; 张利娟; 祝志刚; 王暄; 李娅芳; 李楠
Original assignee: Jiaxing Anyu Biotechnology Co ltd
Current assignee: Jiaxing Anyu Biotechnology Co ltd
Priority date: 2020-07-06
Filing date: 2021-07-06
Publication date: 2022-01-07
Anticipated expiration: 2041-07-06
Also published as: CN113897390B

Abstract

The invention discloses an African swine fever virus vaccine which is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of the African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells. Wherein, the four antigen genes of the African swine fever virus are L8Lubiqutin, I215L, I73Rhbsag and E146L respectively. The construction of the recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus mainly comprises knocking out E1, E3, E2a and E4 genes of the adenovirus vector through CRISPR/cas9, and constructing shuttle plasmids of E1 and E4 regions, wherein the shuttle plasmids are respectively used for expressing L8Lubiqutin, I215L, I73Rhbsag and E146L genes, so that a brand-new adenovirus vector is obtained. Compared with the first generation adenovirus vector, the vector increases the vector capacity by about 3kb, and then the recombinant adenovirus with higher titer is obtained by packaging through a 293TD37 cell line, and is used for preparing a recombinant adenovirus vaccine of African swine fever. The invention can greatly improve the capacity of the adenovirus vector vaccine, and enhances the specific immune response to the African swine fever virus by using a mode of simultaneously expressing four independent antigens of the African swine fever on one adenovirus vector.

Description

Recombinant adenovirus vaccine for African swine fever and construction method thereof

The application claims priority of the prior application of China, application number 2020106427557, 6/7/2020; all of which are intended to be part of this invention.

Technical Field

The invention relates to the technical field of genetic engineering and the field of immunology, in particular to a recombinant adenovirus vaccine of African swine fever virus and a construction method thereof.

Background

African Swine Fever (ASF) is a highly contagious swine viral disease. High mortality rates approaching 100% can result in domestic pigs. ASF is caused by ASF virus (ASFVrus), which is a large double-stranded DNA virus, mainly replicates in the cytoplasm of macrophages, has a 20-hedral structure, has a diameter of 175-215 nm, has a genome full length of 170-190 kb, contains 151 open reading frames, can encode 150-200 proteins, and is a double-stranded linear DNA virus with an envelope. The structural proteins of ASFV virion are P30, P72, P49, P54, P220, P62, pB602L, CD2v protein, etc., and the vaccine based on one or two subunits has not been able to induce immune power strong enough to have significant protection effect on vaccinees.

China finds ASF epidemic situations in 2018, and huge direct and indirect economic losses are brought. Therefore, the development of a vaccine against ASFV is urgently required. It has been reported that previous studies of ASFV vaccines have mainly focused on inactivated vaccines and attenuated vaccines. However, inactivated vaccines do not induce an effective protective response; the biological safety of attenuated vaccines is a major limiting factor in their use, and attenuated strains are not allowed to be studied in our country. However, in the case where live virus experiments cannot be performed at the present stage, it is necessary to provide a vaccine to elicit an immune response against as many antigens as possible.

Therefore, there is a need to develop a novel ASFV vaccine. Potential vaccine candidates are live vector vaccines. Compared with other vaccines, live vector vaccines offer advantages in that: (1) can actively infect target tissues or cells, and improves the efficiency of foreign genes entering the cells; (2) the carrier has adjuvant effect and can induce the production of cytokines and chemokines; (3) most induce a long-term immune response. Advantageously, it is desirable to deliver as much pathogen protein as possible with as few live vectors as possible.

Live vector vaccines refer to the cloning of a gene encoding a protein of a pathogen into a live viral vector, which is then used to immunize an animal and express the protein in the animal, thereby inducing an immune response against the protein. Adenovirus type 5 has many advantages as a vector for expressing African swine fever antigen protein: firstly, the adenovirus expression vector is replication-defective, can only be produced and prepared in a unique complementary cell line, simultaneously, the adenovirus does not need to be integrated into the host cell genome, the target gene is expressed in a free state outside the host cell genome, the integration mutation carcinogenic possibility is low, the genotoxicity is low, and the safety of vaccine preparation is good; secondly, the recombinant adenovirus vector can obtain higher titer, is beneficial to large-scale production, and has high factory efficiency and low production cost; the research on the structure, the characteristics and the function of the adenovirus type 5 is relatively deep at present, the adenovirus vector is easy to copy, the operation is simple, and the research is facilitated; fourthly, 6K gene is knocked out from the genome of the common generation adenovirus vector, and 7.5K exogenous gene can be inserted into the genome, so that the genome has larger capacity; fifthly, the adenovirus is relatively stable and can be purified, concentrated and stored.

The prior art reports on some live vector vaccines. For example, ASFV p32, p54, p72 and pp62 genes are respectively recombined into a human adenovirus Ad5 vector to carry out 'cocktail' type immunity, and good antigen-specific CTL reaction is obtained; then, 7 ASFV antigen genes including ASFV A151R, B119L, B602L, EP402R delta PRR, B438L and K205R-A104R are recombined into replication-defective adenovirus vectors, and strong humoral immune response and cellular immune response can be induced after mixed immunization in a 'cocktail' manner. However, in the case of "cocktail" immunization, each ASFV antigen gene must be recombined into a replication-defective adenovirus vector, and therefore, the number of vectors required is very large, and there is a risk of immune reaction against the adenovirus vector during the immunization. CN108504686A and CN108504687A provide recombinant adenovirus vectors expressing EP153R and EP402R genes of ASFV, respectively. CN109652449A discloses a recombinant adenovirus vector co-expressed by two antigen genes of EP153R and EP402R, and CN109735567A discloses a recombinant adenovirus vector co-expressed by two antigen genes of EP153R and P54.

However, in order to further enhance the specific immune response to ASF, the antigenic gene capacity of adenoviral vectors needs to be further increased, and as many pathogen proteins as possible need to be delivered with as few live vectors as possible to elicit an immune response against as many antigens as possible.

CN110269932A discloses fusion of 5-7 antigen genes such as A104R, A151R, B119L, B602L, CD2v, K205R and P49 of ASFV based on adenovirus vector for preparing live vector vaccine. However, fusion of multiple antigen genes presents the risk of reduced immunogenicity and possible immune failure, and therefore, it is necessary to express completely independent antigen genes on each adenoviral vector in order to increase vaccine activity.

However, no recombinant adenovirus vector co-expressed by four antigen genes exists in the prior art, and no recombinant adenovirus vector co-expressed by four antigen genes of L8Lubiqutin, I215L, I73Rhbsag and E146L of ASFV is applied to the development of live vector vaccines.

Disclosure of Invention

In order to solve the problems, the invention provides an African swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of the African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells; the four antigen genes are respectively L8Lubiqutin, I215L, I73Rhbsag and E146L, wherein L8Lubiqutin is obtained by adding a molecular adjuvant ubiqutin to L8L, I73Rhbsag is obtained by adding a molecular adjuvant hbsag to I73R, L8Lubiqutin and I215L are expressed in an E1 region, and I73Rhbsag and E146L are expressed in an E4 region, so that a recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L co-expressed by the four antigen genes is formed.

Wherein, the recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73 Rhbbsag-E146L can realize recombinant adenovirus packaging only through 293TD37 cells constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the cell strain preservation number of the 293TD37 cell is as follows: CCTCC NO of C201996, and is preserved in China center for type culture Collection.

Ordinary 293 cells contain E1 gene of adenovirus type 5, and adenoviruses with E1 and E3 knocked-out can replicate in the cell line, but adenoviruses with E4 and E2a knocked-out genes cannot replicate in 293 cells.

293TD37 cell strain invented by the group of the invention, and applied for patent CN201911033247.2, preserved in 5.8.2019 and China center for type culture Collection, with the preservation number of CCTCC NO: C2019111, and classified name being human embryonic kidney transformed cell AY293-TD-37, the cell strain contains E2a-DBP gene and E4-ORF6/7 gene of adenovirus, can be used for packaging E2a-DBP gene and E4 gene-deficient second generation adenovirus to form complete infectious second generation adenovirus particles, compared with the first generation adenovirus, the second generation adenovirus has greatly reduced RCA occurrence probability, lays a foundation for preparing live vector vaccine, and because of deletion of E2a-DBP and E4 gene, the packaging capacity is increased again compared with E2a mutant or E4 deleted second generation adenovirus, further improves the insertion amount of adenovirus vector foreign gene, has important significance for enhancing the application level of the adenovirus vector.

Wherein, L8L, ubiqutin, I215L, I73R, hbsag, E146L and pAd5LCL3 respectively have nucleotide sequences shown in Seq ID No.1, Seq ID No.2, Seq ID No.3, Seq ID No.4, Seq ID No.5, Seq ID No.6 and Seq ID No.7 in the sequence table.

The African swine fever virus has more than 160 antigen genes, and the inventor selects 20 antigen genes with stronger immune effect through a large amount of screening experiments, wherein the 20 antigen genes are respectively as follows: p72, B602L, P30, P54, CP129R, MGF5L6L, CP312R, MGF110-4L, L8L, I215L, I73R, E146L, EP402R, EP153R, I177L, K205R, F317L, a151R, P34, pp 62; the 20 antigen genes are divided into five groups according to the sizes of the gene fragments, and 4 antigen genes in each group can be co-expressed in the recombinant adenovirus vector pAd5LCL3 provided by the invention, namely four antigen genes can be completely and independently expressed in the same vector. The five groups of antigen gene vaccines (including 5 recombinant adenovirus vectors pAd5LCL3) form a complete African swine fever virus vaccine, and a very good immune effect is achieved. The invention selects four antigen genes of L8L, I215L, I73R, E146L and EP402R, and can be well matched and assembled in the same recombinant adenovirus vector, thereby completely and independently expressing the four antigen genes.

The research proves that the expression level of the E3 region for the foreign protein is not high, while the expression level of the antigen gene is higher when the E1 region and the E4 region are used for expressing the antigen genes, so that four antigens can be respectively expressed in the E1 region and the E4 region.

The E3 gene needs to be knocked out to be replication-defective due to the association with replication; the role of E3 is related to the immune escape of adenovirus; the E3 knockout region can increase the capacity of the adenovirus vector; and enables the adenovirus vector to be normally packaged.

On the other hand, the invention also provides a construction method of the recombinant adenovirus vector co-expressed by the four antigen genes of the African swine fever virus, which comprises the following steps:

1) e1 gene of adenovirus circular carrier plasmid is knocked out by CRISPR/cas9, SwaI enzyme cutting site is introduced, fused fragments and carrier are seamlessly cloned, E3 gene is knocked out by CRISPR/cas9, and seamless cloning mode is used for connection, so that adenovirus carrier plasmid pAd5 with E1 and E3 gene deletion is obtained.

2) E4 gene of the adenovirus circular carrier plasmid is knocked out by CRISPR/cas9, PCR amplification is used, I-ceI enzyme cutting sites are introduced, and a seamless cloning method is used to obtain adenovirus carrier plasmid pAd5 delta E4 with deletion of E1, E3 and E4 genes.

On the basis of knocking out E1 and E3 genes, knocking out the E4 gene can improve the capacity of an adenovirus vector and reduce the immunogenicity of the adenovirus vector, and meanwhile, a foreign gene can be inserted into an E4 region and can be expressed in a large amount at the E4 position without influencing the packaging of an adenosis vector. The foreign genes are expressed at the E1 and E4 genes, so that the mutual interference of a plurality of foreign genes in the same region can be avoided, the expression is more facilitated, unnecessary E4 related genes are reduced, the immunogenicity of the adenovirus is reduced, the adenovirus can exist in host cells for a long time, and the foreign genes can be expressed for a long time.

The gene of the E4 region plays a key role in immunogenicity, and expression of a large number of genes of the E4 region can enable a host to generate a stronger immune response and induce generation of antibodies, so that the adenovirus vector can express a target protein in the host for a long time, and therefore, the immunogenicity of the adenovirus vector can be reduced by knocking out unnecessary genes in the E4 region, and the vector can be expressed in a long time.

In order to completely knock out the E4 gene and facilitate the connection of large carrier plasmids, the CRISPR/cas9 method is used for knocking out the Fiber gene at the upstream of the E4 region and the E4 gene, a PCR method is used for amplifying part of the Fiber and introducing an I-ceI single enzyme cutting site, a Gibson seamless cloning method is used for connecting the redundant cut fragment to a carrier, and the carrier plasmid with the I-ceI single enzyme cutting site knocked out by E4 is obtained again. The vector plasmid was linearized using I-sceI, a shuttle plasmid for the E4 region was constructed, and the foreign gene was recombined into the E4 region and expressed in large quantities in the E4 region.

3) E2a gene of adenovirus circular carrier plasmid is knocked out by CRISPR/cas9, ORF6/7 expression frame of E4 region is placed at sequence position where E2a region is knocked out, and then seamless cloning method is used to obtain adenovirus carrier plasmid pAd5LCL3 with E1, E3, E4 and E2a gene deleted.

The sequences of ORF 1-ORF 5 in the E4 region are knocked out, E4promoter, ORF6, ORF7 and polyA sequences are reserved and inserted into the E2a position, so that the E4 position can express foreign genes. The DBP sequence of the E2a region was also knocked out. The adenovirus E2a gene is a DNA binding protein, and is related to the replication of adenovirus, and the structural protein of adenovirus and the packaging of adenovirus are not affected by knocking out the gene. DBP deletion can prevent or greatly reduce back-mutations. The knock-out of the partial sequences of E2a and E4 increased the vector capacity by about 3 kb.

The research finds that the genes related to the replication of the adenovirus are E1, E2, E3 and E4, and the deletion of the genes does not affect the expression of structural proteins of the adenovirus, does not hinder the packaging of the adenovirus, but can prevent the adenovirus from replicating; thus, these replication-associated cell lines are constructed so that replication-defective adenovirus vectors, in which the replication genes have been knocked out, can be packaged for replication in their own cell lines. Meanwhile, research shows that only ORF6 or ORF3 in E4 gene of the expressed adenovirus can replace the whole E4 gene, so that the adenovirus with E4 knocked out can be used for replication and packaging. Through further sequence analysis of the E4 and E2a genes, the E4 gene can be expressed at E2 a. Therefore, the E4 gene is subjected to sequence analysis, a promoter, ORF6/7 and polyA of E4 are found out, the basic elements are integrated into a complete expression frame, the complete expression frame is constructed at the position of the sequence of the E2a knocked out, the ORF6 and ORF7 genes are normally expressed, and finally, a replication-defective adenovirus 5 type vector which is knocked out of E1, E3, E4 and E2a and is provided with the E4 expression frame at the position of E2a is obtained, and the replication-defective adenovirus 5 type vector can be replicated and packaged in 293TD37 cells containing DBP sequences.

The research finds that the E4 gene contains 7 expression frames of ORF1,2,3,4,5,6 and 7, wherein ORF6/7 cannot be deleted, and once deleted, the packaging of adenovirus and the expression of antigen genes are obviously affected, so that ORF6/7 needs to be supplemented back, and meanwhile, in order to obtain larger vector space, ORF6/7 needs to be expressed at E2a, so that an adenovirus vector with larger capacity and better expression effect is prepared.

4) The shuttle plasmid pS5E1 of the adenovirus E1 region is constructed and is respectively connected with L8Lubiqutin, IRES and I215L gene segments through DNA ligase to construct the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L of the African swine fever adenovirus 5 type vector E1 region.

The shuttle plasmid pS5E1 is firstly connected with a ribosome entry site IRES fragment to obtain a pS5E1-IRES vector, and then is connected with an I215L fragment to obtain pS5E1-IRES-I215L, and pS5E1-IRES-I215L is subjected to enzyme digestion and connection with an L8Lubiqutin fragment to obtain an E1 region shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L, and colony PCR verification is carried out.

L8Lubiqutin is formed by adding a molecular adjuvant ubiqutin to L8L, and the molecular adjuvant ubiqutin can help to improve the immune response of the vaccine.

5) The construction of an adenovirus E4 region shuttle plasmid pS5E4-EGFP, I73Rhbsag and 2A, E146L genes obtains an I73Rhbsag-2A-E146L gene fragment by a fusion PCR technology, the I73Rhbsag-2A-E146L gene fragment is knocked out by carrying out enzyme digestion on the shuttle plasmid pS5E4-EGFP, and the I73Rhbsag-2A-E146L gene fragment is seamlessly cloned and connected with DNA ligase to construct an African swine fever adenovirus 5 type-5 vector E4 region shuttle plasmid pS5E4-I73 Rhbsag-2A-E146L.

Through the enzyme digestion of shuttle plasmid pS5E4-EGFP of E4, the deletion of EGFP is replaced by pS5E4-I73Rhbsag-2A-E146L, I73Rhbsag is obtained, and E146L is connected through a 2A sequence. The 2A sequence is added for protein cleavage, the EF1 alpha promoter is expressed in tandem, and the 2A sequence is further cleaved to obtain CP312R and MGF4L antigens.

The I73Rhbsag is formed by adding a molecular adjuvant hbsag to I73R, and the molecular adjuvant hbsag can help to improve the immune response of the vaccine.

6) Homologous recombination of the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and the adenovirus vector plasmid pAd5LCL3 is carried out to obtain the adenovirus vector plasmid pAd5LCL3-L8 Lubiqutin-IRES-I215L.

7) Homologous recombination is carried out on shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L to obtain recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L with four antigen genes co-expressed, wherein the recombinant adenovirus vector with four antigen genes co-expressed has a nucleotide sequence shown as Seq ID No.8 in a sequence table.

Shuttle plasmids are generally adopted in the existing adenovirus vector construction, and a single enzyme cutting site needs to be searched. The invention creatively adopts CRISPR/cas9 to construct a recombinant adenovirus vector, selects proper E1, E3, E4 and E2a knockout sites through comparison, selects the CRISPR sites according to the positions of E1, E3, E4 and E2a sequences, the number of knockout gene bases and designs the optimal gRNA, thereby completing the construction of the recombinant adenovirus vector.

Further, the adenovirus circular vector plasmid in the step 1) is derived from wild type human adenovirus type 5 virus amplified in A549 cells, virus liquid is collected and concentrated, adenovirus type 5 genome is extracted by adopting a HirtVirus DNA Extract method, and linear adenovirus type 5 genome is constructed into circular adenovirus circular vector plasmid by using a cosmid method.

Further, the ORF6/7 expression frame gene in the step 3) has a nucleotide sequence shown as Seq ID NO.9 in the sequence table; the IRES in the step 4) has a nucleotide sequence shown as Seq ID NO.10 in the sequence table; 2A in the step 5) has a nucleotide sequence shown as Seq ID No.11 in the sequence table.

Further, the shuttle plasmid pS5E1 skeleton in the step 4) adopts puc origin, amp and other basic elements, Ad5 left arm ITR partial sequence, right arm PIX, PIVa2 partial sequence and CMV-MCS SV40 early polyA; the framework of the shuttle plasmid pS5E4-EGFP in the E4 region in the step 5) adopts puc origin, amp and other basic elements, an ITR sequence of the left arm of the Ad5E4 region, a fiber gene sequence of the right arm of the Ad5E4 region and an EF1 alpha-EGFP-HBV polyA gene; wherein the basic elements such as puc origin, amp, etc. have the nucleotide sequence shown in Seq ID No.12 in the sequence table, and the EF1 alpha-EGFP-HBV polyA gene has the nucleotide sequence shown in Seq ID No.13 in the sequence table.

The skeleton of the shuttle plasmid pS5E1 was synthesized by Beijing Bomaide Gene technology, Inc., and the synthesis adopted basic elements (2796bp) such as puc origin, amp, etc., partial sequences (400bp) of ITR of Ad5 left arm, partial sequences (2100bp) of PIX of right arm, PIVa2, and CMV-MCS (944bp) SV40 early polyA (160 bp). Carrying out PCR amplification and gene fragment purification, carrying out seamless cloning connection, transforming the connection product to competent cells, coating an ampicillin resistance plate, culturing, selecting positive clones, carrying out enzyme digestion verification, and obtaining the shuttle plasmid pS5E1 in the adenovirus E1 region.

The skeleton of the shuttle plasmid pS5E4 adopts puc origin, amp and other basic elements, the left arm ITR sequence (370bp) of Ad5E4 region, the right arm fiber gene sequence (1746bp) and EF1 alpha-EGFP-HBV polyA gene. Carrying out PCR amplification and gene fragment purification, carrying out seamless cloning connection, transforming the connection product to competent cells, coating an ampicillin resistance plate, culturing, selecting positive clones, carrying out enzyme digestion verification, and obtaining the shuttle plasmid pS5E4-EGFP in the adenovirus E4 region.

Further, in step 6), homologous recombination of shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3 is carried out by carrying out enzyme digestion on shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3 through PacI and SwaI, dephosphorylating the digestion product, carrying out Gel recovery on the vector and the fragment by using OMEGA Ultra-Sepgel Extraction Kit, coating the transformation product on a plate, picking a colony, and carrying out XhoI enzyme digestion verification.

Further, step 7) homologous recombination of shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8 Lubiqlutin-IRES-I215L is carried out by digesting shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8 Lubiqlutin-IRES-I215L through PacI and I-sceI, dephosphorylating the digested product, carrying out Gel recovery of vector and fragment by OMEGA Ultra-Sep Gel Extraction Kit, coating the transformed product on a plate, picking colonies and carrying out XhoI enzyme digestion verification.

In another aspect, the present invention provides a method for packaging a recombinant adenovirus vector, which comprises digesting the recombinant adenovirus vector of

claim

1 or 2, pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L with PacI, and using the linearized plasmid for transfection; transfecting 293TD37 cells constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, collecting cell suspension, and packaging the recombinant adenovirus. The 293TD37 cell strain is preserved in China center for type culture collection (CCTCC NO: C201996) in 2019, 5, 8 and classified as a human embryonic kidney transformed cell AY293-TD15, and the cell strain contains E2a gene and E4-ORF6/7 gene of adenovirus type 5, is obtained by modifying HEK293 cells through genetic engineering, and can be used for packaging second-generation recombinant adenovirus lacking E2a gene and E4 gene to form complete second-generation adenovirus particles with infectivity.

Further, the packaging method of the recombinant adenovirus vector is prepared by the following steps:

1) carrying out enzyme digestion on pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L co-expression recombinant adenovirus vector by PacI, and using the linearized plasmid for transfection; 293TD37 cells were transfected with PEI transfection reagents;

2) 293TD37 cells after transfection at 37 ℃ with 5% CO₂Culturing in an incubator for 72-96 hours, and collecting cell suspension, namely TP0 generation adenovirus;

3) 293TD37 cells were infected with TP0 adenovirus at 37 ℃ and 5% CO₂Culturing for 72 hr in incubator, collecting fine powderThe cell suspension is TP1 generation adenovirus;

4) repeat 3), collecting cell suspension, namely TP2 generation adenovirus;

5) the inoculation was continued until TP4 generation adenovirus.

On the other hand, the invention also provides application of the 293TD37 cell in packaging a recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus, which is characterized in that the four antigen genes are respectively L8Lubiqutin, I215L, I73Rhbsag and E146L, wherein the L8Lubiqutin and I215L are expressed in an E1 region, and the I73Rhbsag and E146L are expressed in an E4 region, so that the recombinant adenovirus vector co-expressed by the four antigen genes is formed, namely d5LCL3-L8Lubiqutin-I215L-I73 Rhbsag-E146L; wherein the 293TD37 cell is constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the collection number of the cell strain is as follows: CCTCC NO of C201996, and is preserved in China center for type culture Collection.

The invention provides an African swine fever virus vaccine which is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of the African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells. Wherein, the four antigen genes of the African swine fever virus are L8Lubiqutin, I215L, I73Rhbsag and E146L respectively. The construction of the recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus mainly comprises knocking out E1, E3, E2a and E4 genes of the adenovirus vector through CRISPR/cas9, and constructing shuttle plasmids of E1 and E4 regions, wherein the shuttle plasmids are respectively used for expressing L8Lubiqutin, I215L, I73Rhbsag and E146L genes, so that a brand-new adenovirus vector is obtained. The invention has the following beneficial effects:

the construction method of the adenovirus type 5 vector CRISPR/cas9 is novel, the optimal knockout site is selected, the optimal gRNA is designed, and the problem that a single enzyme cutting site needs to be found due to the fact that shuttle plasmids for constructing the vectors in the past are knocked out is solved.

Secondly, because the gene of the E4 region plays a key role in immunogenicity, the expression of a large number of genes of the E4 region can enable a host to generate stronger immune response and induce the generation of antibodies, and is not beneficial to long-term expression of target proteins of the adenovirus vector in the host, and the deletion of unnecessary genes in the E4 region can reduce the immunogenicity of the adenovirus vector, so that the vector can be expressed in a longer time.

The invention knocks out the sequence of ORF 1-ORF 5 in E4 area, reserves the sequence of E4promoter, ORF6, ORF7 and polyA, and inserts them into E2a position, so that the E4 position can express exogenous gene.

③ the invention also knock out the DBP (E2a) sequence, the DBP deletion can prevent or greatly reduce the reversion. And the knockout of E2a and E4 partial sequences increases the vector capacity of about 3kb relative to the first generation vector.

E2A and E4 of the adenovirus vector are knocked out, and E4promoter-ORF6/7-polyA is placed in an E2a region, so that a cell line complemented with E2a can be used for packaging, meanwhile, exogenous genes can be simultaneously expressed in the E1 and E4 regions without mutual interference, the adenovirus vaccine is rescued in a 293TD37 cell line which is a complementary cell line constructed by our company at present, and the cell line can persistently express DBP protein.

Sixthly, the shuttle plasmid of E1 and E4 regions is constructed and used for expressing exogenous genes of E1 and E4 regions.

The titer of the recombinant adenovirus prepared by the 293TD37 cell line packaging method is higher.

Based on the principle, the invention can greatly improve the capacity of the vaccine of the adenovirus vector, and enhances the specific immune response to the African swine fever virus by using a mode of simultaneously expressing four independent antigens of the African swine fever virus on one adenovirus vector, so that the domestic pigs can obtain better immune protection.

Drawings

FIG. 1 is a schematic diagram of the Ad5-E4-up-gRNA cleavage site and the PAM site of example 2

FIG. 2 is a schematic diagram of the Ad5-E4-down-gRNA cleavage site and the PAM site of example 2

FIG. 3 shows the results of the "double restriction" detection of plasmids by the vectors Ad5-E4-up-gRNA, Ad5-E4-down-gRNA, and cas9 in example 2, wherein lane 1 shows Ad5-E4-up-gRNA, Ad5-E4-down-gRNA, and cas9, and M shows Marker

FIG. 4 shows the result of the amplified electrophoresis of the fiber and ITR fragments containing partial knockdown in example 2, wherein lane 1 shows the amplified result of the fiber partial fragment, lane 2 shows the amplified result of the ITR partial fragment, and M shows Marker

FIG. 5 shows the results of electrophoretic detection of the Fiber-ITR fusion fragment of example 2, in which lane 1 is the Fiber-ITR fusion fragment, and M is Marker

FIG. 6 shows the results of the PCR-verified electrophoresis of the colonies of example 2, wherein lanes 1-24 are colonies, M is Marker

FIG. 7 shows the results of the electrophoretic tests of the plasmid clones of the positive clones of FIG. 6, which were verified by digestion with BamHI and XhoI in example 2, wherein 1-5 is digestion with BamHI, 6-10 is digestion with XhoI, 1, 10 are pAd5 control (for sure E4 gene), and M is Marker

FIG. 8 is a schematic diagram of the 100k-gRNA cleavage site and PAM site of example 3

FIG. 9 is a schematic diagram of the protease-gRNA cleavage site and PAM site in example 3

FIG. 10 shows the results of the "double digestion" of 100k-gRNA, protease-gRNA and cas9 in example 3, lane 1 shows the results of the "double digestion" of 100k-gRNA, protease-gRNA and cas9, and M shows Marker

FIG. 11 shows the results of PCR amplification and electrophoresis of 100k, E4ORF6/7 expression cassette and protease of example 3, wherein lane 1 is E4ORF6/7 expression cassette, lane 2 is 100k, and M is Marker

FIG. 12 shows the results of the fusion PCR electrophoresis of the 100k, E4ORF6/7 expression cassette and the Protease fragment of example 3, wherein lane 1 shows the fragment 100k, E4ORF6/7 expression cassette and the Protease fusion PCR product, and M shows Marker

FIG. 13 shows the results of the PCR-verified electrophoresis of the colonies of example 3, in which lanes 1-24 are colonies, M is Marker

FIG. 14 shows the results of the XhoI cleavage of the

colonies

9, 18, 21 and 24 positive clones selected from FIG. 13 in example 3, wherein lane 1 shows XhoI cleavage of the positive clone 9, lane 2 shows XhoI cleavage of the positive clone 18, lane 3 shows XhoI cleavage of the positive clone 21, lane 4 shows XhoI cleavage of the positive clone 24, lane 5 shows XhoI cleavage of the control plasmid pAd5LCL3, and M shows Marker

FIG. 15 shows the results of the amplification electrophoresis of CMV-MCS and SV40 earlyployA fragments of example 4, wherein lane 1 is CMV-MCS fragment, lane 2 is SV40 earlyployA fragment, and M is 2000Marker

FIG. 16 shows the results of the amplification electrophoresis of CMV-MCS-SV40 earlylylA, PUC, Ad5 right arm, Ad5 left arm in example 4, wherein lane 1 is CMV-MCS-SV40 earlylylA fusion fragment, lane 2 is PUC, lane 3 is Ad5 right arm, lane 4 is Ad5 left arm, and M is 2000Marker

FIG. 17 shows the results of PCR-verified electrophoresis of colonies of competent cells transformed with the ligation products of the four fragments of pS5E1 backbone, Ad5 left arm, Ad5 right arm and CMV-MCS-SV40 earlyplolyA in example 4, wherein lanes 1-6 are colonies, and M is Marker

FIG. 18 is the result of restriction enzyme examination of the selected colony Nos. 1 to 6 in FIG. 17 of example 4, in which the left 1 to 6 are single restriction enzymes of plasmid pS5E1NcoI, the right 1 to 6 are single restriction enzymes of plasmid pS5E1 PacI, and M is 15000bp Marker

FIG. 19 shows the results of PCR amplification and electrophoresis detection of IRES fragment of example 4, wherein

lanes

1 and 2 are the PCR amplification products of IRES fragment, and M is 15000bp Marker

FIG. 20 shows the results of restriction electrophoresis of the fragment IRES of example 4 and pS5E1 vector, wherein lane 1 shows the restriction of the fragment IRES EcoRV and NotI, lane 2 shows the restriction of pS5E1 EcoRV and NotI, and M shows a 15000bp Marker

FIG. 21 shows the results of PCR-verified electrophoresis of the colonies of the competent cells transformed with the ligation product of pS5E1 vector and IRES fragment in example 4, wherein the numbers 1 to 9 are colonies, and M is Marker

FIG. 22 shows restriction enzyme electrophoresis detection and verification of pS5E1-IRES plasmid NotI and EcoRV of example 4, wherein 2 and 6 of FIG. 21 are selected for plasmid extraction and restriction enzyme verification, wherein lane 1 is plasmid NotI and EcoRV restriction enzyme identification, lane 2 is plasmid NotI and EcoRV restriction enzyme identification

FIG. 23 shows the results of electrophoretic detection of the cleavage of I215L and pS5E1-IRES vector in example 4, wherein the carrier of the lane is pS5E1-IRES, the cleavage of NotI and XhoI is performed in two steps, the fragment I215L of the lane I215L is performed in two steps, the cleavage of NotI and XhoI is performed in two steps, and M is 15000bp and 2000bp Marker

FIG. 24 shows the results of PCR-verified electrophoresis of colonies of transformation competent cells with ligation products of I215L and pS5E1-IRES in example 4, wherein the numbers 1 to 11 are colonies, and M is 2000bp Marker

FIG. 25 shows the restriction enzyme electrophoresis detection of pS5E1-IRES-I215L plasmid in example 4, wherein the

colonies

5,6,7 and 8 shown in FIG. 24 are selected for plasmid extraction and restriction enzyme verification, wherein Lane 2 is restriction enzyme verification of plasmid No.2, Lane 9 is restriction enzyme verification of plasmid No.9, Lane 11 is restriction enzyme verification of plasmid No.11, and M is Marker

FIG. 26 shows the results of electrophoresis detection of L8 Lubiqiutin fragments obtained by fusing L8L and ubiqiutin in example 4 and purified by a gel recovery and purification kit, wherein the L8 Lubiqiutin fragment is shown in lane 1, and M is Marker

FIG. 27 shows the electrophoresis detection results of the cleavage products of the fragment L8Lubiqutin and pS5E1-IRES-I215L vector of example 4, wherein the lane 1 is the pS5E1-IRES-I215L plasmid; lane 2 is pS5E1-IRES-I215L plasmid EcoRV and BamHI cut; lane 3 shows the L8Lubiqutin fragments cut with EcoRV and BamHI, and M shows 15000bp Marker

FIG. 28 shows the results of PCR-verified electrophoresis of the colonies of the pS5E1-IRES-I215L vector and L8Lubiqutin ligation product transformation-competent cells of example 4, wherein the numbers 1 to 24 are colonies, and M is a 2000bp Marker

FIG. 29 shows the restriction electrophoresis detection and verification of pS5E1-L8Lubiqutin-IRES-I215L plasmid of example 4, wherein

lanes

4, 6, 9, 14, 17 and 18 are selected from the colony plasmids BamHI and EcoRV of 4, 6, 9, 14, 17 and 18 in FIG. 27, and M is 15000bp Marker

FIG. 30 shows the results of the amplification electrophoresis of the left arm of the shuttle plasmid pS5E4-EGFP, the right arm of the shuttle plasmid pS5E4-EGFP, EF1 α -EGFP-HBV, and the shuttle plasmid skeleton pS5E4-EGFP in example 5, wherein lane 1 shows the left arm of the shuttle plasmid pS5E4-EGFP, lane 2 shows the right arm of the shuttle plasmid pS5E4-EGFP, lane 3 shows the shuttle plasmid EF1 α -EGFP-HBV, lane 4 shows the shuttle plasmid skeleton pS5E4-EGFP, and M shows 2000Marker

FIG. 31 shows the results of PCR-verified electrophoretic measurements of colonies of competent cells transformed with the four fragment ligation products of the backbone of the shuttle plasmids pS5E4-EGFP, pS5E4-EGFP, EF1 α -EGFP-HBV, and pS5E4-EGFP in example 5, wherein lanes 1-20 are colonies, and M is Marker

FIG. 32 shows the results of electrophoresis in example 5, which were verified by selecting the restriction enzyme digestion of the colonies Nos. 3,4,5, and 6 shown in FIG. 30, wherein the numbers 1-4 are the positive clones No.3, 4,5, and 6, the numbers 5-8 are the positive clones No.3, 4,5, and 6, the HindIII single restriction enzyme digestion is performed, the numbers M1 and M3 are 15000bp markers, and the numbers M2 are 2000bp markers

FIG. 33 shows the results of electrophoretic detection of the fusion PCR amplification of I73Rhbsag and 2A-E146L fragments in example 5, where lane 1 is the I73Rhbsag fragment, lane 1 is the 2A-E146L fragment, and M is 2000bp Marker

FIG. 34 shows the results of restriction electrophoresis of the vector for the fragment pS5E4-EGFP in example 5, wherein lane 1 shows the recovery of the fragment pS5E4-EGFP, BamHI and XhoI double-enzyme gel, and M shows a 15000bp Marker

FIG. 35 shows the results of PCR-verified electrophoresis of the colonies of the transformed competent cells, in which the plasmid 1-12 is a colony and M is 15000bp Marker, obtained by seamlessly cloning and connecting the recovered vector pS5E4-EGFP gel of example 5 with an I73Rhbsag fragment and 2A-E146L

FIG. 36 shows the results of electrophoresis of BamHI and XhoI double digestion verification of the extracted plasmid of the positive clones No.1, 2 and 3 of FIG. 35 selected in example 5, wherein the BamHI and XhoI double digestion verification of the positive clones No.1, 2 and 3 in

lanes

1,2 and 3 are performed, respectively, and M is 15000bp Marker

FIG. 37 shows the results of agarose gel electrophoresis test of pAd5LCL3 and pS5E1-L8Lubiqutin-IRES-I215L in example 6, wherein pAd5LCL3 is shown in lane 1, and pS5E1-L8Lubiqutin-IRES-I215L is shown in lane 2

FIG. 38 shows the results of electrophoresis of plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L obtained by homologous recombination of shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3 of example 6, wherein lanes 1-7 represent clones pAd5LCL3-L8Lubiqutin-IRES-I215L, and M represents 15000bp Marker

FIG. 39 shows the results of restriction enzyme digestion verification and detection of plasmid extracted from example 6 by selecting the positive plasmid No.6 from FIG. 38, wherein the plasmid No.1 is pAd5LCL3-P72-IRES-B602L plasmid XhoI restriction enzyme digestion, and M is 15000bp Marker

FIG. 40 shows the results of the agarose gel-verified electrophoretic detection of shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L in example 6, wherein lane 1 is pS5E4-I73Rhbsag-2A-E146L, lane 2 is pAd5LCL3-L8Lubiqutin-IRES-I215, and M is 15000bp Marker 215L

FIG. 41 shows the results of electrophoresis of plasmid pS5E4-I73Rhbsag-2A-E146L and plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L of the recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L obtained by homologous recombination in example 6, wherein lanes 1-8 are plasmids and M is 15000bp Marker

FIG. 42 is the result of the enzyme digestion verification test of example 6, which includes selecting the positive plasmid No.2 of FIG. 41, transforming the plasmid into competent cells, extracting the plasmid, wherein the lane No.2 is pAd5LCL3-L8Lubiqutin-I215L-I73HbsAg-E146L plasmid XhoI enzyme digestion, and M is 15000bp Marker

FIG. 43 is a photograph of 293TD37 cells induced by TP0 of example 7

FIG. 44 is a photograph of 293TD37 cells induced by TP1 of example 7

FIG. 45 is a photograph of 293TD37 cells induced by TP2 of example 7

FIG. 46 is a photograph of 293TD37 cells induced by TP3 of example 7

FIG. 47 is a photograph of 293TD37 cytopathic effect caused by TP4 of example 7

FIG. 48 is a graph showing the results of Western Blot for detecting L8Lubiqutin and I215L proteins in African swine fever multiple antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73HbsAg-E146L in example 11, wherein lane 1 is 293 blank cells,

lanes

2 and 3 are samples of 293TD37 cells infected with pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L, and M is Marker

FIG. 49 is a vector map of pAd5LCL3

FIG. 50 is a vector map of pS5E1

FIG. 51 is a vector map of pS5E1-L8Lubiqutin-IRES-I215L

FIG. 52 is a vector map of pS5E4-EGFP

FIG. 53 is a vector map of pS5E4-I73Rhbsag-2A-E146L

FIG. 54 is a vector map of pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L

FIG. 55 is a graphical representation of the results of the CD8+ T cell response induced by pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L of example 12

FIG. 56 is a graph showing the results of the CD4+ T cell response induced by pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L of example 12

FIG. 57 is a representation of the cellular immune response following intramuscular injection of pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L of example 12

FIG. 58 is a representation of blank control immune responses in example 12

Detailed Description

In the following, preferred embodiments of the present invention will be described in further detail with reference to the accompanying drawings, it being noted that the following embodiments are intended to facilitate understanding of the present invention without any limitation thereto.

EXAMPLE 1 construction of adenovirus vector plasmid lacking E1 and E3 genes

In A549 cells

Amplifying wild type human adenovirus type 5: (

VR-1516, gene sequence AC _000008.1), collecting and concentrating virus liquid, extracting adenovirus genome by a HirtVireal DNA Extract method, constructing linear hAD5 genome into circular supercos-Ad5 carrier plasmid by a cosmid method, excising hAD5 adenovirus E1 region by CRISPR/cas9, and designing gRNA as follows:

hAd5-E1 upstream gRNA:

GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E1 downstream gRNA:

GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

designing gRNA sites at the upstream and downstream of an hAD 5E1 region, recovering a large fragment vector after cutting, designing a primer, respectively inserting ITR and PIX sequences into the upstream and downstream by fusion PCR, introducing a SwaI enzyme cutting site, then carrying out seamless cloning on the fused fragment and the vector to obtain an E1 knockout supercos-Ad5 delta E1 adenovirus vector, and then carrying out excision of an E3 region on the supercos-Ad5 delta E1 plasmid to design gRNAs as follows:

hAd5-E3 upstream gRNA:

GCGGGACAUUUCAGAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E3 downstream gRNA:

GUAAGGGUACUGCUAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

designing gRNA sites at the upstream and downstream of an hAD 5E 3 region, recovering a large fragment vector after cutting, designing primers, carrying out fusion PCR on Fiber excessively cut at the upstream and downstream of E3 and a pVIII sequence, connecting in a seamless cloning mode to obtain an adenovirus vector plasmid pAd5 with deletion of E1 and E3 genes, and introducing a SwaI enzyme cutting site.

Example 2 construction of E1, E3 and E4 Gene deleted adenovirus vector plasmid pAd5 Δ E4

The E4 gene knockout can be further realized by using the vector plasmid pAd5 obtained in example 1 and in which the E1 and E3 genes are knocked out, so that the capacity of an adenovirus vector can be improved, the immunogenicity of the adenovirus vector can be reduced, a part of fiber is amplified by using a PCR method, an NdeI single enzyme cutting site is introduced, a Gibson seamless cloning method is used, an excessively cut fragment is connected to the vector, and the vector plasmid pAd5 delta E4 with E1, E3 and E4 genes deleted and SwaI and I-sciI enzyme cutting sites introduced is obtained.

1. Selection of target sequence of target gene E4 CRISPR

1) Selection of CRISPR target sequence of fiber gene upstream of E4 gene

Using the Saimer fly GeneArt^TMThe CRISPR Search and Design tool (thermolasher. com/crisprdesign) software, which imports the first 400 bases of the fiber gene, automatically analyzes the 400 base sequence, provides 6 potential CRISPR target sequences. In consideration of the length of an E4 gene knockout sequence and the requirement of constructing a live vector, GCTACTAAACAATTCCTTCC is selected as a targeting sequence, the finally obtained gRNA is named Ad5-E4-up-gRNA, and the cleavage site and the PAM site are shown in FIG. 1.

2) Selection of non-coding sequence CRISPR target sequence downstream of E4

Using the Saimer fly GeneArt^TMCRISPR Search and Design tool (thermofisher. com/CRISPR Design) software, 300 bases downstream of E4 were input, the software was automatically analyzed, 6 potential CRISPR target sequences were provided, AGGTTCGCGTGCGGTTTTCT was selected as the targeting sequence, the finally obtained gRNA was named Ad5-E4-down-gRNA, and the cleavage site and PAM site are shown in fig. 2.

2. DNA amplification of Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

1) DNA template design of Ad5-E4-up-gRNA

5’-TAATACGACTCACTATAGTACTAAACAATTCCTTCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

2) DNA template design of Ad5-E4-down-gRNA

5’-TAATACGACTCACTATAGGTTCGCGTGCGGTTTTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

3. Upstream and downstream primers for designing DNA templates for amplifying Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

Designing the upstream and downstream primers to perform PCR amplification of a DNA template for Ad5-E4-up-gRNA and a DNA template for Ad5-E4-down-gRNA, respectively, using GeneArt^TMPrecision gRNA Synthesis Kit for amplification.

Designing a primer:

Ad5-E4-up-gRNA-Forward：TAATACGACTCACTATAGTACTAAACAATTCCT

Ad5-E4-up-gRNA-Reverse：TTCTAGCTCTAAAACGGAAGGAATTGTTTAGTA

Ad5-E4-down-gRNA-Forward：TAATACGACTCACTATAGGTTCGCGTGCGGTTT

Ad5-E4-down-gRNA-Reverse：TTCTAGCTCTAAAACAGAAAACCGCACGCGAAC

4. DNA template for amplifying Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

1) A0.3. mu.M mixed working solution of Ad5-E4-up-gRNA-Forward/Reverse primer was prepared

10 μ M Ad5-E4-up-gRNA-Forward primer 3ul, 10 μ M Ad5-E4-up-gRNA-Reverse primer 3ul, water was supplemented to 100 ul.

2) A0.3. mu.M mixed working solution of Ad5-E4-down-gRNA-Forward/Reverse primer was prepared

10 μ M Ad5-E4-down-gRNA-Forward primer 3ul, 10 μ M Ad5-E4-down-gRNA-Reverse primer 3ul, water was supplemented to 100 ul.

3) PCR reaction system

The PCR reaction system for the DNA template amplification of Ad5-E4-up-gRNA is as follows: phusion^TMHigh-Fidelity PCR Master Mix (2X) 12.5ul, Tracr Fragment + T7 Primer Mix 1ul, 0.3. mu.M Ad5-E4-up-gRNA-Forward/Reverse Primer Mix 1ul, water to 25 ul.

The PCR reaction system for the DNA template amplification of Ad5-E4-down-gRNA is as follows: phusion^TMHigh-Fidelity PCR Master Mix (2X) 12.5ul, Tracr Fragment + T7 Primer Mix 1ul, 0.3. mu.M Ad5-E4-down-gRNA-Forward/Reverse Primer Mix 1ul, water supplement to 25 ul.

4) PCR procedure

Initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 55 ℃, 15sec, and 32 cycles; extending for 72 ℃, 1min, and 1 cycle; the temperature was maintained at 4 ℃.

5. Obtaining Ad5-E4-up-gRNA and Ad5-E4-down-gRNA through in vitro transcription

Using TranscriptAId^TMThe Enzyme Mix carries out in vitro transcription on the template DNA to obtain Ad5-E4-up-gRNA and Ad 5-E4-down-gRNA.

The reaction system for obtaining Ad5-E4-up-gRNA through in vitro transcription is as follows: NTP mix 8ul, E1A-gRNA DNA template 6ul, 5 × TranscriptAId^TM Reaction Buffer 4ul，TranscriptAid^TMEnzyme Mix 2 ul. After 4 hours incubation at 37 ℃ 1ul of DNase I was added and incubated for 15 minutes at 37 ℃.

The reaction system for obtaining Ad5-E4-down-gRNA by in vitro transcription is as follows: NTP mix 8ul, E1B-gRNA DNA template 6ul, 5 × TranscriptAId^TM Reaction Buffer 4ul，TranscriptAid^TMEnzyme Mix 2 ul. After 4 hours incubation at 37 ℃ 1ul of DNase I was added and incubated for 15 minutes at 37 ℃.

In vitro transcription to obtain Ad5-E4-up-gRNA and Ad 5-E4-down-gRNA.

6. Purification of in vitro transcription products

1) Supplementing the transcribed reaction system to 200ul by nuclease-free water;

2) adding 100ul Binding buffer, and mixing well;

3) adding 300ul ethanol (> 96%), and mixing well;

4) transferring the mixture to the Gene JET^TMIn RNA Purification Micro Column, 14000 Xg is centrifuged for 30-60 seconds, and the solution is discarded;

5) 700ul of Wash Buffer1 (13 mL of ethanol was added), 14000 Xg was centrifuged for 30-60 seconds, and the solution was discarded;

6) adding 700ul of Wash Buffer2 (adding 30mL of ethanol), centrifuging for 30-60 seconds at 14000 Xg, discarding the solution, and repeating the steps once;

7)14000 Xg empty for 60 seconds, completely removing all eluent, and placing the empty tube in a collection tube of 1.5 mL;

8) 10ul of nuclease-free water was added to the center of the column, and the gRNA was collected by centrifugation at 14000 Xg for 60 seconds.

Wherein, both the Wash Buffer1 and the Wash Buffer2 are TranscriptAID^TMThe RNA sequences of the reagents in the Enzyme Mix kit, the Ad5-E4-up-gRNA and the Ad5-E4-down-gRNA obtained by transcription are shown as follows:

Ad5-E4-up-gRNA:GUACUAAACAAUUCCUUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCC GUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

Ad5-E4-down-gRNA:GGUUCGCGUGCGGUUUUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCC GUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

7. CRISPR/Cas9 enzyme digestion "

The vector plasmid obtained in example 1 was digested with Ad5-E4-up-gRNA, Ad5-E4-down-gRNA and Cas9 in a double digestion manner, and the reaction systems were Cas9 protein 3. mu.g, Ad5-E4-up-gRNA 6. mu.g, Ad5-E4-down-gRNA 6. mu.g, pAd5-REBP vector plasmid 3. mu.g, NEB buffer 3.15 ul, and water was added to 50 ul.

The cleavage reaction was incubated at 37 ℃ overnight. 3ul samples were taken for agarose gel validation and the electrophoretic pattern of the experiment is shown in FIG. 3. Lane 1 shows the results of Ad5-E4-up-gRNA, Ad5-E4-down-gRNA, and cas9 "double digestion" pAd5 vector plasmids, which show that the target size is 2500bp-5000bp, and the digestion result is correct. The vector was purified using the Axygen gel recovery kit.

8. Obtaining a fragment containing a part of knocked-out fiber and an ITR (internal transcribed spacer) and introducing an I-SceI enzyme cutting site, knocking out a primer containing the knocked-out part of fiber, amplifying the fiber fragment and introducing the I-SceI enzyme cutting site

1) Amplification of fragment fiber

An amplification primer:

Fiber-RH-F：GAGTGCTACTAAACAATTCCTTCCTGGACCCAGAATATTGG

Fiber-ISceI-ITR-R：TGGTGTTATTACCCTGTTATCCCTAGCAATTGAAAAATAAACACGTTG

the amplification sequence is as follows:

TGGTGTTATTACCCTGTTATCCCTAGCAATTGAAAAATAAACACGTTGAAACATAACACAAACGATTCTTTATTCTTGGGCAATGTATGAAAAAGTGTAAGAGGATGTGGCAAATATTTCATTAATGTAGTTGTGGCCAGACCAGTCCCATGAAAATGACATAGAGTATGCACTTGGAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTAATGGTTAGTGTTACAGGTTTAGTTTTGTCTCCGTTTAAGTAAACTTGACTGACAATGTTACTTTTGGCAGTTTTACCGTGAGATTTTGGATAAGCTGATAGGTTAGGCATAAATCCAACAGCGTTTGTATAGGCTGTGCCTTCAGTAAGATCTCCATTTCTAAAGTTCCAATATTCTGGGTCCAGGAAGGAATTGTTTAGTAGCACTC

the amplification system is as follows: 10 μ M Fiber-RH-F primer 1 ul; 10 μ M Fiber-ISceI-ITR-R primer 1 ul; template pAd5(100ng/ul)0.5 ul; q5 high fidelity enzyme 25 ul; water is added to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃,10 sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. The electrophoresis chart of the amplification result is shown in FIG. 4, wherein lane 1 shows the amplification result of the fiber partial fragment, M is 2000Marker, and the amplification result is correct, and the fragment is purified by using the Axygen gel recovery kit.

2) Amplification of ITR fragments

An amplification primer:

ISceI-ITR-F：TAGGGATAACAGGGTAATAACACCACTCGACACGGCAC

ITR-RH-R：GGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTT

the amplification sequence is as follows:

GGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTTTAACCGTTACGTCATTTTTTAGTCCTATATATACTCGCTCTGCACTTGGCCCTTTTTTACACTGTGACTGATTGAGCTGGTGCCGTGTCGAGTGGTGTTATTACCCTGTTATCCCTA

the amplification system is as follows: 10 μ M ISceI-ITR-F primer 1 ul; 10uM ITR-RH-R primer 1 ul; template pAd5(100ng/ul)0.5 ul; q5 high fidelity enzyme 25 ul; water is added to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃,10 sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. The amplification result is shown in FIG. 4, lane 2 shows the result of ITR partial fragment amplification, M is 2000Marker, which shows that the amplification result is correct, and the fragment is purified by using Axygen gel recovery kit.

3) Fusion PCR to obtain Fiber-ITR fusion fragment

The amplification system is as follows: 10 μ M Fiber-RH-F primer 1ul, 10 μ M Fiber-ISceI-ITR-R primer 1ul, template pAd5(100ng/ul)0.5ul, Q5 Hi-Fi enzyme 25ul, water to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃, 20sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. The amplification result is shown in FIG. 5, lane 1 shows the fusion fragment of Fiber-ITR, and M shows 2000Marker, which indicates that the fusion result is correct. The fragments were purified using the Axygen gel recovery kit.

9. Carrier attachment

The Fiber-ITR fragment was ligated to the E4 knockout vector plasmid using Gibson of NEB, as follows: 100ng of plasmid fragment of the product vector is recovered by glue, 50ng of fiber-ITR fragment of the product is recovered by glue, 10ul of Gibson premix is obtained, and water is supplemented to 20 ul. Incubate at 50 ℃ for 40 minutes.

10. Transformation of

Taking out the kanamycin-resistant culture medium plate, putting the prepared NEB 10 beta competent cells on ice for melting, adding 10ul of ligation products, slightly sucking the ligation products evenly by a pipette, and placing the ligation products on the ice for 30 minutes; the centrifuge tubes were placed in a 42 ℃ water bath and heat-shocked for 90 seconds to select transformants using kanamycin resistance.

11. Colony PCR for transformant screening

Colony PCR validation was performed on the transformants using PCR amplification.

Design of downstream primer for colony PCR

E4-cexu-F：AGTGACGATTTGAGGAAGTTG

E4-cexu-R：TCAATTGCAGAAAATTTCAAGTC

The reaction system is as follows: 10 mu M E4-cexu-F primer 1ul, 10 mu M E4-cexu-R primer 1ul, Q5 high fidelity enzyme 10ul, replenishing water to 20ul, and picking up a monoclonal colony in a reaction system. The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃, 20sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. Agarose gel electrophoresis was performed, and as shown in FIG. 6, positive bands were observed in most colonies except for the colonies No.2, 8, 11, and 17.

12. Plasmid restriction enzyme verification

4 positive clone colonies are picked, plasmids are extracted, digestion verification is carried out on BamHI and XhoI, digestion results are shown in figure 7, and as can be seen from figure 7, digestion results of plasmids No. 2-5 BamHI and XhoI are both correct, and a sequencing result is correct, so that adenovirus vector plasmids pAd5 delta E4 with deletion of E1, E3 and E4 genes are obtained.

Example 3 construction of adenovirus vector plasmid pAd5LCL3 deleted for E1, E3, E4 and E2a genes

1. Selection of target sequence of target gene E2a CRISPR

1) Selection of CRISPR target sequence of 100k gene on upstream of E2a gene

Using the Saimer fly GeneArt^TMThe CRISPR Search and Design tool (thermofisher. com/crispdesign) software imports the first 400 bases of the 100k gene and the software automatically analyzes the 400 bases sequence, providing 6 potential CRISPR target sequences. Considering the length of E2a gene knockout sequence and the requirement of constructing a live vector, ATAGGTGGCGTTCGTAGGCA was selected as the targeting sequence, and the final gRNA was named 100k-gRNA, cleavage site and PAM site asAs shown in fig. 8.

2) Selection of non-coding sequence CRISPR target sequence downstream of E2a

Using the Saimer fly GeneArt^TMCRISPR Search and Design tool (thermofisher. com/CRISPR Design) software, 300 bases downstream of E4 were input, the software was automatically analyzed to provide 6 potential CRISPR target sequences, TACCCCGGTAATAAGGTTCA was selected as a targeting sequence, the finally obtained gRNA was named protease-gRNA, cleavage site and PAM site are shown in fig. 9.

2. DNA amplification of 100k-gRNA and protease-gRNA

1) DNA template design for 100k-gRNA

5’-TAATACGACTCACTATAGAGGTGGCGTTCGTAGGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

2) DNA template design of protease-gRNA

5’-TAATACGACTCACTATAGCCCCGGTAATAAGGTTCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

3. Designing upstream and downstream primers of DNA template for amplifying 100k-gRNA and protease-gRNA

An upstream primer and a downstream primer were designed to perform PCR amplification of a 100k-gRNA DNA template and a protease-gRNA DNA template, respectively, using GeneArt^TMPrecision gRNA Synthesis Kit for amplification.

1) Primer design

100k-gRNA-Foward：TAATACGACTCACTATAG AGGTGGCGTTCGTAG

100k-gRNA-Reverse：TTCTAGCTCTAAAAC TGCCTACGAACGCCACCT

protease-gRNA-Foward：TAATACGACTCACTATAG CCCCGGTAATAAGGT

protease-gRNA-Reverse：TTCTAGCTCTAAAAC TGAACCTTATTACCGGGG

2) DNA template for amplifying 100k-gRNA and protease-gRNA

Firstly, preparing 0.3 mu M100 k-gRNA-Forward/Reverse primer mixed working solution, comprising 10 mu M100 k-gRNA-Forward primer 3ul, 10 mu M100 k-gRNA-Reverse primer 3ul, and supplementing water to 100 ul.

Preparing 0.3 mu M of Aprotease-gRNA-Forward/Reverse primer mixed working solution, including 3ul of 10 mu M of protease-gRNA-Forward primer, 3ul of 10 mu M of protease-gRNA-Reverse primer, and supplementing water to 100 ul.

PCR reaction system

The PCR reaction system for DNA template amplification of 100k-gRNA is as follows: phusion^TMHigh-Fidelity PCR Master Mix (2X) 12.5ul, Tracr Fragment + T7 Primer Mix 1ul, 0.3. mu.M 100k-gRNA-Forward/Reverse Primer Mix 1ul, water make-up to 25 ul.

The PCR reaction system for the DNA template amplification of the protease-gRNA is as follows: phusion^TMHigh-Fidelity PCR Master Mix (2X) 12.5ul, Tracr Fragment + T7 Primer Mix 1ul, 0.3. mu.M protease-gRNA-Forward/Reverse Primer Mix 1ul, water supplement to 25 ul.

(iv) PCR procedure

3. Obtaining 100k-gRNA and protease-gRNA through in vitro transcription

Using TranscriptAId^TMThe Enzyme Mix carries out in vitro transcription on the template DNA to obtain 100k-gRNA and protease-gRNA.

1) Obtaining 100k-gRNA and protease-gRNA through in vitro transcription

The reaction system for obtaining 100k-gRNA by in vitro transcription is as follows: NTP mix 8ul, 100k-gRNA DNA template 6ul, 5 × TranscriptAId^TM Reaction Buffer 4ul，TranscriptAid^TMEnzyme Mix 2 ul. After 4 hours incubation at 37 ℃ 1ul of DNase I was added and incubated for 15 minutes at 37 ℃.

The reaction system for obtaining the protease-gRNA through in vitro transcription is as follows: NTP mix 8ul, protease-gRNA DNA template 6ul, 5 × TranscriptAID^TM Reaction Buffer 4ul，TranscriptAid^TMEnzyme Mix 2 ul. After 4 hours incubation at 37 ℃ 1ul of DNase I was added and incubated for 15 minutes at 37 ℃.

2) Purification of in vitro transcription products

Supplementing the reaction system after transcription with nuclease-free water200ul, adding 100ul Binding buffer, mixing, adding 300ul ethanol (ethanol)>96%), mixing well, transferring the mixture to the Gene JET^TMIn RNA Purification Micro Column, 14000 Xg is centrifuged for 30-60 seconds, and the solution is discarded; 700ul of Wash Buffer1 (13 mL of ethanol was added), 14000 Xg was centrifuged for 30-60 seconds, and the solution was discarded; 700ul of Wash Buffer2 (30 mL of ethanol added) was added, the mixture was centrifuged at 14000 Xg for 30-60 seconds, and the solution was discarded, and the above procedure was repeated once. 14000 Xg was left empty for 60 seconds, all the eluate was completely removed, the empty tube was placed in a 1.5mL collection tube, 10ul of nuclease-free water was added to the center of the column, and the gRNA was collected by centrifugation at 14000 Xg for 60 seconds.

Wherein, both the Wash Buffer1 and the Wash Buffer2 are TranscriptAID^TMThe RNA sequences of 100k-gRNA and protease-gRNA obtained by transcription of the reagents in the Enzyme Mix kit are shown below:

100k-gRNA:GAGGUGGCGUUCGUAGGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

protease-gRNA:GCCCCGGUAAUAAGGUUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

4. CRISPR/Cas9 enzyme digestion "

The adenovirus vector plasmid which is obtained in the example 2 and lacks E1, E3 and E4 genes is subjected to double enzyme digestion by using 100k-gRNA, protease-gRNA and Cas9, and the reaction system is 3 mu g of Cas9 protein; 6 mu g of 100 k-gRNA; 6 mu g of protease-gRNA; 3. mu.g of the vector plasmid obtained in example 2; NEB buffer 3.15 ul; water was replenished to 50 ul.

The above digestion reactions were incubated overnight at 37 ℃. 3ul samples were taken for agarose gel validation and the results are shown in FIG. 10. Lane 1 shows the results of "double digestion" of vector plasmids by 100k-gRNA, protease-gRNA and cas9, and fragments with the target size of 1000 and 2500bp appeared, which indicates that the digestion results are correct. The vector was purified using the Axygen gel recovery kit.

5. Obtaining a 100k, E4ORF6/7 expression cassette and a Protease fragment containing partial knockout

1) Amplification of partially knocked-out 100k, E4ORF6/7 expression cassette, Protease fragment

Part knocked-out 100k amplification primers:

100k-F：TGAGAATAGGTGGCGTTCGTAGGCAAGGCTGACATCCGCTATGG

100k-ORF6/7-R：TACAATTCCCAACACATACAAGTTTCCTTCTCCTATAGGCAGAA

the amplification system is as follows: 10 μ M100 k-F primer 1 ul; 10 μ M100 k-ORF6/7-R primer 1 ul; template pAd 5. delta.E 4(100ng/ul)0.5 ul; q5 high fidelity enzyme 25 ul; water is added to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃, 20sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃.

E4ORF6/7 expression cassette amplification primer:

ORF6/7-F：ACTTGTATGTGTTGGGAATTGTA

ORF6/7-R：ATCGTTTGTGTTATGTTTCAACG

the amplification system is as follows: ORF6/7-F primer 1 ul; 10 μ M ORF6/7-R primer 1 ul; 0.5ul of template ORF6/7 expression cassette gene (100 ng/ul); q5 high fidelity enzyme 25 ul; water is added to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃,10 sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃.

Amplification of partially knocked-out Protease fragment

ORF6/7-Protease-F：CCCACCCTTGCCGTCTGCGCCGTATCGTTTGTGTTATGTTTCAACG

Protease-R：ATGGATCACAACCCCACCATGAACCTTATTACCGGGGTACCCA

The amplification system is as follows: 10 μ M ORF6/7-Protease-F primer 1 ul; 10 μ M of Protease-R primer 1 ul; template pAd 5. delta.E 4(100ng/ul)0.5 ul; q5 high fidelity enzyme 25 ul; water is added to 50 ul.

(100 k), E4ORF6/7 expression cassette, and the results of protease PCR amplification are shown in FIG. 11, wherein lane 1 is E4ORF6/7 expression cassette, lane 2 is 100k, and M is 15000bpMarker

The amplification result is correct, and the fragments are respectively recovered and purified by using an Axygen gel recovery kit.

6. Obtaining a fusion fragment of 100k, E4ORF6/7 expression frame and Protease fragment by fusion PCR

The amplification system is as follows: 10 μ M100 k-F primer 1 ul; 10 μ M of Protease-R primer 1 ul; the template 100k glue recovery product (50ng/ul)1ul template E4ORF6/7 expression frame glue recovery product (50ng/ul)1ul template E4ORF6/7 expression frame glue recovery product (50ng/ul)1 ul; q5 high fidelity enzyme 25 ul; water is added to 50 ul.

The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃, 50sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. The amplification results are shown in FIG. 12, in which lane 1 shows the fragment 100k, the E4ORF6/7 expression cassette, and the protease fusion PCR product, and the amplification results are correct. The fragments were purified using the Axygen gel recovery kit.

7. Carrier attachment

The 100k, E4ORF6/7 expression cassette, protease fusion PCR gel recovery product was ligated to the E2a knockout vector of step 4 using Gibson from NEB as follows: 100ng of vector fragment after E2a knockout of gel recovery product, 100k of gel recovery product, 50ng of E4ORF6/7 expression frame, 50ng of protease fusion PCR fragment, 10ul of Gibson premix and 20ul of water supplement. Incubate at 50 ℃ for 40 minutes.

8. Transformation of

9. Colony PCR for transformant screening

Design of downstream primer for colony PCR

DBP-upsteam-F：GTTGGGCTCGCATGTGCCG

DBP-downsteam-R：ACTCCCATGGATCACAACCC

The reaction system is as follows: 10 mu M DBP-uptecam-F primer 1ul, 10 mu M DBP-downecam-R primer 1ul, Q5 high fidelity enzyme 10ul, moisturizing to 20ul, and picking the single colony in the reaction system. The PCR procedure was: initial denaturation at 98 ℃,10 sec, 1 cycle; denaturation at 98 ℃ for 5 sec; annealing at 60 ℃ for 30 sec; extension 72 ℃, 20sec, 35 cycles; extension at 72 deg.C for 5min, and 1 cycle; the temperature was maintained at 4 ℃. Agarose gel electrophoresis was performed and positive bands appeared at 9, 18, 21, and 24 as shown in FIG. 13.

10. Plasmid restriction enzyme verification

The colonies of 4

positive clones

9, 18, 21 and 24 were picked, plasmids were extracted, and the restriction enzyme digestion was verified by XhoI, and the restriction enzyme digestion results are shown in FIG. 14, wherein lane 1 is the restriction enzyme digestion of positive clone XhoI of number 9, lane 2 is the restriction enzyme digestion of positive clone XhoI of number 18, lane 3 is the restriction enzyme digestion of positive clone XhoI of number 21, lane 4 is the restriction enzyme digestion of positive clone XhoI of number 24, and lane 5 is the restriction enzyme digestion of XhoI of control plasmid pAd5LCL 3. As can be seen from FIG. 14, the restriction enzyme cutting results of plasmid XhoI are all correct, and the sequencing results are correct, that is, plasmid pAd5LCL3 with E2a region sequence position deleted, in which E1, E3, E4 and E2a genes are deleted, and ORF6/7 expression cassette of E4 region is placed, is obtained, and the vector map is shown in FIG. 49.

Example 4 construction of African Swine fever adenovirus type 5 vector E1 region shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L

1. Construction of shuttle plasmid in E1 region of human adenovirus type 5 vector

The backbone of the shuttle plasmid pS5E1 used basic elements (2796bp) such as puc origin and amp (pS5E1 backbone synthesized by Beijing Bomeide Gene technology, Inc.), ITR partial sequence (355bp) of Ad5 left arm, PIX partial sequence (2100bp) of right arm and PIVa2 partial sequence (2100bp), and CMV-MCS (Seq ID No.14) (944bp) SV40 early polyA (Seq ID No.15) (160 bp).

1) Primer design

puc-Ad5-right arm-F：TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT

Ad5-right arm-CMV-R：ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATATAAG

CMV-F：GTATCTGCTCCCTGCTTGTG

CMV-SV40-R：TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG

SV40-F：CTTCGCCCACCCCAACTTGT

SV40-R：AGAGGTCGACGGTATACAGAC

SV40-Ad5-left arm-F：TGTCTGTATACCGTCGACCTCTCCGAAAAACACCTGGGCGAGTCTCC

Ad5-left arm-puc-R：ACACTATAGAATACACGGAATTCTTAATTAAATCATCAATAATATACCTTATTTTG

puc-F：GAATTCCGTGTATTCTATAGTGT

puc-R：TTTCGATAAGCCAGCTGCATTA

2) Amplification of fragments of interest

Amplifying a CMV promoter MCS fragment of a pS5E1 shuttle plasmid by taking pCDNA3.1(+) as a template (the plasmid is purchased from Saimer fly company) and CMV-F and CMV-SV40-R as primers; an amplification system: 50ng of pCDNA3.1(+) plasmid, 1ul of 10uM CMV-F primer, 1ul of 10uM CMV-SV40-R primer and 20ul of Q5 high fidelity enzyme; supplementing water to 40 ul; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 1min, 35 cycles; 72 ℃ for 5 min.

② an SV 40-earlyplo A fragment of the pS5E1 shuttle plasmid is amplified by taking pCDNA3.1(+) as a template (the plasmid is purchased from Saimer Fei company) and SV40-F and SV40-R as primers; an amplification system: 50ng of pCDNA3.1(+) plasmid, 1ul of 10uM SV40-F primer, 1ul of 10uM SV40-R primer and 20ul of Q5 high-fidelity enzyme; supplementing water to 40 ul; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 10 sec; 72 ℃ for 5 min.

The amplification product agarose validation is shown in FIG. 15, in which lane 1 is CMV-MCS fragment, lane 2 is SV40 earlylylA fragment, and M is 2000 Marker. As can be seen from FIG. 15, the amplification results were correct.

③ purifying by using an Axygen gel recovery kit.

Fourthly, PCR amplification is carried out on the pS5E1 shuttle plasmid skeleton by taking pS5E1 skeleton plasmid synthesized by Bomeide company as a template and puc-F and puc-R as primers, and an amplification system is as follows: pS5E1 backbone plasmid 50ng, 10uM puc-F primer 1ul, 10uM puc-R primer 1ul, Q5 Hi-Fi enzyme 20 ul; supplementing water to 40 ul; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 1min, 20 sec; 72 ℃ for 5 min.

Fifthly, amplifying the left arm of the shuttle plasmid pS5E1 by taking pAd5LCL3 plasmid as a template and SV40-Ad5-left arm-F and Ad5-left arm-puc-R as primers, and obtaining an amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM SV40-Ad5-left arm-F primer, 1ul of 10uM Ad5-left arm-puc-R primer, 20ul of Q5 high fidelity enzyme and water supplementation to 40 ul. The PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 20s, 35 cycles; 72 ℃ for 5 min.

Sixthly, amplifying the right arm of the shuttle plasmid pS5E1 by taking pAd5LCL3 plasmid as a template and puc-Ad5-right arm-F and Ad5-right arm-CMV-R as primers, wherein the amplification system comprises the following steps: pAd5LCL3 plasmid 50ng, 10uM puc-Ad5-right arm-F primer 1ul, 10uM Ad5-right arm-CMV-R primer 1ul, Q5 Hi-Fi enzyme 20ul, water make up to 40 ul. The PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 15s, 35 cycles; 72 ℃ for 5 min.

Seventhly, amplifying the CMV-MCS-SV40 earlylyLYA fragment of the pS5E1 shuttle plasmid by taking the CMV-MCS of the glue recovery product as a template and CMV-F and SV40-R as primers, and obtaining an amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM CMV-F primer, 1ul of 10uM SV40-R primer, 20ul of Q5 high-fidelity enzyme and water supplement to 40 ul. The PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 40 s; 72 ℃ for 5 min.

The amplification product was verified on agarose as shown in FIG. 16, wherein lane 1 is CMV-MCS-SV40 earlyplolyA fusion fragment, lane 2 is PUC, lane 3 is Ad5 right arm, and lane 4 is Ad5 left arm.

3) Ligation transformation of fragments

The fragments were purified using Axygen gel recovery kit, and then four fragments of pS5E1 backbone, Ad5 left arm, Ad5 right arm, CMV-MCS-SV40 earlylylylA were ligated using a seamless Cloning kit from Bomeide, with linker systems of 2 × Smaless Cloning Mix 10ul, pS5E1 backbone 50ng, Ad5 left arm 50ng, Ad5 right arm 50ng, CMV-MCS-SV40 polyA 50ng, supplemented with water to 20ul, and incubated at 50 ℃ for 40 minutes to obtain the ligation product plasmid pS5E 1. The ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

4) Verification of plasmids

Bacterial colony PCR verification

Colonies were picked and checked on agarose gel, and a positive band was observed as shown in FIG. 17.

② enzyme digestion verification

And (3) selecting positive clones, placing the positive clones in 5mL of LB liquid culture medium containing ampicillin resistance, culturing for 12-15 hours, extracting plasmids, performing enzyme digestion verification, and obtaining electrophoresis results shown in figure 18, wherein the left 1-6 is single enzyme digestion of the plasmid pS5E1NcoI, the right 1-6 is single enzyme digestion of the plasmid pS5E1 PacI, the M is 15000bp Marker, the enzyme digestion results are correct, and successfully constructing a shuttle plasmid pS5E1 in the E1 region of the human adenovirus 5 type vector, and the vector map of the shuttle plasmid is shown in figure 50.

2. Construction of African swine fever adenovirus type 5 vector shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L

1) Ligation of pS5E1 with IRES fragment

Firstly, primer synthesis

IRES-EcoRV-F：ccg GATATC TGTCGTCATCATCCTTATAGTCC

IRES-NotI-R：aaatat GCGGCCGC GGTTGTGGCCATTATCATCGTG

Amplification of IRES fragment

An amplification system: 25ul of Q5 enzyme, 10uM primer IRES-EcoRV-F1 ul, 10uM primer IRES-NotI-R1 ul, 2ul of template IRES template and water supplementing to 50 ul; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 20s, 35 cycles; 72 ℃ for 5 min. The electrophoresis detection of the amplification result is shown in FIG. 19, wherein

lanes

1 and 2 are IRES fragment PCR amplification products, M is 15000bp Marker, and the amplification result is correct.

③ purification of the IRES fragment using Axygen PCR purification kit.

Cutting target fragment IRES with pS5E1 carrier enzyme

An enzyme digestion reaction system: vector pS5E1, IRES fragment ~ 2ug, EcoRV and NotI each 1 ul; 10 Xcutmarstat buffer 5 ul; adding water to 50 ul; reaction conditions are as follows: 30min at 37 ℃; inactivating at 65 deg.C for 20 min; and (5) recovering and purifying the glue. The electrophoretic detection of the cleavage products is shown in FIG. 20, wherein the fragment IRES EcoRV and NotI is cleaved in lane 1, the fragment pS5E1 EcoRV and NotI is cleaved in lane 2, and M is 15000bp Marker.

Connecting pS5E1 vector with IRES fragment

A connection system: pS5E1(100 ng); IRES fragment (vector: fragment 1:5, molar ratio); t4 DNA ligase 1 ul; 10 Xligase buffer1 ul; water is added to 10 ul. Reaction conditions are as follows: room temperature, 30 min. The ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

Sixth colony PCR verification

An amplification system: q5 enzyme 10ul, 10uM primer IRES-EcoRV-F1 ul, 10uM primer IRES-NotI-R1 ul, water supplement to 20 ul; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 20s, 35 cycles; 72 ℃ for 5 min. Electrophoresis was performed, as shown in FIG. 21, in which colonies Nos. 1 to 9 and M were Marker, as seen from FIG. 21, and positive bands appeared in Nos. 2 and 6.

And enzyme cutting verification of the plasmids NotI and EcoRV, selecting 2 and 6 for plasmid extraction, enzyme cutting verification, and obtaining the result shown in FIG. 22, wherein the enzyme cutting identification of the plasmid No.2 NotI and EcoRV, the enzyme cutting identification of the plasmid No.6 NotI and EcoRV, and the enzyme cutting result is correct.

2) Ligation of pS5E1-IRES to I215L fragment

Firstly, primer synthesis

I215L-NotI-F：aaggaaaaaaGCGGCCGCgccaccATGGTGAGCAGGTTTCTGATC

I215L-XhoI-R：catgCTCGAG TCAGGCGTAATCGGGCACAT

② PCR amplification of I215L fragment

An amplification system: 25ul of Q5 enzyme, 10uM primer I215L-NotI-F1 ul, 10uM primer I215L-XhoI-R1 ul, template I215L 1ul, and water is supplemented to 50 ul; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 40 s; 72 ℃ for 5 min.

③ purification of the I215L fragment using the Axygen PCR purification kit.

Fourthly, the target fragment I215L is enzyme-digested with pS5E1-IRES vector

An enzyme digestion reaction system: vector pS5E1-IRES, I215L fragment ~ 2ug, NotI and XhoI each 1 ul; 10 Xcutmarstat buffer 5 ul; water is added to 50 ul. Reaction conditions are as follows: 30min at 37 ℃; inactivating at 65 deg.C for 20 min. And (5) recovering and purifying the glue. The electrophoretic detection of the cleaved products is shown in FIG. 23, wherein the lane vector is double cleaved with pS5E1-IRES NotI and XhoI, the lane I215L is double cleaved with fragment I215L NotI and XhoI, and M is 15000bp and 2000bp Marker.

Fifth, the target fragment I215L is connected with pS5E1-IRES

A connection system: pS5E1-IRES (100 ng); I215L fragment (carrier: fragment 1: 3 molar ratio); t4 DNA ligase 1 ul; 10 Xligase buffer1 ul; water is added to 10 ul. Reaction conditions are as follows: room temperature, 30 min. The ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

Sixth colony PCR verification

An amplification system: q5 enzyme 10ul, 10uM universal primer CMV-F1 ul, 10uM primer I215L-XhoI-R1 ul, and supplementing water to 20 ul; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 30s, 35 cycles; 72 ℃ for 5 min. Electrophoresis was performed, as shown in FIG. 24, in which the numbers 1 to 11 were colonies and M was 2000bp Marker. As can be seen in FIG. 24, 1,2, 5,6,7, 8, 11 are positive colonies.

And seventhly, carrying out plasmid enzyme digestion verification (NotI and XhoI), selecting colonies of 5,6,7 and 8, carrying out plasmid extraction, and carrying out enzyme digestion verification. The results are shown in FIG. 25, which are all positive plasmids.

3) Ligation of pS5E1-IRES-MGF5L6L with fragment L8Lubiqutin

Firstly, primer synthesis

L8L-BamHI-F：cgcGATCCgccaccATGGGCAACAGACTGATCAAG

L8L-ubiqutin-R：AAGGGTTTTCACGAAAATCTGCATGGCGTAGTCGGGCACGTCGT

ubiqutin-F：ATGCAGATTTTCGTGAAAACCC

ubiqutin-EcoRV-R：ccgGATATC TTACTTGTCTTCTGGTTTGTTGA

② PCR amplification of L8Lubiqutin fragment

Amplification of L8L fragment

An amplification system: 25ul of Q5 enzyme, L8L-BamHI-F1 ul of primer, L8L-ubiqutin-R1 ul of primer, L8L 2ul of template, and supplementing water to 50 ul; reaction conditions are as follows: 30S at 98 ℃; 10s at 98 ℃, 30s at 68 ℃, 15s at 72 ℃ and 35 cycles; 5min at 72 ℃.

Amplification of ubiqutin fragments

An amplification system: 25ul of Q5 enzyme, 1ul of a primer ubiqutin-F, 1ul of a primer ubiqutin-EcoRV-R, 2ul of a template ubiqutin, and 50ul of water; reaction conditions are as follows: 30S at 98 ℃; 10s at 98 ℃, 30s at 68 ℃, 15s at 72 ℃ and 35 cycles; 5min at 72 ℃.

Purifying the L8L and ubiqutin fragments by using an Axygen gel recovery and purification kit;

fusion PCR amplification of L8Lubiqutin fragment

An amplification system: 25ul of Q5 enzyme, 25ul of upstream primer L8L-BamHI-F, 50ng of downstream primer ubiqutin-EcoRV-R template fragment L8L and fragment ubiqutin respectively, and water is supplemented to 50 ul; reaction conditions are as follows: 98 deg.C; 5s at 98 ℃, 30s at 68 ℃, 30s at 72 ℃ and 35 cycles; 7min at 72 ℃.

③ purifying the L8Lubiqutin fragment by using an Axygen PCR purification kit, wherein the fused L8Lubiqutin fragment is shown in FIG. 26.

Fourthly, enzyme digestion of target fragment L8Lubiqutin and pS5E1-IRES-I215L carrier

An enzyme digestion reaction system: vector pS5E1-IRES-I215L, L8Lubiqutin fragment-2 ug, EcoRV and BamHI each 1 ul; 10 Xcutmarstat buffer 5 ul; water is added to 50 ul. Reaction conditions are as follows: 30min at 37 ℃; inactivating at 65 deg.C for 20 min. And (5) recovering and purifying the glue. The restriction products were detected by electrophoresis as shown in FIG. 27, in which lane 1 is pS5E1-IRES-I215L plasmid; lane 2 is pS5E1-IRES-I215L plasmid EcoRV and BamHI cut; lane 3 shows the L8Lubiqutin fragments EcoRV and BamHI cut, M15000 bp Marker.

Connecting pS5E1-IRES-I215L vector with L8Lubiqutin fragment

A connection system: pS5E1-IRES-I215L 100 ng; 50ng of L8Lubiqutin fragment; t4 DNA ligase 1 ul; 10 Xligase buffer1 ul; water is added to 10 ul. Reaction conditions are as follows: room temperature, 30 min. The ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

Sixth colony PCR verification

An amplification system: q5 enzyme 10ul, 10uM universal primer CMV-F1 ul, 10uM primer ubiqutin-EcoRV-R1 ul, and water is supplemented to 20 ul; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 40 s; 72 ℃ for 5 min; electrophoresis was performed, as shown in FIG. 28, in which the numbers 1 to 24 were colonies and M was 2000bp Marker.

Seventhly, carrying out enzyme digestion verification on the plasmids BamHI and EcoRV, selecting colonies of 4, 6, 9, 14, 17 and 18 for plasmid extraction, carrying out enzyme digestion verification, wherein the results are shown in figure 29, the enzyme digestion verification is carried out on the BamHI and EcoRV, and M is 15000bp Marker. As can be seen from FIG. 29, the restriction enzyme digestion result is correct, the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L plasmid of the E1 region of the African swine fever adenovirus type 5 vector is successfully constructed, and the vector map is shown in FIG. 51.

Example 5 construction of African Swine fever adenovirus type 5 vector E4 region shuttle plasmid pS5E4-I73Rhbsag-2A-E146L

1. Construction of shuttle plasmid in E4 region of human adenovirus type 5 vector

The skeleton of the shuttle plasmid pS5E4 adopts puc origin, amp and other basic elements, the left arm ITR sequence (370bp) of Ad5E4 region, the right arm fiber gene sequence (1746bp) and EF1 alpha-EGFP-HBV polyA gene.

1) Gene synthesis

EF1 alpha-EGFP-HBV polyA gene was synthesized by Bomeide.

2) Primer design

puc-Ad5E4-left arm-F：

AGGTGACACTATAGAATACACGTTAATTAAATCATCAATAATATACCTTATTTTG

Ad5E4-left arm-EF1α-R：caatccccccttttcttttaaaaAACACCACTCGACACGGCAC

EF1α-F：ttttaaaagaaaaggggggattg

EF1α-R：TAGAGCCCCAGCTGGTTCTTT

EF1α-Ad5E4-right arm-F：GGAAAGAACCAGCTGGGGCTCTAGCAATTGAAAAATAAACACGTTGA

Ad5E4-right arm-puc-R：TAATACGACTCACTATAGGGAGACCCAAAATGTAACCACTGTGAG

puc-F：TCTCCCTATAGTGAGTCGTATT

puc-R：CGTGTATTCTATAGTGTCACCT

ORF6/7-Protease-F：CGTTGAAACATAACACAAACGATACGGCGCAGACGGCAAGGGTGGG

3) Amplification of fragments of interest

Amplifying an EF1 alpha-EGFP-HBV polyA fragment of a pS5E4-EGFP shuttle plasmid by taking an EF1 alpha-EGFP-HBV gene synthetic fragment as a template and EF1 alpha-F and EF1 alpha-R as primers; an amplification system: EF1 alpha-EGFP-HBV gene synthetic fragment 50ng, 10uM EF1 alpha-F primer 1ul, 10uM EF1 alpha-R primer 1ul, Q5 Hi-Fi enzyme 20 ul; supplementing water to 40 ul. The PCR procedure was: 98 ℃ for 10 sec; 35 cycles of 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 40 sec; 72 ℃ for 5 min.

② the left arm segment of the pS5E1 shuttle plasmid is amplified by taking pAd5LCL3 as a template and puc-Ad5E4-left arm-F and Ad5E4-left arm-EF1 alpha-R as primers. An amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM puc-Ad5E4-left arm-F primer, 1ul of 10uM Ad5E4-left arm-EF1 alpha-R primer, and 20ul of Q5 Hi-Fi enzyme; supplementing water to 40 ul. The PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 10 sec; 72 ℃ for 5 min.

Thirdly, amplifying the right arm segment of the pS5E4-EGFP shuttle plasmid by taking pAd5LCL3 as a template and EF1 alpha-Ad 5E4-right arm-F and Ad5E4-right arm-puc-R as primers; an amplification system: pAd5LCL3 plasmid 50ng, 10uM EF1 α -Ad5E4-right arm-F primer 1ul, 10uM Ad5E4-right arm-puc-R primer 1ul, Q5 Hi Enzyme 20 ul; supplementing water to 40 ul.

The PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 40 sec; 72 ℃ for 5 min.

Fourthly, PCR amplification is carried out on the pS5E4-EGFP shuttle plasmid skeleton by taking the pS5E1 plasmid as a template and puc-F and puc-R as primers; an amplification system: pS5E1 backbone plasmid 50ng, 10uM puc-F primer 1ul, 10uM puc-R primer 1ul, Q5 Hi-Fi enzyme 20 ul; supplementing water to 40 ul. The PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 1min, 20 sec; 72 ℃ for 5 min. The agarose validation of the amplification products is shown in FIG. 30, wherein lane 1 is the left arm of pS5E4-EGFP shuttle plasmid, lane 2 is the right arm of pS5E4-EGFP shuttle plasmid, lane 3 is EF1 α -EGFP-HBV, lane 4 is the backbone of pS5E4-EGFP shuttle plasmid, and M is 2000 Marker. As can be seen from FIG. 30, the amplification results were correct.

4) The desired fragment was purified using the Axygen gel recovery kit.

5) Ligation transformation of fragments

Connecting the four fragments of the left arm of the pS5E4-EGFP shuttle plasmid, the right arm of the pS5E4-EGFP shuttle plasmid, EF1 alpha-EGFP-HBV and pS5E4-EGFP shuttle plasmid skeleton by using a seamless Cloning kit of Bomeide company, wherein the connecting system is 2 multiplied by Smaless Cloning Mix 10ul, 50ng of the left arm fragment of the pS5E4-EGFP shuttle plasmid, 50ng of the right arm fragment of the pS5E4-EGFP shuttle plasmid, 50ng of the EF1 alpha-EGFP-HBV fragment, 50ng of the shuttle plasmid skeleton fragment of pS5E4-EGFP, replenishing water to 20ul, and preserving the temperature for 40 minutes at 50 ℃; the ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

6) Verification of plasmids

Bacterial colony PCR verification

The objective fragment was PCR-amplified by colony using the primer puc-Ad5E4-left arm-F/EF1 alpha-R as a primer, and the result of agarose gel validation shows that a positive band appears as shown in FIG. 31.

② enzyme digestion verification

Selecting No.3, 4,5 and 6 positive clones, culturing in 5mL LB liquid medium containing ampicillin resistance for 12-15 hours, extracting plasmids for enzyme digestion verification, wherein electrophoresis results are shown in figure 32, wherein 1-4 is No.3, 4,5 and 6 positive clones PacI single enzyme digestion, 5-8 is No.3, 4,5 and 6 positive clones HindIII single enzyme digestion, M1 and M3: 15000bp Marker; m2: 2000bp Marker; the enzyme digestion result is correct, and the sequencing is correct; the shuttle plasmid pS5E4-EGFP in the E4 region of the human adenovirus type 5 vector was successfully constructed, and the vector map thereof is shown in FIG. 52.

2. Construction of shuttle plasmid pS5E4-I73Rhbsag-2A-E146L in E4 region of African swine fever adenovirus type 5 vector

1) Primer design

pS5E4-I73R-BamHI-F：ccaagctgtgaccggcgcctacGGATCCgccaccATGGAGACACAGAAG

I73R-hbsag-R：AGCCGCTGGTGGTGTTCTCCATGGCGTAGTCAGGCACATCGTA

hbsag-F：ATGGAGAACACCACCAGCGGC

hbsag-2A-R：TGAAGTTAGTAGCTCCGCTTCCGATGTACACCCAGAGGCAGAA

2A-F：GGAAGCGGAGCTACTAACTTC

2A-E146L-R：ACAAAGTCTGTTGTTCCGCCCATAGGTCCAGGGTTCTCCTCCA

E146L-F：ATGGGCGGAACAACAGACTTT

E146L-pS5E4-XhoI-R：CGGGTTTAAACGGGCCCTCTAGACTCGAGTTAGATGATTCTCTGC

2) Amplification of fragments of interest I73R, hbsag, 2A, E146L

Amplifying an I73R fragment by taking an I73R gene synthetic fragment as a template and pS5E4-I73R-BamHI-F and I73-hbsag-R as primers; an amplification system: 50ng of I73 gene synthetic fragment, 1ul of 10uM pS5E4-I73R-BamHI-F primer, 1ul of 10uM I73-hbsag-R primer and 20ul of Q5 Hi-Fi enzyme; supplementing water to 40 ul; the PCR procedure was: 98 ℃ for 10 sec; 35 cycles of 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 20 sec; 72 ℃ for 5 min.

Amplifying the hbsag fragment by using the hbsag gene synthetic fragment as a template and using hbsag-F and hbsag-2A-R as primers; an amplification system: 50ng of the hbsag gene synthetic fragment, 1ul of 10uM hbsag-F primer, 1ul of 10uM hbsag-2A-R primer and 20ul of Q5 high fidelity enzyme; supplementing water to 40 ul; the PCR procedure was: 98 ℃ for 10 sec; 35 cycles of 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 20 sec; 72 ℃ for 5 min.

Thirdly, amplifying the 2A fragment by taking the 2A gene synthesized fragment as a template and taking 2A-F and 2A-E146L-R as primers; an amplification system: 50ng of 2A gene synthetic fragment, 1ul of 10uM 2A-F primer, 1ul of 10uM 2A-E146L-R primer and 20ul of Q5 high fidelity enzyme; supplementing water to 40 ul; the PCR procedure was: 98 ℃ for 10 sec; 35 cycles of 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 20 sec; 72 ℃ for 5 min.

Fourthly, amplifying the E146L fragment by taking the E146L gene synthetic fragment as a template and taking E146L-F and E146L-pS5E4-XhoI-R as primers; an amplification system: 50ng of E146L gene synthetic fragment, 1ul of 10uM E146L-F primer, 1ul of 10uM E146L-pS5E4-XhoI-R primer and 20ul of Q5 Hi-Fi enzyme; supplementing water to 40 ul; the PCR procedure was: 98 ℃ for 10 sec; at 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 30sec, 35 cycles; 72 ℃ for 5 min.

The desired fragment was purified using the Axygen gel recovery kit.

4) Fusion PCR amplification of I73Rhbsag fragment

An amplification system: 50ng of I73R gel recovery fragment, 50ng of hbsag gel recovery fragment, 1ul of 10uM pS5E4-I73R-HamHI-F primer, 1ul of 10uM hbsag-2A-R primer and 25ul of Q5 Hi-Fi enzyme; adding water to 50 ul; the PCR procedure was: 98 ℃ for 10 sec; 35 cycles of 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 20 sec; 72 ℃ for 5 min.

5) Fusion PCR amplification of 2A-E146L fragment

An amplification system: 50ng of a 2A gel recovery fragment, 50ng of an E146L gel recovery fragment, 1ul of a10 uM 2A-F primer, 1ul of a10 uM E146L-pS5E4-XhoI-R primer and 25ul of Q5 Hi-Fi enzyme; adding water to 50 ul; the PCR procedure was: 98 ℃ for 10 sec; at 98 deg.C, 5sec, 60 deg.C, 30sec, 72 deg.C, 30sec, 35 cycles; 72 ℃ for 5 min. The fusion results are shown in FIG. 33, in which lane 1 is the I73Rhbsag fragment, lane 1 is the 2A-E146L fragment, and M is 2000bp Marker.

6) pS5E4-EGFP vector restriction enzyme

An enzyme digestion reaction system: vector pS5E4-EGFP 2ug, BamHI and XhoI each 1 ul; 10 Xcutmarstat buffer 5 ul; water is added to 50 ul. Reaction conditions are as follows: 30min at 37 ℃; inactivating at 65 deg.C for 20 min. And recovering and purifying the Axygen kit gel.

7) Purifying the vector fragment by using an Axygen gel recovery kit;

the gel recovery results are shown in FIG. 34, in which lane 1 shows the recovery of the fragment pS5E 4-EGFPdamI, XhoI double-enzyme gel, M is 15000bp Marker.

8) pS5E4-EGFP glue recovery vector, I73Rhbsag fragment and 2A-E146L seamless cloning connection and transformation

A connection system: the pS5E4-EGFP gel recovered product (100ng), I73Rhbsag fragment (50ng), 2A-E146L fragment (50ng), 2 × Smaless Cloning Mix 5ul, supplemented with water to 10 ul. Reaction conditions are as follows: 50 ℃ for 40 min. The ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

9) Verification of plasmids

Bacterial colony PCR verification

The target fragment was amplified by colony PCR using EF1 α 2(jd) -F, HBV (jd) -R as primers, and the results of agarose gel assay are shown in FIG. 35, in which the numbers 1-12 are colonies, M is 15000bp Marker, and all are positive bands.

② enzyme digestion verification

Selecting No.1, No.2 and No.3 positive clones, culturing in 5mL LB liquid culture medium containing ampicillin resistance for 12-15 hours, extracting plasmids, and performing BmHI and XhoI double enzyme digestion verification; the cleavage results are shown in FIG. 36, wherein

lanes

1,2 and 3 are positive clones BamHI and XhoI, and M is 15000bp Marker. The restriction enzyme cutting result is correct, the sequencing is correct, the shuttle plasmid pS5E4-I73Rhbsag-2A-E146L of the E4 region of the African swine fever adenovirus type 5 vector is successfully constructed, and the vector map is shown in FIG. 53.

Example 6 recombination of shuttle plasmids pS5E1-L8Lubiqutin-IRES-I215L, pS5E4-I73Rhbsag-2A-E146L and pAd5LCL3 constructs pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L plasmid

1. Homologous recombination of shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3

1) PacI and SwaI carry out enzyme digestion on the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and the adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system is as follows:

A. shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L 3 μ g; PacI 2 ul; buffer cutmarst 4 ul; supplementing water to 40 ul.

B. Adenovirus vector plasmid pAd5LCL 33 ug; SwaI 2 ul; buffer 3.14 ul; supplementing water to 40 ul.

The reaction conditions are 37 ℃ and 1 h; inactivating at 65 deg.C for 20 min.

2ul agarose gel was used for verification, and the result is shown in FIG. 37, wherein lane 1 is pAd5LCL3, and lane 2 is pS5E1-L8 Lubiqutin-IRES-I215L.

2) Dephosphorylation of enzyme digestion products

Reaction system: 37.5ul of enzyme digestion reaction liquid; dephosphorylating enzyme 1 ul; dephosphorylating buffer 5 ul; water is added to 50 ul. The reaction conditions are 37 ℃ and 1 h; inactivating at 65 deg.C for 5 min.

3) Gel recovery of the vector and fragment was performed using the OMEGA Ultra-Sep Gel Extraction Kit.

4) And co-transforming BJ5183 competent cells by using 100ng of purified shuttle plasmids and 100ng of purified adenovirus vectors, coating the transformed products on an LB plate containing Kan, and culturing at 37 ℃ for 12-16 h.

5) Selecting colonies in 5mL LB liquid medium containing Kan, carrying out shake culture at 37 ℃ for 12-16 h, and extracting plasmids for XhoI enzyme digestion verification; the results are shown in FIG. 38, where lanes 1-7 are pAd5LCL3-L8Lubiqutin-IRES-I215L clone, M: 15000bp Marker, as can be seen from FIG. 38, clones No.6 and No.7 were cleaved correctly.

6) The No.6 positive plasmid is transformed to DH5a competence, a colony is selected to be placed in 5mL LB liquid culture medium containing Kan, shaking culture is carried out at 37 ℃ for 12-16 h, plasmid extraction is carried out again, XhoI enzyme digestion verification is carried out, the enzyme digestion result is shown in figure 39, wherein a No.1 lane is pAd5LCL3-L8Lubiqutin-IRES-I215L plasmid XhoI enzyme digestion, M is 15000bp Marker, as can be seen from figure 39, the enzyme digestion result is correct, and adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L is successfully constructed.

2. The shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and the adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L are subjected to homologous recombination to obtain pAd5LCL3-L8Lubiqutin-I215L-I73HbsAg-E146L

1) The shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and the adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L are subjected to enzyme digestion by PacI and I-sceI, and the enzyme digestion reaction system is as follows:

A. shuttle plasmid pS5E4-I73Rhbsag-2A-E146L 3. mu.g; PacI 2 ul; 10 Xcutmarstat buffer 4 ul; supplementing water to 40 ul.

B. Adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L 3 ug; I-sciI 2 ul; buffer cutmarst 4 ul; supplementing water to 40 ul.

2ul agarose gel was used for verification, and the results are shown in FIG. 40, wherein lane 1 is pS5E4-I73Rhbsag-2A-E146L, and lane 2 is pAd5LCL3-L8 Lubiqutin-IRES-I215L.

2) Dephosphorylation of enzyme digestion products

3) Gel recovery of the vector and fragment was performed using the OMEGAUultra-Sep Gel Extraction Kit.

5) 6 colonies were picked and shake-cultured in 5mL LB liquid medium containing Kan at 37 ℃ for 12-16 h, and plasmids were extracted for XhoI restriction enzyme validation, the results are shown in FIG. 41, where lanes 1-8 are plasmids, M is 15000bp Marker, and it can be seen that 1-8 plasmids are all correct.

6) Transforming the positive plasmid No.2 to DH5a competent; selecting a colony in 5mL LB liquid medium containing Kan, carrying out shake culture at 37 ℃ for 12-16 h, extracting plasmids, and carrying out XhoI enzyme digestion verification again; the digestion result is shown in FIG. 42, the lane No.2 is pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L plasmid XhoI digestion, M is 15000Marker, and as can be seen from FIG. 42, pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L is successfully constructed, the digestion result is correct, and the vector map is shown in FIG. 54.

EXAMPLE 7 packaging of recombinant adenovirus

The pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L plasmid was packaged using 293TD37 cells, and the procedure was as follows:

preparation of 293TD37 cells: the day before transfection, cells were prepared, and 293TD37 cells to be transfected were seeded into 6-well plates at 0.5X 10⁶Pore, 5% CO at 37 ℃₂The cells were cultured for 24 hours at rest, and the cells had a confluency of 40-50% on the day of transfection.

Plasmid pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L linearization: the plasmid to be transfected was digested with PacI, incubated at 37 ℃ for 40min and then inactivated at 65 ℃ for 20 min.

Transfection: the linearized 2. mu.g plasmid and PEI were diluted separately with 100ul serum-free medium; and adding the plasmid diluent into the PEI diluent, repeatedly sucking for 5 times or vortexing for 10 seconds, uniformly mixing, and incubating for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture was gently aspirated from the plate, 2mL of fresh growth medium was added, and 10 minutes later the transfection complex was added to the cells that had been replaced with fresh medium.

Cell culture: transfected 293TD37 cells at 37 ℃ in 5% CO₂Standing and culturing for 72-96 hours in an incubator; after the viral plasmid is transfected for 72-96 hours, 6-well plate cell suspension is collected in a 1.5ml centrifuge tube, namely TP 0.

Continuous inoculation: freezing and thawing the collected cell suspension at-80 deg.C for 3 times, centrifuging at 4 deg.C and 2000g for 10min, collecting supernatant 500ul, infecting 293TD37 cells (293TD37 cells need to be prepared one day earlier), and culturing at 37 deg.C and 5% CO₂Incubate for 60 min, supplement 2mL FBS medium, 37 ℃, 5% CO₂Culturing for 72 hours, and collecting cell suspension TP 1; the previous steps were repeated and the cell suspension, i.e., TP2, was collected. The virus inoculation is continued until the cells show lesions.

Cytopathic effect: after 293TD37 cells were cultured from TP0 to TP4, the cells were progressively diseased until 293TD37 cells were completely diseased at TP 4. The cytopathic effects of TP0 to TP4 are shown in FIGS. 43-47, respectively.

Example 8 detection of titer of African Swine fever Multi-antigen recombinant adenovirus vaccine

293TD37 cells were prepared, well-grown cells were collected from T75 flasks, supernatant was discarded, cells were washed with PBS, digested with 0.25% trypsin, digested with 10mL of fresh DMEM medium containing 10% fetal bovine serum, aspirated and mixed, and seeded into 6-well plates (5X 10)⁵Viable cells/mL, 2mL per well), 5% CO at 37 deg.C₂And (5) standing and culturing in a carbon dioxide incubator. After 24 hours, after the cells grow into monolayer cells in an adherent way, the culture medium is discarded, and serum-free DMEM maintenance liquid is used for 10 times of recombinant adenovirus^-3～10^-6The dilutions were performed in duplicate, and each dilution was inoculated into 2 wells at 250uL per well, and after 1 hour of infection, the supernatant was discarded, supplemented with complete medium, and then subjected to static culture in a 5% carbon dioxide incubator at 37 ℃. After 24h, the supernatant was discarded, cells were washed with PBS 1mL per well, PBS was discarded, 1mL of cold formaldehyde was added per well for fixation, room temperature 10min, formaldehyde was discarded, cells were washed with PBS 1mL per well, adenovirus antibody-FITC was added 1mL per well, after 1h at room temperature, cells were washed with PBS 1mL per well, 1mL PBS was added per well after two passes, and counting was performed under a fluorescent microscope (200 x, 10 sequential fields). And (3) calculating: viral titer (FFU/mL) mean × 1013 × 4 × 10^(-n). FFU of pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virusIs 2.2X 10⁸FFU/mL, higher titer.

Example 9 detection of stability of African Swine fever multiple antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L

Preparing 293TD37 cells, collecting well-grown cells from T75 culture flask, discarding supernatant, washing cells with PBS, digesting with 0.25% trypsin, adding 10mL of DMEM fresh medium containing 10% fetal calf serum to stop digestion, mixing, seeding 293TD37 cells into 6-well plate (5 × 10)⁵cells/mL, 2 mL/well), incubating for 1 hour at room temperature to adhere, and observing the adherence degree under a microscope after incubation. Infection was performed with pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus particles, with a titer of 5 MOI/well. After the 293TD37 cells are diseased 48 hours later, the cells are collected, freeze thawing is carried out repeatedly for 3 times, then centrifugation is carried out at 2000g, the supernatant is collected, the collected supernatant is used for detecting FFU, and then new 293TD37 cells are infected again until 30 generations. The virus liquid collected from the 5 th, 10 th, 15 th, 20 th, 25 th and 30 th generations is detected, and the genome of the virus is still complete, which indicates that the replication-defective pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus can be stably packaged in 293TD37 cells.

Example 10 detection of African Swine fever multiple antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L recovery mutation (RCA)

The pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus RCA detection method comprises the following steps:

1. pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus solution is prepared, the virus titer is measured, the virus particle concentration is measured, 1% of Universal nucleic acid (Universal nucleic acid 7.5-15 units/mL virus solution) is added into the virus solution to digest the DNA of the host cell, and the mixture is subjected to water bath at 37 ℃ for 40 min. The virus particles are collected by using an ultrafiltration centrifugal tube with 300Kd, centrifuging for 30min by 1000g and eluting by 1 XPBS, and the A260 is measured, and the concentration of the particles is A260 x 1.1 x 10 x 12 VP/mL.

2. Viral infection, 6-well plates of A549 cells were prepared, 2.5X 10 cells per well⁵Per well, discard medium, wash with PBS once, and place adenovirus at 1X 10⁹vP/well inoculation of virus, infection of A549 cells, wild type adenovirus type 5 as control, 37℃，5％CO₂After 1h, abandoning the virus liquid, supplementing 5% of complete culture medium, 37 ℃ and 5% of CO₂Culturing for 48 h.

3. Immunostaining, discarding cell supernatant, washing cells on the surface of PBS, fixing with glacial formaldehyde, standing at-20 deg.C for 20min, washing with 1 × PBS for three times, each time for 5min, adding 2ml of 1% BSA-PBS solution into each well, placing on a shaker, and incubating for 1 h. The supernatant was discarded, adenovirus type 5 fluorescent antibody (1:500 dilution) was added, incubated for 1h, and washed three times with 1 XPBS for 5min each time.

Observing with 10-fold fluorescence microscope, and calculating RCA by using formula

RCA＝(average positive cell field)×(374field/well)×(dilution factor))/Total VPs in 0.5ml viral sample

The judgment criterion was that RCA level was <1 RCA/3X 10¹⁰vp. The level of RCA of pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L is less than 1RCA/3 multiplied by 10¹⁰vp, which shows that the replication-defective pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus prepared by the invention can be stably packaged in 293TD37 cells, and the probability of conversion into wild type is low or not.

Example 11 African swine fever multiple antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L protein expression test

Preparing 293TD37 cells one day in advance, placing the 293TD37 cells in a 12-hole cell culture plate, infecting 293TD37 cells by using African swine fever multi-antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L virus, enabling the cells to be diseased after 48 hours, collecting all 1ml of cells, washing the cells by using PBS, preparing samples and using the samples for Western Blot detection; the target protein was detected using antibodies to HA, purchased from Abcam. Wherein the L8Lubiquitin fusion protein, I215L protein HAs HA tag, and the protein size is 32kda and 26 kda. The experimental results are shown in FIG. 48, wherein lane 1 is 293 blank cells, and

lanes

2 and 3 are samples of 293TD37 cells infected with pAd5LCL3-L8Lubiqutin-I215L-I73 Rhbsag-E146L; it can be clearly seen that the L8Lubiquitin fusion protein and the I215L protein have normal expression, and thus the pAd5LCL3-L8 Lubiquitin-I215L-I73 Rhbsag-E146L vaccine can normally express the target protein in 293 cells.

Example 12 immunological evaluation on African Swine fever multiple antigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L mouse model

Vaccine cellular immune response detection

10 SPF-rated mice (6-8 weeks old) were randomized into 2 groups of 5 mice each. Mice were immunized with pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L according to the grouping shown in Table 1. The injection mode is as follows: intramuscular injection of the inner thigh; the injection dose is as follows: 100 ul.

Table 1: vaccine immunoassay for grouping of mice

Mice were sacrificed 14 days after immunization, splenic lymphocytes were isolated, and cultured for 6 hours with stimulation of PK15 cells transfected with shuttle plasmids pS5E1-L8Lubiqutin-I215L and pS5E4-I73Rhbsag-E146L, while blocking cytokine secretion by addition of a protein secretion blocking agent. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after fixation and perforation of the cells. Cell surface markers include CD4, CD8, and intracellular cytokines include IFN γ, IL 2. The levels of IFN γ and IL2 expression of CD4+ T cells and CD8+ T cells after stimulation with the protein of interest were analyzed using a flow cytometer (CyExpert).

CD8+ T cell and CD4+ T cell immune responses induced by pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L are shown in FIGS. 55 and 56, and representative results are shown in FIGS. 57-58, wherein FIG. 57 is a representation of cellular immune responses after intramuscular injection of pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L, and FIG. 58 is a representation of blank control immune responses. The results show that: 14 days after mice are immunized, after spleen cells are stimulated by target protein, the levels of IFN gamma, TNF alpha and IL2 expressed by CD8+ T cells are all obviously higher than that of Ad5 vector Control group (Control) (P < 0.05). After CD4+ T cells are stimulated, the expression levels of IFN gamma, TNF alpha and IL2 are all obviously higher than those of an Ad5 vector Control group (Control) (P < 0.05). The result of cellular immune response detection shows that the adenovirus vector vaccine immunized by intramuscular injection with 1 x 10^7FFU can induce the immunized mice to generate specific cellular immune response.

Although the present invention is disclosed above, the present invention is not limited thereto. Various changes and modifications may be effected therein by one skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Jiaxing Anyu Biotechnology Ltd

<120> recombinant adenovirus vaccine for African swine fever and construction method thereof

<150> 2020106427557

<151> 2020-07-06

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 336

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgggcaaca gactgatcaa gaaggatctg aagaagtgtg agtactacta cggcgagcag 60

cagaacctga agcagatctg gagactgctg tttaatgagc ctctgggcac ctacgtggtg 120

tccagcttcc tgaagaagaa ctacgtggtg atctccttct cctgtcctac aaacacaaga 180

atcatgcacc tgagaatcaa catctgctac gatctgtact gtatcaacgg cgagtactac 240

gagaagatcg acgattttat caggctgtac ccccacatct tctacaggcc tctgtacagg 300

tacaagagct acccttacga cgtgcccgac tacgcc 336

<210> 2

<211> 471

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcagattt tcgtgaaaac ccttacgggg aagaccatca ccctcgaggt tgaaccctcg 60

gatacgatag aaaatgtaaa ggccaagatc caggataagg aaggaattcc tcctgatcag 120

cagagactga tctttgctgg caagcagctg gaagatggac gtactttgtc tgactacaat 180

attcaaaagg agtctactct tcatcttgtg ttgagacttc gtggtggtgc taagaaaagg 240

aagaagaagt cttacaccac tcccaagaag aataagcaca agagaaagaa ggttaagctg 300

gctgtcctga aatattataa ggtggatgag aatggcaaaa ttagtcgcct tcgtcgagag 360

tgcccttctg atgaatgtgg tgctggggtg tttatggcaa gtcactttga cagacattat 420

tgtggcaaat gttgtctgac ttactgtttc aacaaaccag aagacaagta a 471

<210> 3

<211> 666

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggtgagca ggtttctgat cgccgagtac aggcacctga tcgagaaccc ctccgagaac 60

tttaagatct ccgtgaacga gaaggatatg acagagtggg atgtgatcct gagaggcccc 120

cctgacacct tttacgaggg cggcctgttt aaggccaaga tcgcctttcc tcccgagtac 180

ccttacgccc cccccaggct gacatttaca agcgagatgt ggcaccccaa catctacagc 240

gatggcaagc tgtgtatctc catcctgcac ggcgacaatg ccgaggagca gggcatgaca 300

tggagccctg cccagaagat cgacaccatc ctgctgagcg tgatctccct gctgaacgag 360

cctaaccctg actcccccgc caacgtggat gccgccaaga gctacaggaa gctgctgtac 420

aaggaggacc tggagtccta ccccatggag gtgaagagga ccgtgaagaa gtccctggat 480

gagtgctccc ccgaggacat cgagtacttt aagaacgccg ccagcaatgt gcctcctatc 540

ccttccgacg cctacgagga tgagtgcgag gagatggagg atgacaccta catcctgacc 600

tacgacgatg aggacgagga ggaggaggat gacgagtacc cctacgatgt gcccgattac 660

gcctga 666

<210> 4

<211> 243

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggagacac agaagctgat ctccatggtg aaggaggccc tggagaagta ccagtaccct 60

ctgaccgcca agaatatcaa ggtggtgatc cagaaggagc acaacgtggt gctgcctacc 120

ggctccatca attccatcct gtactccaac agcgagctgt tcgagaagat cgacaagacc 180

aacaccatct accctcctct gtggatcagg aagaactacc cctacgatgt gcctgactac 240

gcc 243

<210> 5

<211> 678

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggagaaca ccaccagcgg cttcctgggc cccctgctgg tgctgcaggc cggattcttc 60

ctgctgaccc gcatcctgac catcccccag agcctggaca gctggtggac ctccctgaac 120

tttctgggcg gggcccccac ctgccccgga cagaactctc agagccccac ctccaaccac 180

agccccacca gctgcccccc catctgccca ggatatagat ggatgtgcct ccgccgcttc 240

atcatcttcc tgttcatcct gctcctgtgc ctcatcttcc tcctcgtgct cctggactac 300

cagggcatgc tccccgtctg ccccctcctg cctggcacat ccaccacctc caccggcccc 360

tgcaagacct gcaccatccc cgcccagggc acctccatgt tcccctcctg ctgctgcacc 420

aaaccctccg acggcaactg cacctgcatc cccatcccca gcagctgggc cttcgccagg 480

ttcctgtggg aatgggccag cgtcaggttc agctggctct ccctcctcgt gcccttcgtg 540

cagtggtttg tgggcctgag ccccaccgtc tggctcagcg tgatctggat gatgtggtat 600

tgggggcccc gcctgtacaa catcctctcc cctttcctcc ccctgctgcc catcttcttc 660

tgcctctggg tgtacatc 678

<210> 6

<211> 441

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgggcggaa caacagactt tgtgctgagc atcacaatcg tgctggtgat cctgatcatc 60

atcgccttca tctggtacaa ttttaccggc tggtccccct ttaagtacag caagggcaac 120

accgtgacat ttaagacccc tgacgagagc agcatcgcct acatgagatt taggaactgt 180

gtgttcacat tcaccgaccc caagggcagc ctgcacagca tcgacgtgac agaggtgctg 240

aacaacatgg ccaagggctt tagggatgcc cagaatcccc ctagctcctt cacactgggc 300

ggccactgcc aggcccccct gaatgctttt tcctttgtgc tgcctggcgt gaacgacaga 360

gccacagtgg ccaccgccga cgaggccaag aagtgggaga actgcgacgc caccctgacc 420

ggcctgcaga gaatcatcta a 441

<210> 7

<211> 32619

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca cttgataacc 60

ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc ggaatcgcag 120

accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct ccttcattac 180

agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa ttgcagtttc 240

atttgatgct cgatgagttt ttctaatcag aattggttaa ttggttgtaa cactggcaga 300

gcattacgct gacttgacgg gacggcggct ttgttgaata aatcgaactt ttgctgagtt 360

gaaggatcag atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt 420

caaaatcacc aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt 480

ctggctggat gatggggcga ttcaggcctg gtatgagtca gcaacacctt cttcacgagg 540

cagacctcag cgctcaaaga tgcaggggta aaagctaacc gcatctttac cgacaaggca 600

tccggcagtt caacagatcg ggaagggctg gatttgctga ggatgaaggt ggaggaaggt 660

gatgtcattc tggtgaagaa gctcgaccgt cttggccgcg acacgccgac atgatccaac 720

tgataaaaga gtttgatgct cagggtgtag cggttcggtt tattgacgac gggatcagta 780

ccgacggtga tatggggcaa atggtggtca ccatcctgtc ggctgtggca caggctgaac 840

gccggaggat cctagagcgc acgaatgagg gccgacagga agcaaagctg aaaggaatca 900

aatttggccg caggcgtacc gtggacagga gcgtcgattt ttgtgatgct cgtcaggggg 960

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 1020

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 1080

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 1140

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 1200

tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 1260

aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 1320

tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca 1380

tgattacgcc aagcttgcat gcctgcaggt cgatcgatta attaacgacc catcatcaat 1440

aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt ttgtgacgtg 1500

gcgcggggcg tgggaacggg gcgggtgacg taggttttag ggcggagtaa cttgtatgtg 1560

ttgggaattg tagttttctt aaaatgggaa gttacgtaac gtgggaaaac ggaagtgacg 1620

atttgaggaa gttgtgggtt ttttggcttt cgtttctggg cgtaggttcg cgtgcggttt 1680

tctgggtgtt ttttgtggac tttaaccgtt acgtcatttt ttagtcctat atatactcgc 1740

tctgcacttg gccctttttt acactgtgac tgattgagct ggtgccgtgt cgagtggtgt 1800

tattaccctg ttatccctag caattgaaaa ataaacacgt tgaaacataa cacaaacgat 1860

tctttattct tgggcaatgt atgaaaaagt gtaagaggat gtggcaaata tttcattaat 1920

gtagttgtgg ccagaccagt cccatgaaaa tgacatagag tatgcacttg gagttgtgtc 1980

tcctgtttcc tgtgtaccgt ttagtgtaat ggttagtgtt acaggtttag ttttgtctcc 2040

gtttaagtaa acttgactga caatgttact tttggcagtt ttaccgtgag attttggata 2100

agctgatagg ttaggcataa atccaacagc gtttgtatag gctgtgcctt cagtaagatc 2160

tccatttcta aagttccaat attctgggtc caggaaggaa ttgtttagta gcactccatt 2220

ttcgtcaaat cttataataa gatgagcact ttgaactgtt ccagatattg gagccaaact 2280

gcctttaaca gccaaaactg aaactgtagc aagtatttga ctgccacatt ttgttaagac 2340

caaagtgagt ttagcatctt tctctgcatt tagtctacag ttaggagatg gagctggtgt 2400

ggtccacaaa gttagcttat cattattttt gtttcctact gtaatggcac ctgtgctgtc 2460

aaaactaagg ccagttccta gtttaggaac catagccttg tttgaatcaa attctaggcc 2520

atggccaatt tttgttttga ggggatttgt gtttggtgca ttaggtgaac caaattcaag 2580

cccatctcct gcattaatgg ctatggctgt agcgtcaaac atcaacccct tggcagtgct 2640

taggttaacc tcaagctttt tggaattgtt tgaagctgta aacaagtaaa ggcctttgtt 2700

gtagttaata tccaagttgt gggctgagtt tataaaaaga gggccctgtc ctagtcttag 2760

atttagttgg ttttgagcat caaacggata actaacatca agtataaggc gtctgttttg 2820

agaatcaatc cttagtcctc ctgctacatt aagttgcata ttgccttgtg aatcaaaacc 2880

caaggctcca gtaactttag tttgcaagga agtattatta atagtcacac ctggaccagt 2940

tgctacggtc aaagtgttta ggtcgtctgt tacatgcaaa ggagccccgt actttagtcc 3000

tagttttcca ttttgtgtat aaatgggctc tttcaagtca atgcccaagc taccagtggc 3060

agtagttaga gggggtgagg cagtgatagt aagggtactg ctatcggtgg tggtgagggg 3120

gcctgatgtt tgcagggcta gctttccttc tgacactgtg aggggtcctt gggtggcaat 3180

gctaagtttg gagtcgtgca cggttagcgg ggcctgtgat tgcatggtga gtgtgttgcc 3240

cgcgaccatt agaggtgcgg cggcagccac agttagggct tctgaggtaa ctgtgagggg 3300

tgcagatatt tccaggttta tgtttgactt ggtttttttg agaggtgggc tcacagtggt 3360

tacattttgg gaggtaaggt tgccggcctc gtccagagag aggccgttgc ccattttgag 3420

cgcaagcatg ccattggagg taactagagg ttcggatagg cgcaaagaga gtaccccagg 3480

gggactctct tgaaacccat tgggggatac aaagggagga gtaagaaaag gcacagttgg 3540

aggaccggtt tccgtgtcat atggatacac ggggttgaag gtatcttcag acggtcttgc 3600

gcgcttcatc tgcaacaaca tgaagatagt gggtgcggat ggacaggaac aggaggaaac 3660

tgacattcca tttagattgt ggagaaagtt tgcagccagg aggaagctgc aataccagag 3720

ctgggaggag ggcaaggagg tgctgctgaa taaactggac agaaatttgc taactgattt 3780

taagtaagtg atgctttatt attttttttt attagttaaa gggaataaga tctttgagac 3840

cgcacagggt cttaataagg gtgcagagat cctcaggtcc ttgacaaggt gagtgaatgc 3900

agccttcggt ttctaccgag tgctgagtta tggtaatggg cttttctccc accatgacca 3960

ccaatttctg acgcttggtt ggcaacttgt agctaaggcg gtgtccggtg gtattactgt 4020

cgtaggtgac tttggcctgc tttaccagac aaaagatacc ccttttgcac tggtgcaagt 4080

taaccatgtc ttggagctct tgattcatgc gctgttgctc ggccgctgcc ctgcgtcttt 4140

ctagcaggcg ctgctctgta ataattccgt ccatttctag ctagagaaac ctgaattaga 4200

atagcccgta gagttgcttg aattgttcat aaaccccaca gtagctgcgc ctttggccta 4260

ataccctaag ggttttctaa gctcacctcc tgttctggta aacagagtta ttgaggtctg 4320

tccggaaaaa gtctggttta cggtcaggcg gtaggtgtgg tgcagcggcc ggtgacgcac 4380

tcgtacgttc ccggcaggta aggagggtgg tgttttttct gatggagtag ctgagctcgg 4440

agaggttctc tcgtagactc actccgtctg ggttgaaact gttgtaaatc acagagggag 4500

agatgttaaa agtaccaggt aaggttcgcc ttggtttgct tgggcgggtg aagacggtgg 4560

cgtttacagg atggcgatag gagccccagt atattttaat ttctgtattt attatactca 4620

gcacagagat ggcaacaaag atcttgatgt aatccagggt taggacagtt gcaaatcaca 4680

gtgagaacac agggtcccct gtcccgctca actagcaggg ggcgctgggt aaactcccga 4740

atcaggctac gggcaagctc tccctgggcg gtaagccgga cgccgtgcgc cgggccctcg 4800

atatgatcct cgggcaattc aaagtagcaa aactcaccgg agtcgcgggc aaagcacttg 4860

tggcggcgac agtggaccag gtgtttcagg cgcagttgct ctgcctctcc acttaacatt 4920

cagtcgtagc cgtccgccga gtcctttacc gcgtcaaagt taggaataaa ttgatccgga 4980

tagtggccgg gaggtcccga gaaggggtta aagtagaccg atggcacaaa ctcctcaata 5040

aattgcagag ttccaatgcc tccagagcgc ggctcagagg acgaggtctg cagagttagg 5100

attgcctgac gaggcgtgaa tgaagagcgg ccggcgccgc cgatctgaaa tgtcccgtcc 5160

ggacggagac caagcgagga gctcaccgac tcgtcgttga gctgaatacc tcgccctctg 5220

attgtcaggt gagttatacc ctgcccgggc gaccgcaccc tgtgacgaaa gccgcccgca 5280

agctgcgccc ctgagttagt catctgaact tcggcctggg cgtctctggg aagtaccaca 5340

gtggtgggag cgggactttc ctggtacacc agggcagcgg gccaactacg gggattaagg 5400

ttattacgag gtgtggtggt aatagccgcc tgttccagga gaattcggtt tcggtgggcg 5460

cgtattccgt tgacccggga tatcatgtgg ggtcccgcgc tcatgtagtt tattcgggtt 5520

gagtagtctt gggcagctcc agccgcaagt cccatttgtg gctggtaact ccacatgtag 5580

ggcgtgggaa tttccttgct cataatggcg ctgacaacag gtgctggcgc cgggtgtggc 5640

cgctggagat gacgtagttt tcgcgcttaa atttgagaaa gggcgcgaaa ctagtcctta 5700

agagtcagcg cgcagtattt actgaagaga gcctccgcgt cttccagcgt gcgccgaagc 5760

tgatcttcgc ttttgtgata caggcagctg cgggtgaggg atcgcagaga cctgtttttt 5820

attttcagct cttgttcttg gcccctgctc tgttgaaata tagcatacag agtgggaaaa 5880

atcctgtttc taagctcgcg ggtcgatacg ggttcgttgg gcgccagacg cagcgctcct 5940

cctcctgctg ctgccgccgc tgtggatttc ttgggctttg tcagagtctt gctatccggt 6000

cgcctttgct tctgtgtggc cgctgctgtt gctgccgctg ccgccggtgc agtatgggct 6060

gtagagatga cggtagtaat gcaggatgtt acgggggaag gccacgccgt gatggtagag 6120

aagaaagcgg cgggcgaagg agatgttgcc cccacagtct tgcaagcaag caactatggc 6180

gttcttgtgc ccgcgccatg agcggtagcc ttggcgctgt tgttgctctt gggctaacgg 6240

cggcggctgc ttggacttac cggccctggt tccagtggtg tcccatctac ggttgggtcg 6300

gcgaacgggc agtgccggcg gcgcctgagg agcggaggtt gtagccatgc tggaaccggt 6360

tgccgatttc tggggcgccg gcgaggggaa tgcgaccgag ggtgacggtg tttcgtctga 6420

cacctcttcg acctcggaag cttcctcgtc taggctctcc cagtcttcca tcatgtcctc 6480

ctcctcctcg tccaaaacct cctctgcctg actgtcccag tattcctcct cgtccgtggg 6540

tggcggcggc agctgcagct tctttttggg tgccatcctg ggaagcaagg gcccgcggct 6600

gctgctgata gggctgcggc ggcgggggga ttgggttgag ctcctcgccg gactgggggt 6660

ccaagtaaac cccccgtccc tttcgtagca gaaactcttg gcgggctttg ttgatggctt 6720

gcaattggcc aagaatgtgg ccctgggtaa tgacgcaggc ggtaagctcc gcattaggcg 6780

ggcgggattg gtcttcgtag aacctaatct cgtgggcgtg gtagtcctca ggtacaaatt 6840

tgcgaaggta agccgacgtc cacagccccg gagtgagttt caaccccgga gccgcggact 6900

tttcgtcagg cgagggaccc tgcagctcaa aggtaccgat aatttgactt tcgttaagca 6960

gctgcgaatt gcaaaccagg gagcggtgcg gggtgcatag gttgcagcga cagtgacact 7020

ccagtagacc gtcaccgctc acgtcttcca ttatgtcaga gtggtaggca aggtagttgg 7080

ctagctgcag aaggtagcag tggccccaaa gcggcggagg gcattcgcgg tacttaatgg 7140

gcacaaagtc gctaggaagt gcacagcagg tggcgggcaa gattcctgag cgctctagga 7200

taaagttcct aaagttctgc aacatgcttt gactggtgaa gtctggcaga ccctgttgca 7260

gggttttaag caggcgttcg gggaaaatga tgtccgccag gtgcgcggcc acggagcgct 7320

cgttgaaggc cgtccatagg tccttcaagt tttgctttag cagtttctgc agctccttga 7380

ggttgcactc ctccaagcac tgctgccaaa cgcccatggc cgtctgccag gtgtagcata 7440

gaaataagta aacgcagtcg cggacgtagt cgcggcgcgc ctcgcccttg agcgtggaat 7500

gaagcacgtt ttgcccaagg cggttttcgt gcaaaattcc aaggtaggag accaggttgc 7560

agagctccac gttggagatc ttgcaggcct ggcgtacgta gccctgtcga aaggtgtagt 7620

gcaatgtttc ctctagcttg cgctgcatct ccgggtcagc aaagaaccgc tgcatgcact 7680

caagctccac ggtaacgagc actgcggcca tcattagttt gcgtcgctcc tccaagtcgg 7740

caggctcgcg cgtttgaagc cagcgcgcta gctgctcgtc gccaactgcg ggtaggccct 7800

cctctgtttg ttcttgcaaa tttgcatccc tctccagggg ctgcgcacgg cgcacgatca 7860

gctcactcat gactgtgctc atgaccttgg ggggtaggtt aagtgccggg taggcaaagt 7920

gggtgacctc gatgctgcgt tttagtacgg ctaggcgcgc gttgtcaccc tcgagttcca 7980

ccaacactcc agagtgactt tcattttcgc tgttttcctg ttgcagagcg tttgccgcgc 8040

gcttctcgtc gcgtccaaga ccctcaaaga tttttggcac ttcgttgagc gaggcgatat 8100

caggtatgac agcgccctgc cgcaaggcca gctgcttgtc cgctcggctg cggttggcac 8160

ggcaggatag gggtatcttg cagttttgga aaaagatgtg ataggtggca agcacctctg 8220

gcacggcaaa tacggggtag aagttgaggc gcgggttggg ctcgcatgtg ccgttttctt 8280

ggcgtttggg gggtacgcgc ggtgagaata ggtggcgttc gtaggcaagg ctgacatccg 8340

ctatggcgag gggcacatcg ctgcgctctt gcaacgcgtc gcagataatg gcgcactggc 8400

gctgcagatg cttcaacagc acgtcgtctc ccacatctag gtagtcgcca tgcctttcgt 8460

ccccccgccc gacttgttcc tcgtttgcct ctgcgttgtc ctggtcttgc tttttatcct 8520

ctgttggtac tgagcggtcc tcgtcgtctt cgcttacaaa acctgggtcc tgctcgataa 8580

tcacttcctc ctcctcaagc gggggtgcct cgacggggaa ggtggtaggc gcgttggcgg 8640

catcggtgga ggcggtggtg gcgaactcag agggggcggt taggctgtcc ttcttctcga 8700

ctgactccat gatctttttc tgcctatagg agaaggaaac ttgtatgtgt tgggaattgt 8760

agttttctta aaatgggaag ttacgtaacg tgggaaaacg gaagtgacga tttgaggaag 8820

ttgtgggttt tttggctttc gtttctgggc gtaggttcgc gtgcggtttt ctgggtgttt 8880

tttgtggact ttaaccgtta cgtcattttt tagtcctata tatactcgct ctgcacttgg 8940

ccctttttta cactgtgact gattgagctg gtgccgtgtc gagtggtgtt tttttaatag 9000

gttttctttt ttactggtaa ggctgactgt tatgactacg tccggcgttc catttggcat 9060

gacactacga ccaacacgat ctcggttgtc tcggcgcact ccgtacagta gggatcgtct 9120

acctcctttt gagacagaaa cccgcgctac catactggag gatcatccgc tgctgcccga 9180

atgtaacact ttgacaatgc acaacgtgag ttacgtgcga ggtcttccct gcagtgtggg 9240

atttacgctg attcaggaat gggttgttcc ctgggatatg gttctaacgc gggaggagct 9300

tgtaatcctg aggaagtgta tgcacgtgtg cctgtgttgt gccaacattg atatcatgac 9360

gagcatgatg atccatggtt acgagtcctg ggctctccac tgtcattgtt ccagtcccgg 9420

ttccctgcag tgtatagccg gcgggcaggt tttggccagc tggtttagga tggtggtgga 9480

tggcgccatg tttaatcaga ggtttatatg gtaccgggag gtggtgaatt acaacatgcc 9540

aaaagaggta atgtttatgt ccagcgtgtt tatgaggggt cgccacttaa tctacctgcg 9600

cttgtggtat gatggccacg tgggttctgt ggtccccgcc atgagctttg gatacagcgc 9660

cttgcactgt gggattttga acaatattgt ggtgctgtgc tgcagttact gtgctgattt 9720

aagtgagatc agggtgcgct gctgtgcccg gaggacaagg cgccttatgc tgcgggcggt 9780

gcgaatcatc gctgaggaga ccactgccat gttgtattcc tgcaggacgg agcggcggcg 9840

gcagcagttt attcgcgcgc tgctgcagca ccaccgccct atcctgatgc acgattatga 9900

ctctaccccc atgtagacta gggttctgtg agtttgatta aggtacggtg atctgtataa 9960

gctatgtggt ggtggggcta tactactgaa tgaaaaatga cttgaaattt tctgcaattg 10020

aaaaataaac acgttgaaac ataacacaaa cgatacggcg cagacggcaa gggtgggggt 10080

aaataatcac ccgagagtgt acaaataaaa gcatttgcct ttattgaaag tgtctctagt 10140

acattatttt tacatgtttt tcaagtgaca aaaagaagtg gcgctcctaa tctgcgcact 10200

gtggctgcgg aagtagggcg agtggcgctc caggaagctg tagagctgtt cctggttgcg 10260

acgcagggtg ggctgtacct ggggactgtt gagcatggag ttgggtaccc cggtaataag 10320

gttcatggtg gggttgtgat ccatgggagt ttggggccag ttggcaaagg cgtggagaaa 10380

catgcagcag aatagtccac aggcggccga gttgggcccc tgtacgcttt gggtggactt 10440

ttccagcgtt atacagcggt cgggggaaga agcaatggcg ctacggcgca ggagtgactc 10500

gtactcaaac tggtaaacct gcttgagtcg ctggtcagaa aagccaaagg gctcaaagag 10560

gtagcatgtt tttgagtgcg ggttccaggc aaaggccatc cagtgtacgc ccccagtctc 10620

gcgaccggcc gtattgacta tggcgcaggc gagcttgtgt ggagaaacaa agcctggaaa 10680

gcgcttgtca taggtgccca aaaaatatgg cccacaacca agatctttga caatggcttt 10740

cagttcctgc tcactggagc ccatggcggc agctgttgtt gatgttgctt gcttctttat 10800

gttgtggcgt tgccggccga gaagggcgtg cgcaggtaca cggtttcgat gacgccgcgg 10860

tgcggctggt gcacacggac cacgtcaaag acttcaaaca aaacataaag aagggtgggc 10920

tcgtccatgg gatccacctc aaaagtcatg tctagcgcgt gggcggagtt ggcgtagaga 10980

aggttttggc ccaggtctgt gagtgcgccc atggacataa agttactgga gaatgggatg 11040

cgccaaaggg tgcgatcgca aagaaacttt ttctgggtaa tgctgtcaac tgcggtcttg 11100

cctataagcg gataggggaa gttagcaggg taggcctgtc cttcgcgcat ggtgggggca 11160

aggtagccaa caaatccaga gttgttgtgt tggtgtagga tgcccacctg ttggtagtcc 11220

ttgtatttag tatcatccac cacctgacgg ctcatgggct ggaagtttct aaagaaggag 11280

tacatgcggt ccttgtagct ctctgggata tagaagccct ggtagccaat gttatagtta 11340

gctagcattt gtaccaggaa ccagtctttg gtcatgttac actgggcaac gttgtaaccc 11400

tccccgtcaa ctgagcgctt aatttcaaac tcgttggggg taagcaggcg gtcattgcca 11460

ggccagctga cagaagagtc aaaggtaatg gccaccttct taaaggtgtg gttgaggtaa 11520

aaggttccat ctaggtaggg tatagagcca gagtaggtgt aataagggtc gtagcccgag 11580

cccagtgatg gggtttcctt agtcttaagg cgcgtgaagg cccagccgcg gaaagccgcc 11640

cagttgcggg aggggatgga tatgggcacg ttggtagcgt tggcgggtat agggtagagc 11700

atgttggcgg cggagagata gtcgttaaag gactggtcgt tggtgtcgtt tctaagcatg 11760

gcctcaagcg tggaggcggt gttgtgggcc atggggaaga aggtggcgta aaggcaaatg 11820

ctatcaaact taatgctggc tccgtcaacc cttaggtcat ttcctaggga gctctgcaga 11880

accatgttaa catccttcct gaagttccac tcgtaggtgt atgagcccgg caggagaagg 11940

aggtttttaa tggcaaagaa cttctgaggc acctggatgt ggaagggcac atagcgacca 12000

ttgcccagca acattgagcg gtagcgcagg ccagcattgc ggtggtggtt aaatgggttg 12060

acgttgtcca tatagtcaag ggaccagcgt gctccaaggt taatgtagca gtccactagc 12120

ccgggagcca ccactcgctt gttcatgtag tcgtaggtgt ttgggttatc agaaattttt 12180

acgttggaag gactgtactt tagcttgtcg ggcaaataca gcgctatgtt ggagtacagg 12240

aaatttctcc acaggttggc atttagattg atttccatgg caaaattatt tccaactctt 12300

atttcatttt tatctgaaaa ttctgtagca tctttttccc atccattttc ctgacctgtt 12360

ttaggtttta ccttggtaag agtctctgta ttaatcacac ctcccagtgg aaagcagtaa 12420

tttggaagtt catcttcagt tccatgattt tcaataattc taacatctgg atcatagctg 12480

tcaacagcct gattccacat agaaaagtac ctggttctat caccaatgga atcaagcaaa 12540

agctggtatg aaagctctgt gtttctgtct tgcaaatcta caacagcatt caactgcgat 12600

gcttggcccg ccagaacacc catattaccc gtgctgttgt aatacattag accaataaaa 12660

ttgtccctaa aagcaatgta attaggcctg ttgggcatag attgttggcc cattagttct 12720

cgtgagttac cttccttaat agtgggcatg taagaaatat gagtgtctgg ggtttctata 12780

tctacatctt cactgtacaa taccacttta ggagtcaagt tatcaccatt gcctgcggct 12840

gcctcagtag ttgagaaaaa ttgcatttcc acttgacttt ctagctttcc attttgttgc 12900

tttacaagaa tgccttgccc tccattttca tttgtgggtt ttgcatatga accgtaacat 12960

ggtttcattg gggtagtctt ttttaggact ctcccagctg catgattaat ttctgtttcg 13020

taccactgag attctcctat ttgaggttca ggttgaaatg ttttatcggc atatttaggt 13080

gtttgacctt cgacacctat ttgaataccc tcctttgtaa tatttatacc agaataaggc 13140

gcctgcccaa atacgtgagt tttttgctgc tcagcttgct cgtctacttc gtcttcgttg 13200

tcatcgtcct cttcttctag gtttatttca agagcagtag cagcttcatc ccattcgcaa 13260

ggatttgggg cacccttggg agccagggcg ttgtaggcag tgccagagta gggcttaaaa 13320

gtagggcccc tgtccagcac gccgcggatg tcaaagtacg tggaagccat gtccagcaca 13380

cggttatcac ccacagctag ggtgaaccgc gccttgtacg agtacgcagt atcctcacgg 13440

tccacaggga tgaaccgcag cgtcaaacgc tgggaccggt ctgtggtcac gtcgtgcgta 13500

ggcgccaccg tggggtttct aaacttgtta ttcaggctga agtacgtctc ggtggcgcgg 13560

gcaaactgca ccagcccggg gctcaggtac tccgaggcgt cctggcccga gatgtgcatg 13620

taagaccact gcggcatcat cgaaggggta gccatcttgg aaagcgggcg cgcggcggct 13680

cagcagctcc tctggcggcg acatggacgc atacatgaca cacatacgac acgttagcta 13740

tcagaagcat cgtcggcgct tcagggattg cacccccaga cccacgatgc tgttcagtgt 13800

gctttgccag ttgccactgg ctacgggccg caacgatcgc ggaccgctgg cggcgcggcg 13860

cagggacgcg cggctaggac gggttacaac aacggcggtc gggcctggca gcacaggttt 13920

ctgctgggtg tcggcggggg gaggcaggtc cagcgttacg ggtgtgtgct ggcccagcac 13980

tccggtagcc atgggcgcga tgggacgggt ggtgggcagg ccttgcttta gtgcctcctc 14040

gtacgaggga ggctcgtcta tttgcgtcac cagagtttct tccctgtcgg ggcgcggacg 14100

cttttcgcca cgcccctctg gagacactgt ctccacggcc ggtggaggct cctctacggg 14160

agggcgggga tcaagcttac tgttaatctt attttgcact gcctggttgg ccaggtccac 14220

caccccgcta atgccagagg ccaggccatc taccaccttt tgttggaaat tttgctcttt 14280

caacttatcc ctcagcatct ggcctgtgct gctgttccag gccttgctgc catagttctt 14340

aacggtggaa ccgaaatttt taatgccgct ccacagcgag ccccagctga aggcgccacc 14400

gctcatattg ctggtgccga tatcttgcca gtttcccatg aacgggcgcg agccgtgtcg 14460

cggggccaga gacgcaaagt tgatgtcttc cattctacaa aatagttaca ggaccaagcg 14520

agcgtgagag tccagacttt ttattttgat ttttccacat gcaacttgtt tttaatcagt 14580

gtctctgcgc ctgcaaggcc acggatgcaa ttccgggcac ggcgccaatc gccgcggcga 14640

tcagtggaat aaggaggggc aggataccgc cgcgcatgcg acggtgcgac gcgcgccgcc 14700

gccggtggtg cgcacgacgc atgccgcccg tcaggccgtg gccggccatg cccctcctac 14760

ggtgcattct tcctcggaat cccggcaccg ggaaacggag gcggcaggtg agggccatat 14820

ctgcaagaac cacaaagacc ggcttttaaa cgatgctggg gtggtagcgc gctgttggca 14880

gcaccagggt cctgcctcct tcgcgagcca ccctgcgcac ggaaatcggg gccagcacgg 14940

gctggcgacg gcgacggcgg cggcgggttc cagtggtggt tcggcgtcgg gtagttgctc 15000

gtcttctggg gcggtaggtg tagccacgat agccgggggt aggcgcaatg gaaggatgta 15060

gggcatattc gggcagtagc gcgctggcgg cgccgtactt cctcgaacgg cgcgggcgcc 15120

ggggggctga aacgcgaaac atccacgggt ccgtttgcac ctccgtagag gtcttggacg 15180

cggccgcagc gaccgcctgc accgcggcat ccgccaccgc tgaggcaacc ggggacgttt 15240

gtgtctccat gccctctgtg gcggtggcaa tactggtgct actggtagtg ggtatctgaa 15300

cgtccacggt ctgcacgccc agtcccggcg ccacctgctt gattggccgc acgcggacct 15360

cgggctccag cccaggttcc acggtcattt tttccaagac atcttccagt cgctggcgct 15420

tgggtaccat cagctgcacg gtgggtgcca agtcaccaga ctcgcgcttt aggccgcgct 15480

tttcttcgga cggtgcaagc gcgggcagca cctgctgcag tgttacgggc tttaggctag 15540

gtgttgggtt gccctcgtcc agcggcaacg ccagcatgtc cttatgccgc tttccgtagg 15600

caaactcccc gaggcgctcg ttggcctgct caagcaggtc ctcgtcgccg tacacctcat 15660

catacacgcg cttgtaggtg cgggtggagc gctcaccggg cgtaaagact acggtggtgc 15720

cgggtcgcaa aacacgtttt acgcgtcgac ctttccactg tacccgtcgc ctgggcgcgg 15780

tagcgtgcag cagttccacc tcgtcgtcaa gttcatcatc atcatctttc tttttctttt 15840

tgacccgctt tagctttcgg ggcttgtaat cctgctcttc cttcttcggg gggccataga 15900

tctccggcgc gatgacctgg agcatctctt ctttgatttt gcgcttggac atagcttcgt 15960

tgcgcgccgc cgccgctgga tacatacaac agtacgagtc taagtagttt tttcttgcaa 16020

tctagttgcg cggggggcgg gtgcgcacgg gcacgcgcag gccgctaacc gagtcgcgca 16080

cccaatacac gttgcccctg cgaccctgag tcatagcact aatggccgcg gctgctgcgg 16140

cggccgctcg tcgcctggac ctggggggca cagtgacaat acccgcggcc agccttcgag 16200

cggcccgcat ggccgcccgt cggccggtgc gacgtgcgcg gttaagcagg gccgccgccg 16260

cgcgttgggc ggcagtgccg ggtcggcggc ggtggcgacg tgctacgcgc ctccgccgtc 16320

tcttcatttt agcatagcgc cgggctccgc gcaccacggt ctgaatggcc gcgtccactg 16380

tggacactgg tggcggcgtg ggcgtgtagt tgcgcgcctc ctccaccacc gcgtcgatgg 16440

cgtcatcgac ggtggtgcgc ccagtgcggc cgcgtttgtg cgcgccccag ggcgcgcggt 16500

agtgcccgcg cacgcgcact gggtgttggt cggagcgctt cttggccccg ccaaacatct 16560

tgcttgggaa gcgcaggccc cagcctgtgt tattgctggg cgatataagg atggacatgc 16620

ttgctcaaaa agtgcggctc gataggacgc gcggcgagac tatgcccagg gccttgtaaa 16680

cgtaggggca ggtgcggcgt ctggcgtcag taatggtcac tcgctggact cctccgatgc 16740

tgttgcgcag cggtagcgtc ccgtgatctg tgagagcagg aacgttttca ctgacggtgg 16800

tgatggtggg ggctggcggg cgcgccaaaa tctggttctc gggaaagcga ttgaacacgt 16860

gggtcagaga ggtaaactgg cggatgagtt gggagtagac ggcctggtcg ttgtagaagc 16920

tcttggagtg cacgggcaac agctcggcgc ccaccaccgg aaagttgctg atctggcgcg 16980

tggagcggaa ggtcacgggg tcttgcatca tgtctggcaa cgaccagtag acctgctccg 17040

agccgcaggt tacgtcagga gtgcaaagca gggtccatga gcggattccg gtctgagggt 17100

cgccgtagtt gtatgcaagg taccagctgc ggtactgggt gaaggtgctg tcattgctta 17160

ttaggttgta actgcgtttc ttgctgtcct ctgtcagggg tttgatcacc ggtttcttct 17220

gaggcttctc gacctcgggt tgcgcagcgg gggcggcagc ttcggccgct gcttcggcct 17280

cagcgcgctt ctcctcagcc cgtgtggcaa aggtgtcgcc gcgaatggca tgatcgttca 17340

tgtcctccac cggctgcatt gccgcggctg ccgcgttgga gttctcttcc gcgccgctgc 17400

cactgctgtt gctgccgcct gcgccacccc cgccctgttc ggtgtcatct ttcaagctcg 17460

cctggtaggc gtccacatcc aacagtgcgg gaatgttacc accctccaga tcatcgtagg 17520

tgatcctaaa gccctcctgg aagggttgcc gcttgcggat gcccaacaag ttgctcaggc 17580

ggctgtgggt gaagtccacc ccgcatcctg gcagcaaaat gatgtctgga tggaaggctt 17640

cgtttgtata taccccaggc atgacaagac cagtgacggg gtcaaacccc agtctgaagt 17700

tgcgggtgtc aaactttacc ccgatgtcgc tttccagaac cccgttctgt ctgcccactt 17760

tcaagtagtg ctccacgatc gcgttgttca taaggtctat ggtcatggtc tcggagtagt 17820

tgccctcggg cagcgtgaac tccacccact cgtatttcag ctccacctga ttgtccttag 17880

taggcaagcg cgacaccatc acccgcgcct taaacttatt ggtaaacatg aactcgttca 17940

catttggcat gttggtatgc aggatggttt tcaggtcgcc gccccagtgc gaccggtcgt 18000

caagattgat ggtctgtgtg cttgcctccc ccgggctgta gtcattgttt tgaatgaccg 18060

tggtcagaaa gttgctgtgg tcgttctggt agttcaggga tgccacatcc gttgacttgt 18120

tgtccaccag gtacacacgg gtggtgtcga ataggggtgc caactcagag taacggatgc 18180

tgtttctccc cccggtaggc cgcaggtacc gcggaggcac aaacggcggg tccaggggag 18240

catcgaaggg agaacccagc gccgccgcca ctggcgccgc gctcaccaca ctctcgtagg 18300

agggaggagg accttcctca tacatcgccg cgcgccgcat actaagggga atacaagaaa 18360

accaacgctc ggtgccatgg ccttggtgag ttttttattt tgcatcatgc tttttttttt 18420

tttaaaacat tctccccagc ctggggcgaa ggtgcgcaaa cgggttgcca ctccctccca 18480

aatccaggac gctgctgtcg tctgccgagt catcgtcctc ccacaccaga ccccgctgac 18540

ggtcgtgcct ttgacgacgg gtgggcgggc gcgggcctgg cacgtccctg tgctcctgcg 18600

cgtacgtctt ccatctactc atcttgtcca ctaggctctc tatcccgttg ttgggaaatg 18660

ccggaggcag gtttttttcg cgctgcggct gcagcagcga gttgtttagg tactcctcct 18720

cgcccagcag gcgcgggcgg gtggtgcgag tgctggtaag agaccctatc aagcttggaa 18780

atgggctact agcatctgac cgcggggccg cagcgcctag atcggacaag ctgcttggcc 18840

tgcggaagct ttcctttcgc agcgccgcct ctgcctgctc gcgctgttgc aactctagca 18900

gggtctgcgg ttgcggggaa aacacgctgt cgtctatgtc gtcccagagg aatccatcgt 18960

taccctcggg cacctcgaat cccccggtgt agaaaccagg gggcggtagc cagtgcgggt 19020

tcaagatggc attggtgaaa tactcggggt tcacggcggc cgcgcgatgc aagtagtcca 19080

ttaggcggtt gataaacggc cggtttgagg catacatgcc cggttccatg ttgcgcgcgg 19140

tcatgtccag cgccacgctg ggcgttaccc cgtcgcgcat caggttaagg ctcacgctct 19200

gctgcacgta gcgcaaaatg cgctcctcct cgctgtttaa actgtgcaac gaggggatct 19260

tctgccgccg gttggtcagc aggtagttta gggttgcctc caggctgccc gtgtcctcct 19320

gccccagcgc gcggctgaca cttgtaatct cctggaaagt atgctcgtcc acatgcgcct 19380

gacctatggc ctcgcggtac agtgtcagca agtgacctag gtatgtgtcc cgggacacgc 19440

tgccactgtc cgtgaagggc gctattagca gcagcaacag gcgcgagttg ggcgtcagca 19500

agctagacac ggtcgcgcgg tcgcctgtgg gagcccgcac cccccacagc ccctgcaagt 19560

ttttgaaagc ctggctcagg tttacggtct gcaggccttg tctactggtc tggaaaaaat 19620

agtctggccc agactggtac acctcacttt gcggtgtctc agtcaccatt agccgcagtg 19680

cgctcacaaa gttggtgtag tcctcctgtc cccgcggcac gttggcgggc tgtgtactca 19740

ggaaggcgtt tagtgcaacc atggagccca ggttgccctg ctgctgcgcg cgctcacgct 19800

gcgccacggc ctcgcgcaca tcccccacca gccggtccag gttggtctgc acgttgccgc 19860

tgttgtaacg agccacgcgc tgaagcagcg cgtcgtagac caggccggcc tcgtcgggcc 19920

ggatggccct gttttcggcc agcgcgttta cgatcgccag caccttctcg tgcgtggggt 19980

ttgcgcgcgc cgggaccacc gcttccagaa ttgcggagag ccggttggcc tgcggctgct 20040

gccggaacgc gtcaggattg cgcgcagtca gcgacatgat gcggtccatg acctggcgcc 20100

agtcgtccgt ggagttaagg ccggacggct ggctctgcag cgccgcccgc accgccgggt 20160

ccgttgcgtc ttgcatcatc tgatcagaaa catcaccgct tagtactcgc cgtcctctgg 20220

ctcgtactca tcgtcctcgt catattcctc cacgccgccg acgttgccag cgcgcgcggg 20280

tgccaccgcc agcccaggtc cggccccagc tgcctccagg gcgcgtcggc ttggggccca 20340

gcgcaggtca gcgcccgcgt caaagtagga ctcggcctct ctatcgccgc tgcccgtgcc 20400

agccagggcc ctttgcaggc tgtgcatcag ctcgcggtcg ctgagctcgc gccgccggct 20460

cacgctcacg gccttgtgga tgcgctcgtt gcgataaacg cccaggtcgt cgctcaaggt 20520

aagcaccttc agcgccatgc gcatgtagaa cccctcgatc tttacctcct tgtctatggg 20580

aacgtaaggg gtatggtata tcttgcgggc gtaaaacttg cccaggctaa gcatggaata 20640

gttgatggcg gccaccttgt cagccaggct caagctgcgc tcctgcacca ctatgctctg 20700

caggatgttt atcaaatcga gcagccagcg gccctcgggc tctactatgt ttagcagcgc 20760

atccctgaat gcctcgttgt ccctgctgtg ctgcactata aggaacagct gcgccatgag 20820

cggcttgcta tttgggtttt gctccagcgc gcttacaaag tcccacagat gcatcagtcc 20880

tatagccacc tcctcgcgcg ccacaagcgt acgcacgtgg ttgttaaagc ttttttgaaa 20940

gttaatctcc tggttcaccg tctgctcgta tgcggttacc aggtcggcgg ccgccacgtg 21000

tgcgcgcgcg ggactaatcc cggttcgcgc gtcgggctca aagtcctcct cgcgcagcaa 21060

ccgctcgcga ttcaggccat gccgcagctc gcgccctgcg tggaactttc gatcccgcat 21120

ctcctcgggc tcctctccct cgcggtcgcg aaacaggttc tgccgcggca cgtacgcctc 21180

acgcgtatca cgcttcagct gcacccttgg gtgccgctca ggagagggcg ctcctagccg 21240

cgccaggccc tcgccctcct ccaagtccag gtagtgccgg gcccggcgcc gcgggggttc 21300

gtaatcacca tctgctgccg cgtcaaccgc ggatgtcgcc cctcctgacg cggtaggagg 21360

aggggagggt gccctgcatg tctgccgctg ctcttgctct tgccgctgct gaggaggggg 21420

gcgcatctgc cgcagcaccg gatgcatctg ggaaaagcaa aaaaggggct cgtccctgtt 21480

tccggaggaa tttgcaagcg gggtcttgca tgacggggag gcaaaccccc gttcgccgca 21540

gtccggccgg tccgagactc gaaccggggg tcccgcgact caacccttgg aaaataaccc 21600

tccggctaca gggagcgagc cacttaatgc tttcgctttc cagcctaacc gcttacgctg 21660

cgcgcggcca gtggccaaaa aagctagcgc agcagccgcc gcgcctggaa ggaagccaaa 21720

aggagcactc ccccgttgtc tgacgtcgca cacctgggtt cgacacgcgg gcggtaaccg 21780

catggatcac ggcggacggc cggatacggg gctcgaaccc cggtcgtccg ccatgatacc 21840

cttgcgaatt tatccaccag accacggaag agtgcccgct tacaggctct ccttttgcac 21900

gctagagcgt caacgattgc gcgcgcctga ccggccagag cgtcccgacc atggagcact 21960

ttttgccgct gcgcaacatc tggaaccgcg tccgcgactt tccgcgcgcc tccaccaccg 22020

ccgccggcat cacctggatg tccaggtaca tctacggata tcatcgcctt atgttggaag 22080

atctcgcccc cggagccccg gccaccctac gctggcccct ctaccgccag ccgccgccgc 22140

actttttggt gggataccag tacctggtgc ggacttgcaa cgactacgta tttgactcga 22200

gggcttactc gcgtctcagg tacaccgagc tctcgcagcc gggtcaccag accgttaact 22260

ggtccgttat ggccaactgc acttacacca tcaacacggg cgcataccac cgctttgtgg 22320

acatggatga cttccagtct accctcacgc aggtgcagca ggccatatta gccgagcgcg 22380

ttgtcgccga cctagccctg cttcagccga tgaggggctt cggggtcaca cgcatgggag 22440

gaagagggcg ccacctacgg ccaaactccg ccgccgccgc agcgatagat gcaagagatg 22500

caggacaaga ggaaggagaa gaagaagtgc cggtagaaag gctcatgcaa gactactaca 22560

aagacctgcg ccgatgtcaa aacgaagcct ggggcatggc cgaccgcctg cgcattcagc 22620

aggccggacc caaggacatg gtgcttctgt cgaccatccg ccgtctcaag accgcctact 22680

ttaattacat catcagcagc acctccgcca gaaacaaccc cgaccgccgc ccgctgccgc 22740

ccgccacggt gctcagccta ccttgcgact gtgactggtt agacgccttt ctcgagaggt 22800

tttccgatcc ggtcgatgcg gactcgctca ggtccctcgg cggcggagta cctacacaac 22860

aattgttgag atgcatcgtt agcgccgtat ccctgccgca tggcagcccc ccgccaaccc 22920

ataaccggga catgacgggc ggcgtcttcc aactgcgccc ccgcgagaac ggccgcgccg 22980

tcaccgagac catgcgccgt cgccgcgggg agatgatcga gcgctttgtc gaccgcctcc 23040

cggtgcgccg tcgtcgccgc cgtgtccccc ctcccccacc gccgccagaa gaagaagaag 23100

gggaggccct tatggaagag gagattgaag aagaagaaga ggcccctgta gcctttgagc 23160

gcgaggtgcg cgacactgtc gccgagctca tccgtcttct ggaggaggag ttaaccgtgt 23220

cggcgcgcaa ctcccagttt ttcaacttcg ccgtggactt ctacgaggcc atggagcgcc 23280

ttgaggcctt gggggatatc aacgaatcca cgttgcgacg ctgggttatg tacttcttcg 23340

tggcagaaca caccgccacc accctcaact acctctttca gcgcctgcga aactacgccg 23400

tcttcgcccg gcacgtggag ctcaatctcg cgcaggtggt catgcgcgcc cgcgatgccg 23460

aagggggcgt ggtctacagc cgcgtctgga acgagggagg cctcaacgcc ttctcgcagc 23520

tcatggcccg catttccaac gacctcgccg ccaccgtgga gcgagccgga cgcggagatc 23580

tccaggagga agagatcgag cagttcatgg ccgagatcgc ctatcaagac aactcaggag 23640

acgtgcagga gattttgcgc caggccgccg tcaacgacac cgaaattgat tctgtcgaac 23700

tctctttcag gttcaagctc accgggcccg tcgtcttcac gcagaggcgc cagattcagg 23760

agatcaaccg ccgcgtcgtc gcgttcgcca gcaacctacg cgcgcagcac cagctcctgc 23820

ccgcgcgcgg cgccgacgtg cccctgcccc ctctcccggc gggtccggag ccccccctac 23880

ctccgggggc tcgcccgcgt caccgctttt agatgcatca tccaaggaca cccccgcggc 23940

ccaccgcccg ccgcgcggta ccgtagtcgc gccgcgggga tgcggcctct tgcaagccat 24000

cgacgccgcc accaaccagc ccctggaaat taggtatcac ctggatctag cccgcgccct 24060

gacccgtcta tgcgaggtaa acctgcagga gctcccgcct gacctgacgc cgcgggagct 24120

ccagaccatg gacagctccc atctgcgcga tgttgtcatc aagctccgac cgccgcgcgc 24180

ggacatctgg actttgggct cgcgcggcgt ggtggtccga tccaccgtaa ctcccctcga 24240

gcagccagac ggtcaaggac aagcagccga agtagaagac caccagccaa acccgccagg 24300

cgaggggctc aaattcccac tctgcttcct tgtgcgcggt cgtcaggtca acctcgtgca 24360

ggatgtacag cccgtgcacc gctgccagta ctgcgcacgt ttttacaaaa gccagcacga 24420

gtgttcggcc cgtcgcaggg acttctactt tcaccacatc aatagccact cctccaattg 24480

gtggcgggag atccagttct tcccgatcgg ctcgcatcct cgcaccgagc gtctctttgt 24540

cacctacgat gtagagacct atacttggat gggggccttt gggaagcagc tcgtgccctt 24600

catgctggtc atgaagttcg gcggagatga gcctctagtg actgccgcgc gagacctagc 24660

cgcgaacctt ggatgggacc gctgggaaca agacccgctt accttctact gcatcacccc 24720

agaaaaaatg gccataggtc gccagtttag gacctttcgc gaccacctgc aaatgctaat 24780

ggcccgtgac ctgtggagct cattcgtcgc ttccaaccct catcttgcag actgggccct 24840

ttcagagcac gggctcagct cccctgaaga gctcacctac gaggaactta aaaaattgcc 24900

ttccatcaag ggcatcccgc gcttcttgga actttacatt gtgggccaca acatcaacgg 24960

ctttgacgag atcgtgctcg ccgcccaggt aattaacaac cgttccgagg tgccgggacc 25020

cttccgcatc acacgcaact ttatgcctcg cgcgggaaag atactcttca acgatgtcac 25080

cttcgccctg ccaaatccgc gttccaaaaa gcgcacggac tttttgctct gggagcaggg 25140

cggatgcgac gacactgact tcaaatacca gtacctcaaa gtcatggtca gggacacctt 25200

tgcgctcacc cacacctcgc tccggaaggc cgcgcaggca tacgcgctac ccgtagaaaa 25260

gggatgctgc gcctaccagg ccgtcaacca gttctacatg ctaggctctt accgttcgga 25320

ggccgacggg tttccgatcc aagagtactg gaaagaccgc gaagagtttg tcctcaaccg 25380

cgagctgtgg aaaaaaaagg gacaggataa gtatgacatc atcaaggaaa ccctggacta 25440

ctgcgcccta gacgtgcagg tcaccgccga gctggtcaac aagctgcgcg actcctacgc 25500

ctccttcgtg cgtgacgcgg taggtctcac agacgccagc ttcaacgtct tccagcgtcc 25560

aaccatatca tccaactcac atgccatctt caggcagata gtcttccgag cagagcagcc 25620

cgcccgtagc aacctcggtc ccgacctcct cgctccctcg cacgaactat acgattacgt 25680

gcgcgccagc atccgcggtg gaagatgcta ccctacatat cttggaatac tcagagagcc 25740

cctctacgtt tacgacattt gcggcatgta cgcctccgcg ctcacccacc ccatgccatg 25800

gggtccccca ctcaacccat acgagcgcgc gcttgccgcc cgcgcatggc agcaggcgct 25860

agacttgcaa ggatgcaaga tagactactt cgacgcgcgc ctgctgcccg gggtctttac 25920

cgtggacgca gaccccccgg acgagacgca gctagacccc ctaccgccat tctgctcgcg 25980

caagggcggc cgcctctgct ggaccaacga gcgcctacgc ggagaggtag ccaccagcgt 26040

tgaccttgtc accctgcaca accgcggttg gcgcgtgcac ctggtgcccg acgagcgcac 26100

caccgtcttt cccgaatggc ggtgcgttgc gcgcgaatac gtgcagctaa acatcgcggc 26160

caaggagcgc gccgatcgcg acaaaaacca aaccctgcgc tccatcgcca agttgctgtc 26220

caacgccctc tacgggtcgt ttgccaccaa gcttgacaac aaaaagattg tcttttctga 26280

ccagatggat gcggccaccc tcaaaggcat caccgcgggc caggtgaata tcaaatcctc 26340

ctcgtttttg gaaactgaca atcttagcgc agaagtcatg cccgcttttc agagggagta 26400

ctcaccccaa cagctggccc tcgcagacag cgatgcggaa gagagtgagg acgaacgcgc 26460

ccccaccccc ttttatagcc ccccttcagg aacacccggt cacgtggcct acacctacaa 26520

accaatcacc ttccttgatg ccgaagaggg cgacatgtgt cttcacaccc tggagcgagt 26580

ggacccccta gtggacaacg accgctaccc ctcccactta gcctccttcg tgctggcctg 26640

gacgcgagcc tttgtctcag agtggtccga gtttctatac gaggaggacc gcggaacacc 26700

gctcgaggac aggcctctca agtctgtata cggggacacg gacagccttt tcgtcaccga 26760

gcgtggacac cggctcatgg aaaccagagg taagaaacgc atcaaaaagc atgggggaaa 26820

cctggttttt gaccccgaac ggccagagct cacctggctc gtggaatgcg agaccgtctg 26880

cggggcctgc ggcgcggatg cctactcccc ggaatcggta tttctcgcgc ccaagctcta 26940

cgccctcaaa agtctgcact gcccctcgtg cggcgcctcc tccaagggca agctgcgcgc 27000

caagggccac gccgcggagg ggctggacta tgacaccatg gtcaaatgct acctggccga 27060

cgcgcagggc gaagaccggc agcgcttcag caccagcagg accagcctca agcgcaccct 27120

ggccagcgcg cagcccggag cgcacccctt caccgtgacc cagactacgc tgacgaggac 27180

cctgcgcccg tggaaagaca tgaccctggc ccgtctggac gagcaccgac tactgccgta 27240

cagcgaaagc cgccccaacc cgcgaaacga ggagatatgc tggatcgaga tgccgtagag 27300

caggtgaccg agctgtggga ccgcctggaa ctgcttggtc aaacgctcaa aagcatgcct 27360

acggcggacg gtctcaaacc gttgaaaaac tttgcttcct tgcaagaact gctatcgctg 27420

ggcggcgagc gccttctggc ggatttggtc agggaaaaca tgcgagtcag ggacatgctt 27480

aacgaagtgg cccccctgct cagggatgac ggcagctgca gctctcttaa ctaccagttg 27540

cagccggtaa taggtgtgat ttacgggccc accggctgcg gtaagtcgca gctgctcagg 27600

aacctgcttt cttcccagct gatctcccct accccggaaa ccgttttctt catcgccccg 27660

caggtagaca tgatcccccc atctgaactc aaagcgtggg aaatgcaaat ctgtgagggt 27720

aactacgccc ctgggccgga tggaaccatt ataccgcagt ctggcaccct ccgcccgcgc 27780

tttgtaaaaa tggcctatga cgatctcatc ctggaacaca actatgacgt tagtgatccc 27840

agaaatatct tcgcccaggc cgccgcccgt gggcccattg ccatcattat ggacgaatgc 27900

atggaaaatc ttggaggtca caagggcgtc tccaagttct tccacgcatt tccttctaag 27960

ctacatgaca aatttcccaa gtgcaccgga tacactgtgc tggtggttct gcacaacatg 28020

aatccccgga gggatatggc tgggaacata gccaacctaa aaatacagtc caagatgcat 28080

ctcatatccc cacgtatgca cccatcccag cttaaccgct ttgtaaacac ttacaccaag 28140

ggcctgcccc tggcaatcag cttgctactg aaagacattt ttaggcacca cgcccagcgc 28200

tcctgctacg actggatcat ctacaacacc accccgcagc atgaagctct gcagtggtgc 28260

tacctccacc ccagagacgg gcttatgccc atgtatctga acatccagag tcacctttac 28320

cacgtcctgg aaaaaataca caggaccctc aacgaccgag accgctggtc ccgggcctac 28380

cgcgcgcgca aaacccctaa ataaagacag caagacactt gcttgatcca aatccaaaca 28440

gagtctggtt ttttatttat gttttaaacc gcattgggag gggaggaagc cttcagggca 28500

gaaacctgct ggcgcagatc caacagctgc tgagaaacga cattaagttc ccgggtcaaa 28560

gaatttaaat tctactcgct ggcactcaag agtggcctct tgaggaactc accgggtata 28620

aatacactac acgtcagctg actataataa taaaacgcca actttgaccc ggaacgcgga 28680

aaacacctga gaaaaacacc tgggcgagtc tccacgtaaa cggtcaaagt ccccgcggcc 28740

ctagacaaat attacgcgct atgagtaaca caaaattatt cagatttcac ttcctcttat 28800

tcagttttcc cgcgaaaatg gccaaatctt actcggttac gcccaaattt actacaacat 28860

ccgcctaaaa ccgcgcgaaa attgtcactt cctgtgtaca ccggcgcaca ccaaaaacgt 28920

cacttttgcc acatccgtcg cttacatgtg ttccgccaca cttgcaacat cacacttccg 28980

ccacactact acgtcacccg ccccgttccc acgccccgcg ccacgtcaca aactccaccc 29040

cctcattatc atattggctt caatccaaaa taaggtatat tattgatgat gataagctat 29100

caaacatgag aattcggcgc gccattatca tttgcgggtc ctttccggcg atccgccttg 29160

ttacggggcg gcgacctcgc gggttttcgc tatttatgaa aattttccgg tttaaggcgt 29220

ttccgttctt cttcgtcata acttaatgtt tttatttaaa ataccctctg aaaagaaagg 29280

aaacgacagg tgctgaaagc gagctttttg gcctctgtcg tttcctttct ctgtttttgt 29340

ccgtggaatg aacaacgcgc ctcactgccc gctttccagt cgggaaacct gtcgtgccag 29400

ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgccagggt 29460

ggtttttctt ttcaccagtg agacgggcaa cagctgattg cccttcaccg cctggccctg 29520

agagagttgc agcaagcggt ccacgctggt ttgccccagc aggcgaaaat cctgtttgat 29580

ggtggttgac ggcgggatat aacatgagct gtcttcggta tcgtcgtatc ccactaccga 29640

gatatccgca ccaacgcgca gcccggactc ggtaatggcg cgcattgcgc ccagcgccat 29700

ctgatcgttg gcaaccagca tcgcagtggg aacgatgccc tcattcagca tttgcatggt 29760

ttgttgaaaa ccggacatgg cactccagtc gccttcccgt tccgctatcg gctgaatttg 29820

attgcgagtg agatatttat gccagccagc cagacgcaga cgcgccgaga cagaacttaa 29880

tgggcccgct aacagcgcga tttgctggtg acccaatgcg accagatgct ccacgcccag 29940

tcgcgtaccg tcttcatggg agaaaataat actgttgatg ggtgtctggt cagagacatc 30000

aagaaataac gccggaacat tagtgcaggc agcttccaca gcaatggcat cctggtcatc 30060

cagcggatag ttaatgatca gcccactgac gcgttgcgcg agaagattgt gcaccgccgc 30120

tttacaggct tcgacgccgc ttcgttctac catcgacacc accacgctgg cacccagttg 30180

atcggcgcga gatttaatcg ccgcgacaat ttgcgacggc gcgtgcaggg ccagactgga 30240

ggtggcaacg ccaatcagca acgactgttt gcccgccagt tgttgtgcca cgcggttggg 30300

aatgtaattc agctccgcca tcgccgcttc cactttttcc cgcgttttcg cagaaacgtg 30360

gctggcctgg ttcaccacgc gggaaacggt ctgataagag acaccggcat actctgcgac 30420

atcgtataac gttactggtt tcacattcac caccctgaat tgactctctt ccgggcgcta 30480

tcatgccata ccgcgaaagg ttttgcacca ttcacctgca caccgcgcct taattaagaa 30540

ttccgtgtat tctatagtgt cacctaaatc gtatgtgtat gatacataag gttatgtatt 30600

aattgtagcc gcgttctaac gacaatatgt acaagcctaa ttgtgtagca tctggcttac 30660

tgaagcagac cctatcatct ctctcgtaaa ctgccgtcag agtcggtttg gttggacgaa 30720

ccttctgagt ttctggtaac gccgttccgc accccggaaa tggtcagcga accaatcagc 30780

agggtcatcg ctagccagat cctctacgcc ggacgcatcg tggccaaaag gatctaggtg 30840

aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga 30900

gcgtcagacc ccttaataag atgatcttct tgagatcgtt ttggtctgcg cgtaatctct 30960

tgctctgaaa acgaaaaaac cgccttgcag ggcggttttt cgaaggttct ctgagctacc 31020

aactctttga accgaggtaa ctggcttgga ggagcgcagt caccaaaact tgtcctttca 31080

gtttagcctt aaccggcgca tgacttcaag actaactcct ctaaatcaat taccagtggc 31140

tgctgccagt ggtgcttttg catgtctttc cgggttggac tcaagacgat agttaccgga 31200

taaggcgcag cggtcggact gaacgggggg ttcgtgcata cagtccagct tggagcgaac 31260

tgcctacccg gaactgagtg tcaggcgtgg aatgagacaa acgcggccat aacagcggaa 31320

tgacaccggt aaaccgaaag gcaggaacag gagagcgcac gagggagccg ccagggggaa 31380

acgcctggta tctttatagt cctgtcgggt ttcgccacca ctgatttgag cgtcagattt 31440

cgtgatgctt gtcagggggg cggagcctat ggaaaaacgg ctttgccgcg gccctctcac 31500

ttccctgtta agtatcttcc tggcatcttc caggaaatct ccgccccgtt cgtaagccat 31560

ttccgctcgc cgcagtcgaa cgaccgagcg tagcgagtca gtgagcgagg aagcggaata 31620

tatcctgtat cacatattct gctgacgcac cggtgcagcc ttttttctcc tgccacatga 31680

agcacttcac tgacaccctc atcagtgcca acatagtaag ccagtataca ctccgctagc 31740

gctgaggtct gcctcgtgaa gaaggtgttg ctgactcata ccaggcctga atcgccccat 31800

catccagcca gaaagtgagg gagccacggt tgatgagagc tttgttgtag gtggaccagt 31860

tggtgatttt gaacttttgc tttgccacgg aacggtctgc gttgtcggga agatgcgtga 31920

tctgatcctt caactcagca aaagttcgat ttattcaaca aagccacgtt gtgtctcaaa 31980

atctctgatg ttacattgca caagataaaa atatatcatc atgaacaata aaactgtctg 32040

cttacataaa cagtaataca aggggtgtta tgagccatat tcaacgggaa acgtcttgct 32100

cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 32160

ataatgtcgg gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag 32220

agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 32280

gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc 32340

ctgatgatgc atggttactc accactgcga tccccgggaa aacagcattc caggtattag 32400

aagaatatcc tgattcaggt gaaaatattg ctgatgcgct ggcagtgttc ctgcgccggt 32460

tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 32520

aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 32580

atggctggcc tgttgaacaa gtctggaaag aaatgcata 32619

<210> 8

<211> 38461

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agcttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca cttgataacc 60

ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc ggaatcgcag 120

accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct ccttcattac 180

agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa ttgcagtttc 240

atttgatgct cgatgagttt ttctaatcag aattggttaa ttggttgtaa cactggcaga 300

gcattacgct gacttgacgg gacggcggct ttgttgaata aatcgaactt ttgctgagtt 360

gaaggatcag atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt 420

caaaatcacc aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt 480

ctggctggat gatggggcga ttcaggcctg gtatgagtca gcaacacctt cttcacgagg 540

cagacctcag cgctcaaaga tgcaggggta aaagctaacc gcatctttac cgacaaggca 600

tccggcagtt caacagatcg ggaagggctg gatttgctga ggatgaaggt ggaggaaggt 660

gatgtcattc tggtgaagaa gctcgaccgt cttggccgcg acacgccgac atgatccaac 720

tgataaaaga gtttgatgct cagggtgtag cggttcggtt tattgacgac gggatcagta 780

ccgacggtga tatggggcaa atggtggtca ccatcctgtc ggctgtggca caggctgaac 840

gccggaggat cctagagcgc acgaatgagg gccgacagga agcaaagctg aaaggaatca 900

aatttggccg caggcgtacc gtggacagga gcgtcgattt ttgtgatgct cgtcaggggg 960

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 1020

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 1080

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 1140

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 1200

tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 1260

aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 1320

tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca 1380

tgattacgcc aagcttgcat gcctgcaggt cgatcgatta attaacgacc catcatcaat 1440

aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt ttgtgacgtg 1500

gcgcggggcg tgggaacggg gcgggtgacg taggttttag ggcggagtaa cttgtatgtg 1560

ttgggaattg tagttttctt aaaatgggaa gttacgtaac gtgggaaaac ggaagtgacg 1620

atttgaggaa gttgtgggtt ttttggcttt cgtttctggg cgtaggttcg cgtgcggttt 1680

tctgggtgtt ttttgtggac tttaaccgtt acgtcatttt ttagtcctat atatactcgc 1740

tctgcacttg gccctttttt acactgtgac tgattgagct ggtgccgtgt cgagtggtgt 1800

tttttaaaag aaaagggggg attggggggt acagtgcagg ggaaagaata gtagacataa 1860

tagcaacaga catacaaact aaagaattac aaaaacaaat tacaaaattc aaaattttat 1920

cgtactagtg gatctgcgat cgctccggtg cccgtcagtg ggcagagcgc acatcgccca 1980

cagtccccga gaagttgggg ggaggggtcg gcaattgaac gggtgcctag agaaggtggc 2040

gcggggtaaa ctgggaaagt gatgtcgtgt actggctccg cctttttccc gagggtgggg 2100

gagaaccgta tataagtgca gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg 2160

ccagaacaca gctgaagctt cgaggggctc gcatctctcc ttcacgcgcc cgccgcccta 2220

cctgaggccg ccatccacgc cggttgagtc gcgttctgcc gcctcccgcc tgtggtgcct 2280

cctgaactgc gtccgccgtc taggtaagtt taaagctcag gtcgagaccg ggcctttgtc 2340

cggcgctccc ttggagccta cctagactca gccggctctc cacgctttgc ctgaccctgc 2400

ttgctcaact ctacgtcttt gtttcgtttt ctgttctgcg ccgttacaga tccaagctgt 2460

gaccggcgcc tacggatccg ccaccatgga gacacagaag ctgatctcca tggtgaagga 2520

ggccctggag aagtaccagt accctctgac cgccaagaat atcaaggtgg tgatccagaa 2580

ggagcacaac gtggtgctgc ctaccggctc catcaattcc atcctgtact ccaacagcga 2640

gctgttcgag aagatcgaca agaccaacac catctaccct cctctgtgga tcaggaagaa 2700

ctacccctac gatgtgcctg actacgccat ggagaacacc accagcggct tcctgggccc 2760

cctgctggtg ctgcaggccg gattcttcct gctgacccgc atcctgacca tcccccagag 2820

cctggacagc tggtggacct ccctgaactt tctgggcggg gcccccacct gccccggaca 2880

gaactctcag agccccacct ccaaccacag ccccaccagc tgccccccca tctgcccagg 2940

atatagatgg atgtgcctcc gccgcttcat catcttcctg ttcatcctgc tcctgtgcct 3000

catcttcctc ctcgtgctcc tggactacca gggcatgctc cccgtctgcc ccctcctgcc 3060

tggcacatcc accacctcca ccggcccctg caagacctgc accatccccg cccagggcac 3120

ctccatgttc ccctcctgct gctgcaccaa accctccgac ggcaactgca cctgcatccc 3180

catccccagc agctgggcct tcgccaggtt cctgtgggaa tgggccagcg tcaggttcag 3240

ctggctctcc ctcctcgtgc ccttcgtgca gtggtttgtg ggcctgagcc ccaccgtctg 3300

gctcagcgtg atctggatga tgtggtattg ggggccccgc ctgtacaaca tcctctcccc 3360

tttcctcccc ctgctgccca tcttcttctg cctctgggtg tacatcggaa gcggagctac 3420

taacttcagc ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatgggcgg 3480

aacaacagac tttgtgctga gcatcacaat cgtgctggtg atcctgatca tcatcgcctt 3540

catctggtac aattttaccg gctggtcccc ctttaagtac agcaagggca acaccgtgac 3600

atttaagacc cctgacgaga gcagcatcgc ctacatgaga tttaggaact gtgtgttcac 3660

attcaccgac cccaagggca gcctgcacag catcgacgtg acagaggtgc tgaacaacat 3720

ggccaagggc tttagggatg cccagaatcc ccctagctcc ttcacactgg gcggccactg 3780

ccaggccccc ctgaatgctt tttcctttgt gctgcctggc gtgaacgaca gagccacagt 3840

ggccaccgcc gacgaggcca agaagtggga gaactgcgac gccaccctga ccggcctgca 3900

gagaatcatc taactcgagt ctagagggcc cgtttaaacc cgctgatcag cctcgataat 3960

catctcttgt acatgtccca ctgttcaagc ctccaagctg tgccttgggt ggctttgggg 4020

catggacatt gacccttata aagaatttgg agctactgtg gagttactct cgtttttgcc 4080

ttctgacttc tttccttccg tcagagatct cctagacacc gcctcagctc tgtatcgaga 4140

agccttagag tctcctcttc tgaggcggaa agaaccagct ggggctctag caattgaaaa 4200

ataaacacgt tgaaacataa cacaaacgat tctttattct tgggcaatgt atgaaaaagt 4260

gtaagaggat gtggcaaata tttcattaat gtagttgtgg ccagaccagt cccatgaaaa 4320

tgacatagag tatgcacttg gagttgtgtc tcctgtttcc tgtgtaccgt ttagtgtaat 4380

ggttagtgtt acaggtttag ttttgtctcc gtttaagtaa acttgactga caatgttact 4440

tttggcagtt ttaccgtgag attttggata agctgatagg ttaggcataa atccaacagc 4500

gtttgtatag gctgtgcctt cagtaagatc tccatttcta aagttccaat attctgggtc 4560

caggaaggaa ttgtttagta gcactccatt ttcgtcaaat cttataataa gatgagcact 4620

ttgaactgtt ccagatattg gagccaaact gcctttaaca gccaaaactg aaactgtagc 4680

aagtatttga ctgccacatt ttgttaagac caaagtgagt ttagcatctt tctctgcatt 4740

tagtctacag ttaggagatg gagctggtgt ggtccacaaa gttagcttat cattattttt 4800

gtttcctact gtaatggcac ctgtgctgtc aaaactaagg ccagttccta gtttaggaac 4860

catagccttg tttgaatcaa attctaggcc atggccaatt tttgttttga ggggatttgt 4920

gtttggtgca ttaggtgaac caaattcaag cccatctcct gcattaatgg ctatggctgt 4980

agcgtcaaac atcaacccct tggcagtgct taggttaacc tcaagctttt tggaattgtt 5040

tgaagctgta aacaagtaaa ggcctttgtt gtagttaata tccaagttgt gggctgagtt 5100

tataaaaaga gggccctgtc ctagtcttag atttagttgg ttttgagcat caaacggata 5160

actaacatca agtataaggc gtctgttttg agaatcaatc cttagtcctc ctgctacatt 5220

aagttgcata ttgccttgtg aatcaaaacc caaggctcca gtaactttag tttgcaagga 5280

agtattatta atagtcacac ctggaccagt tgctacggtc aaagtgttta ggtcgtctgt 5340

tacatgcaaa ggagccccgt actttagtcc tagttttcca ttttgtgtat aaatgggctc 5400

tttcaagtca atgcccaagc taccagtggc agtagttaga gggggtgagg cagtgatagt 5460

aagggtactg ctatcggtgg tggtgagggg gcctgatgtt tgcagggcta gctttccttc 5520

tgacactgtg aggggtcctt gggtggcaat gctaagtttg gagtcgtgca cggttagcgg 5580

ggcctgtgat tgcatggtga gtgtgttgcc cgcgaccatt agaggtgcgg cggcagccac 5640

agttagggct tctgaggtaa ctgtgagggg tgcagatatt tccaggttta tgtttgactt 5700

ggtttttttg agaggtgggc tcacagtggt tacattttgg gaggtaaggt tgccggcctc 5760

gtccagagag aggccgttgc ccattttgag cgcaagcatg ccattggagg taactagagg 5820

ttcggatagg cgcaaagaga gtaccccagg gggactctct tgaaacccat tgggggatac 5880

aaagggagga gtaagaaaag gcacagttgg aggaccggtt tccgtgtcat atggatacac 5940

ggggttgaag gtatcttcag acggtcttgc gcgcttcatc tgcaacaaca tgaagatagt 6000

gggtgcggat ggacaggaac aggaggaaac tgacattcca tttagattgt ggagaaagtt 6060

tgcagccagg aggaagctgc aataccagag ctgggaggag ggcaaggagg tgctgctgaa 6120

taaactggac agaaatttgc taactgattt taagtaagtg atgctttatt attttttttt 6180

attagttaaa gggaataaga tctttgagac cgcacagggt cttaataagg gtgcagagat 6240

cctcaggtcc ttgacaaggt gagtgaatgc agccttcggt ttctaccgag tgctgagtta 6300

tggtaatggg cttttctccc accatgacca ccaatttctg acgcttggtt ggcaacttgt 6360

agctaaggcg gtgtccggtg gtattactgt cgtaggtgac tttggcctgc tttaccagac 6420

aaaagatacc ccttttgcac tggtgcaagt taaccatgtc ttggagctct tgattcatgc 6480

gctgttgctc ggccgctgcc ctgcgtcttt ctagcaggcg ctgctctgta ataattccgt 6540

ccatttctag ctagagaaac ctgaattaga atagcccgta gagttgcttg aattgttcat 6600

aaaccccaca gtagctgcgc ctttggccta ataccctaag ggttttctaa gctcacctcc 6660

tgttctggta aacagagtta ttgaggtctg tccggaaaaa gtctggttta cggtcaggcg 6720

gtaggtgtgg tgcagcggcc ggtgacgcac tcgtacgttc ccggcaggta aggagggtgg 6780

tgttttttct gatggagtag ctgagctcgg agaggttctc tcgtagactc actccgtctg 6840

ggttgaaact gttgtaaatc acagagggag agatgttaaa agtaccaggt aaggttcgcc 6900

ttggtttgct tgggcgggtg aagacggtgg cgtttacagg atggcgatag gagccccagt 6960

atattttaat ttctgtattt attatactca gcacagagat ggcaacaaag atcttgatgt 7020

aatccagggt taggacagtt gcaaatcaca gtgagaacac agggtcccct gtcccgctca 7080

actagcaggg ggcgctgggt aaactcccga atcaggctac gggcaagctc tccctgggcg 7140

gtaagccgga cgccgtgcgc cgggccctcg atatgatcct cgggcaattc aaagtagcaa 7200

aactcaccgg agtcgcgggc aaagcacttg tggcggcgac agtggaccag gtgtttcagg 7260

cgcagttgct ctgcctctcc acttaacatt cagtcgtagc cgtccgccga gtcctttacc 7320

gcgtcaaagt taggaataaa ttgatccgga tagtggccgg gaggtcccga gaaggggtta 7380

aagtagaccg atggcacaaa ctcctcaata aattgcagag ttccaatgcc tccagagcgc 7440

ggctcagagg acgaggtctg cagagttagg attgcctgac gaggcgtgaa tgaagagcgg 7500

ccggcgccgc cgatctgaaa tgtcccgtcc ggacggagac caagcgagga gctcaccgac 7560

tcgtcgttga gctgaatacc tcgccctctg attgtcaggt gagttatacc ctgcccgggc 7620

gaccgcaccc tgtgacgaaa gccgcccgca agctgcgccc ctgagttagt catctgaact 7680

tcggcctggg cgtctctggg aagtaccaca gtggtgggag cgggactttc ctggtacacc 7740

agggcagcgg gccaactacg gggattaagg ttattacgag gtgtggtggt aatagccgcc 7800

tgttccagga gaattcggtt tcggtgggcg cgtattccgt tgacccggga tatcatgtgg 7860

ggtcccgcgc tcatgtagtt tattcgggtt gagtagtctt gggcagctcc agccgcaagt 7920

cccatttgtg gctggtaact ccacatgtag ggcgtgggaa tttccttgct cataatggcg 7980

ctgacaacag gtgctggcgc cgggtgtggc cgctggagat gacgtagttt tcgcgcttaa 8040

atttgagaaa gggcgcgaaa ctagtcctta agagtcagcg cgcagtattt actgaagaga 8100

gcctccgcgt cttccagcgt gcgccgaagc tgatcttcgc ttttgtgata caggcagctg 8160

cgggtgaggg atcgcagaga cctgtttttt attttcagct cttgttcttg gcccctgctc 8220

tgttgaaata tagcatacag agtgggaaaa atcctgtttc taagctcgcg ggtcgatacg 8280

ggttcgttgg gcgccagacg cagcgctcct cctcctgctg ctgccgccgc tgtggatttc 8340

ttgggctttg tcagagtctt gctatccggt cgcctttgct tctgtgtggc cgctgctgtt 8400

gctgccgctg ccgccggtgc agtatgggct gtagagatga cggtagtaat gcaggatgtt 8460

acgggggaag gccacgccgt gatggtagag aagaaagcgg cgggcgaagg agatgttgcc 8520

cccacagtct tgcaagcaag caactatggc gttcttgtgc ccgcgccatg agcggtagcc 8580

ttggcgctgt tgttgctctt gggctaacgg cggcggctgc ttggacttac cggccctggt 8640

tccagtggtg tcccatctac ggttgggtcg gcgaacgggc agtgccggcg gcgcctgagg 8700

agcggaggtt gtagccatgc tggaaccggt tgccgatttc tggggcgccg gcgaggggaa 8760

tgcgaccgag ggtgacggtg tttcgtctga cacctcttcg acctcggaag cttcctcgtc 8820

taggctctcc cagtcttcca tcatgtcctc ctcctcctcg tccaaaacct cctctgcctg 8880

actgtcccag tattcctcct cgtccgtggg tggcggcggc agctgcagct tctttttggg 8940

tgccatcctg ggaagcaagg gcccgcggct gctgctgata gggctgcggc ggcgggggga 9000

ttgggttgag ctcctcgccg gactgggggt ccaagtaaac cccccgtccc tttcgtagca 9060

gaaactcttg gcgggctttg ttgatggctt gcaattggcc aagaatgtgg ccctgggtaa 9120

tgacgcaggc ggtaagctcc gcattaggcg ggcgggattg gtcttcgtag aacctaatct 9180

cgtgggcgtg gtagtcctca ggtacaaatt tgcgaaggta agccgacgtc cacagccccg 9240

gagtgagttt caaccccgga gccgcggact tttcgtcagg cgagggaccc tgcagctcaa 9300

aggtaccgat aatttgactt tcgttaagca gctgcgaatt gcaaaccagg gagcggtgcg 9360

gggtgcatag gttgcagcga cagtgacact ccagtagacc gtcaccgctc acgtcttcca 9420

ttatgtcaga gtggtaggca aggtagttgg ctagctgcag aaggtagcag tggccccaaa 9480

gcggcggagg gcattcgcgg tacttaatgg gcacaaagtc gctaggaagt gcacagcagg 9540

tggcgggcaa gattcctgag cgctctagga taaagttcct aaagttctgc aacatgcttt 9600

gactggtgaa gtctggcaga ccctgttgca gggttttaag caggcgttcg gggaaaatga 9660

tgtccgccag gtgcgcggcc acggagcgct cgttgaaggc cgtccatagg tccttcaagt 9720

tttgctttag cagtttctgc agctccttga ggttgcactc ctccaagcac tgctgccaaa 9780

cgcccatggc cgtctgccag gtgtagcata gaaataagta aacgcagtcg cggacgtagt 9840

cgcggcgcgc ctcgcccttg agcgtggaat gaagcacgtt ttgcccaagg cggttttcgt 9900

gcaaaattcc aaggtaggag accaggttgc agagctccac gttggagatc ttgcaggcct 9960

ggcgtacgta gccctgtcga aaggtgtagt gcaatgtttc ctctagcttg cgctgcatct 10020

ccgggtcagc aaagaaccgc tgcatgcact caagctccac ggtaacgagc actgcggcca 10080

tcattagttt gcgtcgctcc tccaagtcgg caggctcgcg cgtttgaagc cagcgcgcta 10140

gctgctcgtc gccaactgcg ggtaggccct cctctgtttg ttcttgcaaa tttgcatccc 10200

tctccagggg ctgcgcacgg cgcacgatca gctcactcat gactgtgctc atgaccttgg 10260

ggggtaggtt aagtgccggg taggcaaagt gggtgacctc gatgctgcgt tttagtacgg 10320

ctaggcgcgc gttgtcaccc tcgagttcca ccaacactcc agagtgactt tcattttcgc 10380

tgttttcctg ttgcagagcg tttgccgcgc gcttctcgtc gcgtccaaga ccctcaaaga 10440

tttttggcac ttcgttgagc gaggcgatat caggtatgac agcgccctgc cgcaaggcca 10500

gctgcttgtc cgctcggctg cggttggcac ggcaggatag gggtatcttg cagttttgga 10560

aaaagatgtg ataggtggca agcacctctg gcacggcaaa tacggggtag aagttgaggc 10620

gcgggttggg ctcgcatgtg ccgttttctt ggcgtttggg gggtacgcgc ggtgagaata 10680

ggtggcgttc gtaggcaagg ctgacatccg ctatggcgag gggcacatcg ctgcgctctt 10740

gcaacgcgtc gcagataatg gcgcactggc gctgcagatg cttcaacagc acgtcgtctc 10800

ccacatctag gtagtcgcca tgcctttcgt ccccccgccc gacttgttcc tcgtttgcct 10860

ctgcgttgtc ctggtcttgc tttttatcct ctgttggtac tgagcggtcc tcgtcgtctt 10920

cgcttacaaa acctgggtcc tgctcgataa tcacttcctc ctcctcaagc gggggtgcct 10980

cgacggggaa ggtggtaggc gcgttggcgg catcggtgga ggcggtggtg gcgaactcag 11040

agggggcggt taggctgtcc ttcttctcga ctgactccat gatctttttc tgcctatagg 11100

agaaggaaac ttgtatgtgt tgggaattgt agttttctta aaatgggaag ttacgtaacg 11160

tgggaaaacg gaagtgacga tttgaggaag ttgtgggttt tttggctttc gtttctgggc 11220

gtaggttcgc gtgcggtttt ctgggtgttt tttgtggact ttaaccgtta cgtcattttt 11280

tagtcctata tatactcgct ctgcacttgg ccctttttta cactgtgact gattgagctg 11340

gtgccgtgtc gagtggtgtt tttttaatag gttttctttt ttactggtaa ggctgactgt 11400

tatgactacg tccggcgttc catttggcat gacactacga ccaacacgat ctcggttgtc 11460

tcggcgcact ccgtacagta gggatcgtct acctcctttt gagacagaaa cccgcgctac 11520

catactggag gatcatccgc tgctgcccga atgtaacact ttgacaatgc acaacgtgag 11580

ttacgtgcga ggtcttccct gcagtgtggg atttacgctg attcaggaat gggttgttcc 11640

ctgggatatg gttctaacgc gggaggagct tgtaatcctg aggaagtgta tgcacgtgtg 11700

cctgtgttgt gccaacattg atatcatgac gagcatgatg atccatggtt acgagtcctg 11760

ggctctccac tgtcattgtt ccagtcccgg ttccctgcag tgtatagccg gcgggcaggt 11820

tttggccagc tggtttagga tggtggtgga tggcgccatg tttaatcaga ggtttatatg 11880

gtaccgggag gtggtgaatt acaacatgcc aaaagaggta atgtttatgt ccagcgtgtt 11940

tatgaggggt cgccacttaa tctacctgcg cttgtggtat gatggccacg tgggttctgt 12000

ggtccccgcc atgagctttg gatacagcgc cttgcactgt gggattttga acaatattgt 12060

ggtgctgtgc tgcagttact gtgctgattt aagtgagatc agggtgcgct gctgtgcccg 12120

gaggacaagg cgccttatgc tgcgggcggt gcgaatcatc gctgaggaga ccactgccat 12180

gttgtattcc tgcaggacgg agcggcggcg gcagcagttt attcgcgcgc tgctgcagca 12240

ccaccgccct atcctgatgc acgattatga ctctaccccc atgtagacta gggttctgtg 12300

agtttgatta aggtacggtg atctgtataa gctatgtggt ggtggggcta tactactgaa 12360

tgaaaaatga cttgaaattt tctgcaattg aaaaataaac acgttgaaac ataacacaaa 12420

cgatacggcg cagacggcaa gggtgggggt aaataatcac ccgagagtgt acaaataaaa 12480

gcatttgcct ttattgaaag tgtctctagt acattatttt tacatgtttt tcaagtgaca 12540

aaaagaagtg gcgctcctaa tctgcgcact gtggctgcgg aagtagggcg agtggcgctc 12600

caggaagctg tagagctgtt cctggttgcg acgcagggtg ggctgtacct ggggactgtt 12660

gagcatggag ttgggtaccc cggtaataag gttcatggtg gggttgtgat ccatgggagt 12720

ttggggccag ttggcaaagg cgtggagaaa catgcagcag aatagtccac aggcggccga 12780

gttgggcccc tgtacgcttt gggtggactt ttccagcgtt atacagcggt cgggggaaga 12840

agcaatggcg ctacggcgca ggagtgactc gtactcaaac tggtaaacct gcttgagtcg 12900

ctggtcagaa aagccaaagg gctcaaagag gtagcatgtt tttgagtgcg ggttccaggc 12960

aaaggccatc cagtgtacgc ccccagtctc gcgaccggcc gtattgacta tggcgcaggc 13020

gagcttgtgt ggagaaacaa agcctggaaa gcgcttgtca taggtgccca aaaaatatgg 13080

cccacaacca agatctttga caatggcttt cagttcctgc tcactggagc ccatggcggc 13140

agctgttgtt gatgttgctt gcttctttat gttgtggcgt tgccggccga gaagggcgtg 13200

cgcaggtaca cggtttcgat gacgccgcgg tgcggctggt gcacacggac cacgtcaaag 13260

acttcaaaca aaacataaag aagggtgggc tcgtccatgg gatccacctc aaaagtcatg 13320

tctagcgcgt gggcggagtt ggcgtagaga aggttttggc ccaggtctgt gagtgcgccc 13380

atggacataa agttactgga gaatgggatg cgccaaaggg tgcgatcgca aagaaacttt 13440

ttctgggtaa tgctgtcaac tgcggtcttg cctataagcg gataggggaa gttagcaggg 13500

taggcctgtc cttcgcgcat ggtgggggca aggtagccaa caaatccaga gttgttgtgt 13560

tggtgtagga tgcccacctg ttggtagtcc ttgtatttag tatcatccac cacctgacgg 13620

ctcatgggct ggaagtttct aaagaaggag tacatgcggt ccttgtagct ctctgggata 13680

tagaagccct ggtagccaat gttatagtta gctagcattt gtaccaggaa ccagtctttg 13740

gtcatgttac actgggcaac gttgtaaccc tccccgtcaa ctgagcgctt aatttcaaac 13800

tcgttggggg taagcaggcg gtcattgcca ggccagctga cagaagagtc aaaggtaatg 13860

gccaccttct taaaggtgtg gttgaggtaa aaggttccat ctaggtaggg tatagagcca 13920

gagtaggtgt aataagggtc gtagcccgag cccagtgatg gggtttcctt agtcttaagg 13980

cgcgtgaagg cccagccgcg gaaagccgcc cagttgcggg aggggatgga tatgggcacg 14040

ttggtagcgt tggcgggtat agggtagagc atgttggcgg cggagagata gtcgttaaag 14100

gactggtcgt tggtgtcgtt tctaagcatg gcctcaagcg tggaggcggt gttgtgggcc 14160

atggggaaga aggtggcgta aaggcaaatg ctatcaaact taatgctggc tccgtcaacc 14220

cttaggtcat ttcctaggga gctctgcaga accatgttaa catccttcct gaagttccac 14280

tcgtaggtgt atgagcccgg caggagaagg aggtttttaa tggcaaagaa cttctgaggc 14340

acctggatgt ggaagggcac atagcgacca ttgcccagca acattgagcg gtagcgcagg 14400

ccagcattgc ggtggtggtt aaatgggttg acgttgtcca tatagtcaag ggaccagcgt 14460

gctccaaggt taatgtagca gtccactagc ccgggagcca ccactcgctt gttcatgtag 14520

tcgtaggtgt ttgggttatc agaaattttt acgttggaag gactgtactt tagcttgtcg 14580

ggcaaataca gcgctatgtt ggagtacagg aaatttctcc acaggttggc atttagattg 14640

atttccatgg caaaattatt tccaactctt atttcatttt tatctgaaaa ttctgtagca 14700

tctttttccc atccattttc ctgacctgtt ttaggtttta ccttggtaag agtctctgta 14760

ttaatcacac ctcccagtgg aaagcagtaa tttggaagtt catcttcagt tccatgattt 14820

tcaataattc taacatctgg atcatagctg tcaacagcct gattccacat agaaaagtac 14880

ctggttctat caccaatgga atcaagcaaa agctggtatg aaagctctgt gtttctgtct 14940

tgcaaatcta caacagcatt caactgcgat gcttggcccg ccagaacacc catattaccc 15000

gtgctgttgt aatacattag accaataaaa ttgtccctaa aagcaatgta attaggcctg 15060

ttgggcatag attgttggcc cattagttct cgtgagttac cttccttaat agtgggcatg 15120

taagaaatat gagtgtctgg ggtttctata tctacatctt cactgtacaa taccacttta 15180

ggagtcaagt tatcaccatt gcctgcggct gcctcagtag ttgagaaaaa ttgcatttcc 15240

acttgacttt ctagctttcc attttgttgc tttacaagaa tgccttgccc tccattttca 15300

tttgtgggtt ttgcatatga accgtaacat ggtttcattg gggtagtctt ttttaggact 15360

ctcccagctg catgattaat ttctgtttcg taccactgag attctcctat ttgaggttca 15420

ggttgaaatg ttttatcggc atatttaggt gtttgacctt cgacacctat ttgaataccc 15480

tcctttgtaa tatttatacc agaataaggc gcctgcccaa atacgtgagt tttttgctgc 15540

tcagcttgct cgtctacttc gtcttcgttg tcatcgtcct cttcttctag gtttatttca 15600

agagcagtag cagcttcatc ccattcgcaa ggatttgggg cacccttggg agccagggcg 15660

ttgtaggcag tgccagagta gggcttaaaa gtagggcccc tgtccagcac gccgcggatg 15720

tcaaagtacg tggaagccat gtccagcaca cggttatcac ccacagctag ggtgaaccgc 15780

gccttgtacg agtacgcagt atcctcacgg tccacaggga tgaaccgcag cgtcaaacgc 15840

tgggaccggt ctgtggtcac gtcgtgcgta ggcgccaccg tggggtttct aaacttgtta 15900

ttcaggctga agtacgtctc ggtggcgcgg gcaaactgca ccagcccggg gctcaggtac 15960

tccgaggcgt cctggcccga gatgtgcatg taagaccact gcggcatcat cgaaggggta 16020

gccatcttgg aaagcgggcg cgcggcggct cagcagctcc tctggcggcg acatggacgc 16080

atacatgaca cacatacgac acgttagcta tcagaagcat cgtcggcgct tcagggattg 16140

cacccccaga cccacgatgc tgttcagtgt gctttgccag ttgccactgg ctacgggccg 16200

caacgatcgc ggaccgctgg cggcgcggcg cagggacgcg cggctaggac gggttacaac 16260

aacggcggtc gggcctggca gcacaggttt ctgctgggtg tcggcggggg gaggcaggtc 16320

cagcgttacg ggtgtgtgct ggcccagcac tccggtagcc atgggcgcga tgggacgggt 16380

ggtgggcagg ccttgcttta gtgcctcctc gtacgaggga ggctcgtcta tttgcgtcac 16440

cagagtttct tccctgtcgg ggcgcggacg cttttcgcca cgcccctctg gagacactgt 16500

ctccacggcc ggtggaggct cctctacggg agggcgggga tcaagcttac tgttaatctt 16560

attttgcact gcctggttgg ccaggtccac caccccgcta atgccagagg ccaggccatc 16620

taccaccttt tgttggaaat tttgctcttt caacttatcc ctcagcatct ggcctgtgct 16680

gctgttccag gccttgctgc catagttctt aacggtggaa ccgaaatttt taatgccgct 16740

ccacagcgag ccccagctga aggcgccacc gctcatattg ctggtgccga tatcttgcca 16800

gtttcccatg aacgggcgcg agccgtgtcg cggggccaga gacgcaaagt tgatgtcttc 16860

cattctacaa aatagttaca ggaccaagcg agcgtgagag tccagacttt ttattttgat 16920

ttttccacat gcaacttgtt tttaatcagt gtctctgcgc ctgcaaggcc acggatgcaa 16980

ttccgggcac ggcgccaatc gccgcggcga tcagtggaat aaggaggggc aggataccgc 17040

cgcgcatgcg acggtgcgac gcgcgccgcc gccggtggtg cgcacgacgc atgccgcccg 17100

tcaggccgtg gccggccatg cccctcctac ggtgcattct tcctcggaat cccggcaccg 17160

ggaaacggag gcggcaggtg agggccatat ctgcaagaac cacaaagacc ggcttttaaa 17220

cgatgctggg gtggtagcgc gctgttggca gcaccagggt cctgcctcct tcgcgagcca 17280

ccctgcgcac ggaaatcggg gccagcacgg gctggcgacg gcgacggcgg cggcgggttc 17340

cagtggtggt tcggcgtcgg gtagttgctc gtcttctggg gcggtaggtg tagccacgat 17400

agccgggggt aggcgcaatg gaaggatgta gggcatattc gggcagtagc gcgctggcgg 17460

cgccgtactt cctcgaacgg cgcgggcgcc ggggggctga aacgcgaaac atccacgggt 17520

ccgtttgcac ctccgtagag gtcttggacg cggccgcagc gaccgcctgc accgcggcat 17580

ccgccaccgc tgaggcaacc ggggacgttt gtgtctccat gccctctgtg gcggtggcaa 17640

tactggtgct actggtagtg ggtatctgaa cgtccacggt ctgcacgccc agtcccggcg 17700

ccacctgctt gattggccgc acgcggacct cgggctccag cccaggttcc acggtcattt 17760

tttccaagac atcttccagt cgctggcgct tgggtaccat cagctgcacg gtgggtgcca 17820

agtcaccaga ctcgcgcttt aggccgcgct tttcttcgga cggtgcaagc gcgggcagca 17880

cctgctgcag tgttacgggc tttaggctag gtgttgggtt gccctcgtcc agcggcaacg 17940

ccagcatgtc cttatgccgc tttccgtagg caaactcccc gaggcgctcg ttggcctgct 18000

caagcaggtc ctcgtcgccg tacacctcat catacacgcg cttgtaggtg cgggtggagc 18060

gctcaccggg cgtaaagact acggtggtgc cgggtcgcaa aacacgtttt acgcgtcgac 18120

ctttccactg tacccgtcgc ctgggcgcgg tagcgtgcag cagttccacc tcgtcgtcaa 18180

gttcatcatc atcatctttc tttttctttt tgacccgctt tagctttcgg ggcttgtaat 18240

cctgctcttc cttcttcggg gggccataga tctccggcgc gatgacctgg agcatctctt 18300

ctttgatttt gcgcttggac atagcttcgt tgcgcgccgc cgccgctgga tacatacaac 18360

agtacgagtc taagtagttt tttcttgcaa tctagttgcg cggggggcgg gtgcgcacgg 18420

gcacgcgcag gccgctaacc gagtcgcgca cccaatacac gttgcccctg cgaccctgag 18480

tcatagcact aatggccgcg gctgctgcgg cggccgctcg tcgcctggac ctggggggca 18540

cagtgacaat acccgcggcc agccttcgag cggcccgcat ggccgcccgt cggccggtgc 18600

gacgtgcgcg gttaagcagg gccgccgccg cgcgttgggc ggcagtgccg ggtcggcggc 18660

ggtggcgacg tgctacgcgc ctccgccgtc tcttcatttt agcatagcgc cgggctccgc 18720

gcaccacggt ctgaatggcc gcgtccactg tggacactgg tggcggcgtg ggcgtgtagt 18780

tgcgcgcctc ctccaccacc gcgtcgatgg cgtcatcgac ggtggtgcgc ccagtgcggc 18840

cgcgtttgtg cgcgccccag ggcgcgcggt agtgcccgcg cacgcgcact gggtgttggt 18900

cggagcgctt cttggccccg ccaaacatct tgcttgggaa gcgcaggccc cagcctgtgt 18960

tattgctggg cgatataagg atggacatgc ttgctcaaaa agtgcggctc gataggacgc 19020

gcggcgagac tatgcccagg gccttgtaaa cgtaggggca ggtgcggcgt ctggcgtcag 19080

taatggtcac tcgctggact cctccgatgc tgttgcgcag cggtagcgtc ccgtgatctg 19140

tgagagcagg aacgttttca ctgacggtgg tgatggtggg ggctggcggg cgcgccaaaa 19200

tctggttctc gggaaagcga ttgaacacgt gggtcagaga ggtaaactgg cggatgagtt 19260

gggagtagac ggcctggtcg ttgtagaagc tcttggagtg cacgggcaac agctcggcgc 19320

ccaccaccgg aaagttgctg atctggcgcg tggagcggaa ggtcacgggg tcttgcatca 19380

tgtctggcaa cgaccagtag acctgctccg agccgcaggt tacgtcagga gtgcaaagca 19440

gggtccatga gcggattccg gtctgagggt cgccgtagtt gtatgcaagg taccagctgc 19500

ggtactgggt gaaggtgctg tcattgctta ttaggttgta actgcgtttc ttgctgtcct 19560

ctgtcagggg tttgatcacc ggtttcttct gaggcttctc gacctcgggt tgcgcagcgg 19620

gggcggcagc ttcggccgct gcttcggcct cagcgcgctt ctcctcagcc cgtgtggcaa 19680

aggtgtcgcc gcgaatggca tgatcgttca tgtcctccac cggctgcatt gccgcggctg 19740

ccgcgttgga gttctcttcc gcgccgctgc cactgctgtt gctgccgcct gcgccacccc 19800

cgccctgttc ggtgtcatct ttcaagctcg cctggtaggc gtccacatcc aacagtgcgg 19860

gaatgttacc accctccaga tcatcgtagg tgatcctaaa gccctcctgg aagggttgcc 19920

gcttgcggat gcccaacaag ttgctcaggc ggctgtgggt gaagtccacc ccgcatcctg 19980

gcagcaaaat gatgtctgga tggaaggctt cgtttgtata taccccaggc atgacaagac 20040

cagtgacggg gtcaaacccc agtctgaagt tgcgggtgtc aaactttacc ccgatgtcgc 20100

tttccagaac cccgttctgt ctgcccactt tcaagtagtg ctccacgatc gcgttgttca 20160

taaggtctat ggtcatggtc tcggagtagt tgccctcggg cagcgtgaac tccacccact 20220

cgtatttcag ctccacctga ttgtccttag taggcaagcg cgacaccatc acccgcgcct 20280

taaacttatt ggtaaacatg aactcgttca catttggcat gttggtatgc aggatggttt 20340

tcaggtcgcc gccccagtgc gaccggtcgt caagattgat ggtctgtgtg cttgcctccc 20400

ccgggctgta gtcattgttt tgaatgaccg tggtcagaaa gttgctgtgg tcgttctggt 20460

agttcaggga tgccacatcc gttgacttgt tgtccaccag gtacacacgg gtggtgtcga 20520

ataggggtgc caactcagag taacggatgc tgtttctccc cccggtaggc cgcaggtacc 20580

gcggaggcac aaacggcggg tccaggggag catcgaaggg agaacccagc gccgccgcca 20640

ctggcgccgc gctcaccaca ctctcgtagg agggaggagg accttcctca tacatcgccg 20700

cgcgccgcat actaagggga atacaagaaa accaacgctc ggtgccatgg ccttggtgag 20760

ttttttattt tgcatcatgc tttttttttt tttaaaacat tctccccagc ctggggcgaa 20820

ggtgcgcaaa cgggttgcca ctccctccca aatccaggac gctgctgtcg tctgccgagt 20880

catcgtcctc ccacaccaga ccccgctgac ggtcgtgcct ttgacgacgg gtgggcgggc 20940

gcgggcctgg cacgtccctg tgctcctgcg cgtacgtctt ccatctactc atcttgtcca 21000

ctaggctctc tatcccgttg ttgggaaatg ccggaggcag gtttttttcg cgctgcggct 21060

gcagcagcga gttgtttagg tactcctcct cgcccagcag gcgcgggcgg gtggtgcgag 21120

tgctggtaag agaccctatc aagcttggaa atgggctact agcatctgac cgcggggccg 21180

cagcgcctag atcggacaag ctgcttggcc tgcggaagct ttcctttcgc agcgccgcct 21240

ctgcctgctc gcgctgttgc aactctagca gggtctgcgg ttgcggggaa aacacgctgt 21300

cgtctatgtc gtcccagagg aatccatcgt taccctcggg cacctcgaat cccccggtgt 21360

agaaaccagg gggcggtagc cagtgcgggt tcaagatggc attggtgaaa tactcggggt 21420

tcacggcggc cgcgcgatgc aagtagtcca ttaggcggtt gataaacggc cggtttgagg 21480

catacatgcc cggttccatg ttgcgcgcgg tcatgtccag cgccacgctg ggcgttaccc 21540

cgtcgcgcat caggttaagg ctcacgctct gctgcacgta gcgcaaaatg cgctcctcct 21600

cgctgtttaa actgtgcaac gaggggatct tctgccgccg gttggtcagc aggtagttta 21660

gggttgcctc caggctgccc gtgtcctcct gccccagcgc gcggctgaca cttgtaatct 21720

cctggaaagt atgctcgtcc acatgcgcct gacctatggc ctcgcggtac agtgtcagca 21780

agtgacctag gtatgtgtcc cgggacacgc tgccactgtc cgtgaagggc gctattagca 21840

gcagcaacag gcgcgagttg ggcgtcagca agctagacac ggtcgcgcgg tcgcctgtgg 21900

gagcccgcac cccccacagc ccctgcaagt ttttgaaagc ctggctcagg tttacggtct 21960

gcaggccttg tctactggtc tggaaaaaat agtctggccc agactggtac acctcacttt 22020

gcggtgtctc agtcaccatt agccgcagtg cgctcacaaa gttggtgtag tcctcctgtc 22080

cccgcggcac gttggcgggc tgtgtactca ggaaggcgtt tagtgcaacc atggagccca 22140

ggttgccctg ctgctgcgcg cgctcacgct gcgccacggc ctcgcgcaca tcccccacca 22200

gccggtccag gttggtctgc acgttgccgc tgttgtaacg agccacgcgc tgaagcagcg 22260

cgtcgtagac caggccggcc tcgtcgggcc ggatggccct gttttcggcc agcgcgttta 22320

cgatcgccag caccttctcg tgcgtggggt ttgcgcgcgc cgggaccacc gcttccagaa 22380

ttgcggagag ccggttggcc tgcggctgct gccggaacgc gtcaggattg cgcgcagtca 22440

gcgacatgat gcggtccatg acctggcgcc agtcgtccgt ggagttaagg ccggacggct 22500

ggctctgcag cgccgcccgc accgccgggt ccgttgcgtc ttgcatcatc tgatcagaaa 22560

catcaccgct tagtactcgc cgtcctctgg ctcgtactca tcgtcctcgt catattcctc 22620

cacgccgccg acgttgccag cgcgcgcggg tgccaccgcc agcccaggtc cggccccagc 22680

tgcctccagg gcgcgtcggc ttggggccca gcgcaggtca gcgcccgcgt caaagtagga 22740

ctcggcctct ctatcgccgc tgcccgtgcc agccagggcc ctttgcaggc tgtgcatcag 22800

ctcgcggtcg ctgagctcgc gccgccggct cacgctcacg gccttgtgga tgcgctcgtt 22860

gcgataaacg cccaggtcgt cgctcaaggt aagcaccttc agcgccatgc gcatgtagaa 22920

cccctcgatc tttacctcct tgtctatggg aacgtaaggg gtatggtata tcttgcgggc 22980

gtaaaacttg cccaggctaa gcatggaata gttgatggcg gccaccttgt cagccaggct 23040

caagctgcgc tcctgcacca ctatgctctg caggatgttt atcaaatcga gcagccagcg 23100

gccctcgggc tctactatgt ttagcagcgc atccctgaat gcctcgttgt ccctgctgtg 23160

ctgcactata aggaacagct gcgccatgag cggcttgcta tttgggtttt gctccagcgc 23220

gcttacaaag tcccacagat gcatcagtcc tatagccacc tcctcgcgcg ccacaagcgt 23280

acgcacgtgg ttgttaaagc ttttttgaaa gttaatctcc tggttcaccg tctgctcgta 23340

tgcggttacc aggtcggcgg ccgccacgtg tgcgcgcgcg ggactaatcc cggttcgcgc 23400

gtcgggctca aagtcctcct cgcgcagcaa ccgctcgcga ttcaggccat gccgcagctc 23460

gcgccctgcg tggaactttc gatcccgcat ctcctcgggc tcctctccct cgcggtcgcg 23520

aaacaggttc tgccgcggca cgtacgcctc acgcgtatca cgcttcagct gcacccttgg 23580

gtgccgctca ggagagggcg ctcctagccg cgccaggccc tcgccctcct ccaagtccag 23640

gtagtgccgg gcccggcgcc gcgggggttc gtaatcacca tctgctgccg cgtcaaccgc 23700

ggatgtcgcc cctcctgacg cggtaggagg aggggagggt gccctgcatg tctgccgctg 23760

ctcttgctct tgccgctgct gaggaggggg gcgcatctgc cgcagcaccg gatgcatctg 23820

ggaaaagcaa aaaaggggct cgtccctgtt tccggaggaa tttgcaagcg gggtcttgca 23880

tgacggggag gcaaaccccc gttcgccgca gtccggccgg tccgagactc gaaccggggg 23940

tcccgcgact caacccttgg aaaataaccc tccggctaca gggagcgagc cacttaatgc 24000

tttcgctttc cagcctaacc gcttacgctg cgcgcggcca gtggccaaaa aagctagcgc 24060

agcagccgcc gcgcctggaa ggaagccaaa aggagcactc ccccgttgtc tgacgtcgca 24120

cacctgggtt cgacacgcgg gcggtaaccg catggatcac ggcggacggc cggatacggg 24180

gctcgaaccc cggtcgtccg ccatgatacc cttgcgaatt tatccaccag accacggaag 24240

agtgcccgct tacaggctct ccttttgcac gctagagcgt caacgattgc gcgcgcctga 24300

ccggccagag cgtcccgacc atggagcact ttttgccgct gcgcaacatc tggaaccgcg 24360

tccgcgactt tccgcgcgcc tccaccaccg ccgccggcat cacctggatg tccaggtaca 24420

tctacggata tcatcgcctt atgttggaag atctcgcccc cggagccccg gccaccctac 24480

gctggcccct ctaccgccag ccgccgccgc actttttggt gggataccag tacctggtgc 24540

ggacttgcaa cgactacgta tttgactcga gggcttactc gcgtctcagg tacaccgagc 24600

tctcgcagcc gggtcaccag accgttaact ggtccgttat ggccaactgc acttacacca 24660

tcaacacggg cgcataccac cgctttgtgg acatggatga cttccagtct accctcacgc 24720

aggtgcagca ggccatatta gccgagcgcg ttgtcgccga cctagccctg cttcagccga 24780

tgaggggctt cggggtcaca cgcatgggag gaagagggcg ccacctacgg ccaaactccg 24840

ccgccgccgc agcgatagat gcaagagatg caggacaaga ggaaggagaa gaagaagtgc 24900

cggtagaaag gctcatgcaa gactactaca aagacctgcg ccgatgtcaa aacgaagcct 24960

ggggcatggc cgaccgcctg cgcattcagc aggccggacc caaggacatg gtgcttctgt 25020

cgaccatccg ccgtctcaag accgcctact ttaattacat catcagcagc acctccgcca 25080

gaaacaaccc cgaccgccgc ccgctgccgc ccgccacggt gctcagccta ccttgcgact 25140

gtgactggtt agacgccttt ctcgagaggt tttccgatcc ggtcgatgcg gactcgctca 25200

ggtccctcgg cggcggagta cctacacaac aattgttgag atgcatcgtt agcgccgtat 25260

ccctgccgca tggcagcccc ccgccaaccc ataaccggga catgacgggc ggcgtcttcc 25320

aactgcgccc ccgcgagaac ggccgcgccg tcaccgagac catgcgccgt cgccgcgggg 25380

agatgatcga gcgctttgtc gaccgcctcc cggtgcgccg tcgtcgccgc cgtgtccccc 25440

ctcccccacc gccgccagaa gaagaagaag gggaggccct tatggaagag gagattgaag 25500

aagaagaaga ggcccctgta gcctttgagc gcgaggtgcg cgacactgtc gccgagctca 25560

tccgtcttct ggaggaggag ttaaccgtgt cggcgcgcaa ctcccagttt ttcaacttcg 25620

ccgtggactt ctacgaggcc atggagcgcc ttgaggcctt gggggatatc aacgaatcca 25680

cgttgcgacg ctgggttatg tacttcttcg tggcagaaca caccgccacc accctcaact 25740

acctctttca gcgcctgcga aactacgccg tcttcgcccg gcacgtggag ctcaatctcg 25800

cgcaggtggt catgcgcgcc cgcgatgccg aagggggcgt ggtctacagc cgcgtctgga 25860

acgagggagg cctcaacgcc ttctcgcagc tcatggcccg catttccaac gacctcgccg 25920

ccaccgtgga gcgagccgga cgcggagatc tccaggagga agagatcgag cagttcatgg 25980

ccgagatcgc ctatcaagac aactcaggag acgtgcagga gattttgcgc caggccgccg 26040

tcaacgacac cgaaattgat tctgtcgaac tctctttcag gttcaagctc accgggcccg 26100

tcgtcttcac gcagaggcgc cagattcagg agatcaaccg ccgcgtcgtc gcgttcgcca 26160

gcaacctacg cgcgcagcac cagctcctgc ccgcgcgcgg cgccgacgtg cccctgcccc 26220

ctctcccggc gggtccggag ccccccctac ctccgggggc tcgcccgcgt caccgctttt 26280

agatgcatca tccaaggaca cccccgcggc ccaccgcccg ccgcgcggta ccgtagtcgc 26340

gccgcgggga tgcggcctct tgcaagccat cgacgccgcc accaaccagc ccctggaaat 26400

taggtatcac ctggatctag cccgcgccct gacccgtcta tgcgaggtaa acctgcagga 26460

gctcccgcct gacctgacgc cgcgggagct ccagaccatg gacagctccc atctgcgcga 26520

tgttgtcatc aagctccgac cgccgcgcgc ggacatctgg actttgggct cgcgcggcgt 26580

ggtggtccga tccaccgtaa ctcccctcga gcagccagac ggtcaaggac aagcagccga 26640

agtagaagac caccagccaa acccgccagg cgaggggctc aaattcccac tctgcttcct 26700

tgtgcgcggt cgtcaggtca acctcgtgca ggatgtacag cccgtgcacc gctgccagta 26760

ctgcgcacgt ttttacaaaa gccagcacga gtgttcggcc cgtcgcaggg acttctactt 26820

tcaccacatc aatagccact cctccaattg gtggcgggag atccagttct tcccgatcgg 26880

ctcgcatcct cgcaccgagc gtctctttgt cacctacgat gtagagacct atacttggat 26940

gggggccttt gggaagcagc tcgtgccctt catgctggtc atgaagttcg gcggagatga 27000

gcctctagtg actgccgcgc gagacctagc cgcgaacctt ggatgggacc gctgggaaca 27060

agacccgctt accttctact gcatcacccc agaaaaaatg gccataggtc gccagtttag 27120

gacctttcgc gaccacctgc aaatgctaat ggcccgtgac ctgtggagct cattcgtcgc 27180

ttccaaccct catcttgcag actgggccct ttcagagcac gggctcagct cccctgaaga 27240

gctcacctac gaggaactta aaaaattgcc ttccatcaag ggcatcccgc gcttcttgga 27300

actttacatt gtgggccaca acatcaacgg ctttgacgag atcgtgctcg ccgcccaggt 27360

aattaacaac cgttccgagg tgccgggacc cttccgcatc acacgcaact ttatgcctcg 27420

cgcgggaaag atactcttca acgatgtcac cttcgccctg ccaaatccgc gttccaaaaa 27480

gcgcacggac tttttgctct gggagcaggg cggatgcgac gacactgact tcaaatacca 27540

gtacctcaaa gtcatggtca gggacacctt tgcgctcacc cacacctcgc tccggaaggc 27600

cgcgcaggca tacgcgctac ccgtagaaaa gggatgctgc gcctaccagg ccgtcaacca 27660

gttctacatg ctaggctctt accgttcgga ggccgacggg tttccgatcc aagagtactg 27720

gaaagaccgc gaagagtttg tcctcaaccg cgagctgtgg aaaaaaaagg gacaggataa 27780

gtatgacatc atcaaggaaa ccctggacta ctgcgcccta gacgtgcagg tcaccgccga 27840

gctggtcaac aagctgcgcg actcctacgc ctccttcgtg cgtgacgcgg taggtctcac 27900

agacgccagc ttcaacgtct tccagcgtcc aaccatatca tccaactcac atgccatctt 27960

caggcagata gtcttccgag cagagcagcc cgcccgtagc aacctcggtc ccgacctcct 28020

cgctccctcg cacgaactat acgattacgt gcgcgccagc atccgcggtg gaagatgcta 28080

ccctacatat cttggaatac tcagagagcc cctctacgtt tacgacattt gcggcatgta 28140

cgcctccgcg ctcacccacc ccatgccatg gggtccccca ctcaacccat acgagcgcgc 28200

gcttgccgcc cgcgcatggc agcaggcgct agacttgcaa ggatgcaaga tagactactt 28260

cgacgcgcgc ctgctgcccg gggtctttac cgtggacgca gaccccccgg acgagacgca 28320

gctagacccc ctaccgccat tctgctcgcg caagggcggc cgcctctgct ggaccaacga 28380

gcgcctacgc ggagaggtag ccaccagcgt tgaccttgtc accctgcaca accgcggttg 28440

gcgcgtgcac ctggtgcccg acgagcgcac caccgtcttt cccgaatggc ggtgcgttgc 28500

gcgcgaatac gtgcagctaa acatcgcggc caaggagcgc gccgatcgcg acaaaaacca 28560

aaccctgcgc tccatcgcca agttgctgtc caacgccctc tacgggtcgt ttgccaccaa 28620

gcttgacaac aaaaagattg tcttttctga ccagatggat gcggccaccc tcaaaggcat 28680

caccgcgggc caggtgaata tcaaatcctc ctcgtttttg gaaactgaca atcttagcgc 28740

agaagtcatg cccgcttttc agagggagta ctcaccccaa cagctggccc tcgcagacag 28800

cgatgcggaa gagagtgagg acgaacgcgc ccccaccccc ttttatagcc ccccttcagg 28860

aacacccggt cacgtggcct acacctacaa accaatcacc ttccttgatg ccgaagaggg 28920

cgacatgtgt cttcacaccc tggagcgagt ggacccccta gtggacaacg accgctaccc 28980

ctcccactta gcctccttcg tgctggcctg gacgcgagcc tttgtctcag agtggtccga 29040

gtttctatac gaggaggacc gcggaacacc gctcgaggac aggcctctca agtctgtata 29100

cggggacacg gacagccttt tcgtcaccga gcgtggacac cggctcatgg aaaccagagg 29160

taagaaacgc atcaaaaagc atgggggaaa cctggttttt gaccccgaac ggccagagct 29220

cacctggctc gtggaatgcg agaccgtctg cggggcctgc ggcgcggatg cctactcccc 29280

ggaatcggta tttctcgcgc ccaagctcta cgccctcaaa agtctgcact gcccctcgtg 29340

cggcgcctcc tccaagggca agctgcgcgc caagggccac gccgcggagg ggctggacta 29400

tgacaccatg gtcaaatgct acctggccga cgcgcagggc gaagaccggc agcgcttcag 29460

caccagcagg accagcctca agcgcaccct ggccagcgcg cagcccggag cgcacccctt 29520

caccgtgacc cagactacgc tgacgaggac cctgcgcccg tggaaagaca tgaccctggc 29580

ccgtctggac gagcaccgac tactgccgta cagcgaaagc cgccccaacc cgcgaaacga 29640

ggagatatgc tggatcgaga tgccgtagag caggtgaccg agctgtggga ccgcctggaa 29700

ctgcttggtc aaacgctcaa aagcatgcct acggcggacg gtctcaaacc gttgaaaaac 29760

tttgcttcct tgcaagaact gctatcgctg ggcggcgagc gccttctggc ggatttggtc 29820

agggaaaaca tgcgagtcag ggacatgctt aacgaagtgg cccccctgct cagggatgac 29880

ggcagctgca gctctcttaa ctaccagttg cagccggtaa taggtgtgat ttacgggccc 29940

accggctgcg gtaagtcgca gctgctcagg aacctgcttt cttcccagct gatctcccct 30000

accccggaaa ccgttttctt catcgccccg caggtagaca tgatcccccc atctgaactc 30060

aaagcgtggg aaatgcaaat ctgtgagggt aactacgccc ctgggccgga tggaaccatt 30120

ataccgcagt ctggcaccct ccgcccgcgc tttgtaaaaa tggcctatga cgatctcatc 30180

ctggaacaca actatgacgt tagtgatccc agaaatatct tcgcccaggc cgccgcccgt 30240

gggcccattg ccatcattat ggacgaatgc atggaaaatc ttggaggtca caagggcgtc 30300

tccaagttct tccacgcatt tccttctaag ctacatgaca aatttcccaa gtgcaccgga 30360

tacactgtgc tggtggttct gcacaacatg aatccccgga gggatatggc tgggaacata 30420

gccaacctaa aaatacagtc caagatgcat ctcatatccc cacgtatgca cccatcccag 30480

cttaaccgct ttgtaaacac ttacaccaag ggcctgcccc tggcaatcag cttgctactg 30540

aaagacattt ttaggcacca cgcccagcgc tcctgctacg actggatcat ctacaacacc 30600

accccgcagc atgaagctct gcagtggtgc tacctccacc ccagagacgg gcttatgccc 30660

atgtatctga acatccagag tcacctttac cacgtcctgg aaaaaataca caggaccctc 30720

aacgaccgag accgctggtc ccgggcctac cgcgcgcgca aaacccctaa ataaagacag 30780

caagacactt gcttgatcca aatccaaaca gagtctggtt ttttatttat gttttaaacc 30840

gcattgggag gggaggaagc cttcagggca gaaacctgct ggcgcagatc caacagctgc 30900

tgagaaacga cattaagttc ccgggtcaaa gaatccaatt gtgccaaaag agccgtcaac 30960

ttgtcatcgc gggcggatga acgggaagct gcactgcttg caagcgggct caggaaagca 31020

aagtcagtca caatcccgcg ggcggtggct gcagcggctg aagcggcggc ggaggctgca 31080

gtctccaacg gcgttccaga cacggtctcg taggtcaagg tagtagagtt tgcgggcagg 31140

acggggcgac catcaatgct ggagcccatc acattctgac gcaccccggc ccatgggggc 31200

atgcgcgttg tcaaatatga gctcacaatg cttccatcaa acgagttggt gctcatggcg 31260

gcggcggctg ctgcaaaaca gatacaaaac tacataagac ccccacctta tatattcttt 31320

cccacccttg tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt gcgcgagcaa 31380

aatttaagct acaacaaggc aaggcttgac cgacaattgc atgaagaatc tgcttagggt 31440

taggcgtttt gcgctgcttc gcgatgtacg ggccagatat acgcgttgac attgattatt 31500

gactagttat taatagtaat caattacggg gtcattagtt catagcccat atatggagtt 31560

ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc 31620

attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg 31680

tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 31740

gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca 31800

gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 31860

taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg 31920

gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca 31980

acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg 32040

tgtacggtgg gaggtctata taagcagagc tctctggcta actagagaac ccactgctta 32100

ctggcttatc gaaattaata cgactcacta tagggagacc caagctggct agcgtttaaa 32160

cttaagcttg gtaccgagct cggatccgcc accatgggca acagactgat caagaaggat 32220

ctgaagaagt gtgagtacta ctacggcgag cagcagaacc tgaagcagat ctggagactg 32280

ctgtttaatg agcctctggg cacctacgtg gtgtccagct tcctgaagaa gaactacgtg 32340

gtgatctcct tctcctgtcc tacaaacaca agaatcatgc acctgagaat caacatctgc 32400

tacgatctgt actgtatcaa cggcgagtac tacgagaaga tcgacgattt tatcaggctg 32460

tacccccaca tcttctacag gcctctgtac aggtacaaga gctaccctta cgacgtgccc 32520

gactacgcca tgcagatttt cgtgaaaacc cttacgggga agaccatcac cctcgaggtt 32580

gaaccctcgg atacgataga aaatgtaaag gccaagatcc aggataagga aggaattcct 32640

cctgatcagc agagactgat ctttgctggc aagcagctgg aagatggacg tactttgtct 32700

gactacaata ttcaaaagga gtctactctt catcttgtgt tgagacttcg tggtggtgct 32760

aagaaaagga agaagaagtc ttacaccact cccaagaaga ataagcacaa gagaaagaag 32820

gttaagctgg ctgtcctgaa atattataag gtggatgaga atggcaaaat tagtcgcctt 32880

cgtcgagagt gcccttctga tgaatgtggt gctggggtgt ttatggcaag tcactttgac 32940

agacattatt gtggcaaatg ttgtctgact tactgtttca acaaaccaga agacaagtaa 33000

gatatcggac tataaggatg atgacgacaa ataatagcaa ttcctcgacg actgcatagg 33060

gttacccccc tctccctccc ccccccctaa cgttactggc cgaagccgct tggaataagg 33120

ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg gcaatgtgag 33180

ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt cccctctcgc 33240

caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg aagcttcttg 33300

aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac ctggcgacag 33360

gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg cacaacccca 33420

gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct caagcgtatt 33480

caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg atctggggcc 33540

tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg ccccccgaac 33600

cacggggacg tggttttcct ttgaaaaaca cgatgataat ggccacaacc gcggccgcgc 33660

caccatggtg agcaggtttc tgatcgccga gtacaggcac ctgatcgaga acccctccga 33720

gaactttaag atctccgtga acgagaagga tatgacagag tgggatgtga tcctgagagg 33780

cccccctgac accttttacg agggcggcct gtttaaggcc aagatcgcct ttcctcccga 33840

gtacccttac gcccccccca ggctgacatt tacaagcgag atgtggcacc ccaacatcta 33900

cagcgatggc aagctgtgta tctccatcct gcacggcgac aatgccgagg agcagggcat 33960

gacatggagc cctgcccaga agatcgacac catcctgctg agcgtgatct ccctgctgaa 34020

cgagcctaac cctgactccc ccgccaacgt ggatgccgcc aagagctaca ggaagctgct 34080

gtacaaggag gacctggagt cctaccccat ggaggtgaag aggaccgtga agaagtccct 34140

ggatgagtgc tcccccgagg acatcgagta ctttaagaac gccgccagca atgtgcctcc 34200

tatcccttcc gacgcctacg aggatgagtg cgaggagatg gaggatgaca cctacatcct 34260

gacctacgac gatgaggacg aggaggagga ggatgacgag tacccctacg atgtgcccga 34320

ttacgcctga ctcgagtcta gagggcccgt ttaaacccgc tgatcacttc gcccacccca 34380

acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 34440

ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 34500

atcatgtctg gatcggtgat caccgatccc ggaaaaacac ctgggcgagt ctccacgtaa 34560

acggtcaaag tccccgcggg ccctagacaa atattacgcg ctatgagtaa cacaaaatta 34620

ttcagatttc acttcctctt attcagtttt cccgcgaaaa tggccaaatc ttactcggtt 34680

acgcccaaat ttactacaac atccgcctaa aaccgcgcga aaattgtcac ttcctgtgta 34740

caccggcgca caccaaaaac gtcacttttg ccacatccgt cgcttacatg tgttccgcca 34800

cacttgcaac atcacacttc cgccacacta ctacgtcacc cgccccgttc ccacgccccg 34860

cgccacgtca caaactccac cccctcatta tcatattggc ttcaatccaa aataaggtat 34920

attattgatg atgataagct atcaaacatg agaattcggc gcgccattat catttgcggg 34980

tcctttccgg cgatccgcct tgttacgggg cggcgacctc gcgggttttc gctatttatg 35040

aaaattttcc ggtttaaggc gtttccgttc ttcttcgtca taacttaatg tttttattta 35100

aaataccctc tgaaaagaaa ggaaacgaca ggtgctgaaa gcgagctttt tggcctctgt 35160

cgtttccttt ctctgttttt gtccgtggaa tgaacaacgc gcctcactgc ccgctttcca 35220

gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 35280

tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc aacagctgat 35340

tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg gtttgcccca 35400

gcaggcgaaa atcctgtttg atggtggttg acggcgggat ataacatgag ctgtcttcgg 35460

tatcgtcgta tcccactacc gagatatccg caccaacgcg cagcccggac tcggtaatgg 35520

cgcgcattgc gcccagcgcc atctgatcgt tggcaaccag catcgcagtg ggaacgatgc 35580

cctcattcag catttgcatg gtttgttgaa aaccggacat ggcactccag tcgccttccc 35640

gttccgctat cggctgaatt tgattgcgag tgagatattt atgccagcca gccagacgca 35700

gacgcgccga gacagaactt aatgggcccg ctaacagcgc gatttgctgg tgacccaatg 35760

cgaccagatg ctccacgccc agtcgcgtac cgtcttcatg ggagaaaata atactgttga 35820

tgggtgtctg gtcagagaca tcaagaaata acgccggaac attagtgcag gcagcttcca 35880

cagcaatggc atcctggtca tccagcggat agttaatgat cagcccactg acgcgttgcg 35940

cgagaagatt gtgcaccgcc gctttacagg cttcgacgcc gcttcgttct accatcgaca 36000

ccaccacgct ggcacccagt tgatcggcgc gagatttaat cgccgcgaca atttgcgacg 36060

gcgcgtgcag ggccagactg gaggtggcaa cgccaatcag caacgactgt ttgcccgcca 36120

gttgttgtgc cacgcggttg ggaatgtaat tcagctccgc catcgccgct tccacttttt 36180

cccgcgtttt cgcagaaacg tggctggcct ggttcaccac gcgggaaacg gtctgataag 36240

agacaccggc atactctgcg acatcgtata acgttactgg tttcacattc accaccctga 36300

attgactctc ttccgggcgc tatcatgcca taccgcgaaa ggttttgcac cattcacctg 36360

cacaccgcgc cttaattaag aattccgtgt attctatagt gtcacctaaa tcgtatgtgt 36420

atgatacata aggttatgta ttaattgtag ccgcgttcta acgacaatat gtacaagcct 36480

aattgtgtag catctggctt actgaagcag accctatcat ctctctcgta aactgccgtc 36540

agagtcggtt tggttggacg aaccttctga gtttctggta acgccgttcc gcaccccgga 36600

aatggtcagc gaaccaatca gcagggtcat cgctagccag atcctctacg ccggacgcat 36660

cgtggccaaa aggatctagg tgaagatcct ttttgataat ctcatgacca aaatccctta 36720

acgtgagttt tcgttccact gagcgtcaga ccccttaata agatgatctt cttgagatcg 36780

ttttggtctg cgcgtaatct cttgctctga aaacgaaaaa accgccttgc agggcggttt 36840

ttcgaaggtt ctctgagcta ccaactcttt gaaccgaggt aactggcttg gaggagcgca 36900

gtcaccaaaa cttgtccttt cagtttagcc ttaaccggcg catgacttca agactaactc 36960

ctctaaatca attaccagtg gctgctgcca gtggtgcttt tgcatgtctt tccgggttgg 37020

actcaagacg atagttaccg gataaggcgc agcggtcgga ctgaacgggg ggttcgtgca 37080

tacagtccag cttggagcga actgcctacc cggaactgag tgtcaggcgt ggaatgagac 37140

aaacgcggcc ataacagcgg aatgacaccg gtaaaccgaa aggcaggaac aggagagcgc 37200

acgagggagc cgccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac 37260

cactgatttg agcgtcagat ttcgtgatgc ttgtcagggg ggcggagcct atggaaaaac 37320

ggctttgccg cggccctctc acttccctgt taagtatctt cctggcatct tccaggaaat 37380

ctccgccccg ttcgtaagcc atttccgctc gccgcagtcg aacgaccgag cgtagcgagt 37440

cagtgagcga ggaagcggaa tatatcctgt atcacatatt ctgctgacgc accggtgcag 37500

ccttttttct cctgccacat gaagcacttc actgacaccc tcatcagtgc caacatagta 37560

agccagtata cactccgcta gcgctgaggt ctgcctcgtg aagaaggtgt tgctgactca 37620

taccaggcct gaatcgcccc atcatccagc cagaaagtga gggagccacg gttgatgaga 37680

gctttgttgt aggtggacca gttggtgatt ttgaactttt gctttgccac ggaacggtct 37740

gcgttgtcgg gaagatgcgt gatctgatcc ttcaactcag caaaagttcg atttattcaa 37800

caaagccacg ttgtgtctca aaatctctga tgttacattg cacaagataa aaatatatca 37860

tcatgaacaa taaaactgtc tgcttacata aacagtaata caaggggtgt tatgagccat 37920

attcaacggg aaacgtcttg ctcgaggccg cgattaaatt ccaacatgga tgctgattta 37980

tatgggtata aatgggctcg cgataatgtc gggcaatcag gtgcgacaat ctatcgattg 38040

tatgggaagc ccgatgcgcc agagttgttt ctgaaacatg gcaaaggtag cgttgccaat 38100

gatgttacag atgagatggt cagactaaac tggctgacgg aatttatgcc tcttccgacc 38160

atcaagcatt ttatccgtac tcctgatgat gcatggttac tcaccactgc gatccccggg 38220

aaaacagcat tccaggtatt agaagaatat cctgattcag gtgaaaatat tgctgatgcg 38280

ctggcagtgt tcctgcgccg gttgcattcg attcctgttt gtaattgtcc ttttaacagc 38340

gatcgcgtat ttcgtctcgc tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg 38400

agtgattttg atgacgagcg taatggctgg cctgttgaac aagtctggaa agaaatgcat 38460

a 38461

<210> 9

<211> 1023

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atcgtttgtg ttatgtttca acgtgtttat ttttcaattg cagaaaattt caagtcattt 60

ttcattcagt agtatagccc caccaccaca tagcttatac agatcaccgt accttaatca 120

aactcacaga accctagtct acatgggggt agagtcataa tcgtgcatca ggatagggcg 180

gtggtgctgc agcagcgcgc gaataaactg ctgccgccgc cgctccgtcc tgcaggaata 240

caacatggca gtggtctcct cagcgatgat tcgcaccgcc cgcagcataa ggcgccttgt 300

cctccgggca cagcagcgca ccctgatctc acttaaatca gcacagtaac tgcagcacag 360

caccacaata ttgttcaaaa tcccacagtg caaggcgctg tatccaaagc tcatggcggg 420

gaccacagaa cccacgtggc catcatacca caagcgcagg tagattaagt ggcgacccct 480

cataaacacg ctggacataa acattacctc ttttggcatg ttgtaattca ccacctcccg 540

gtaccatata aacctctgat taaacatggc gccatccacc accatcctaa accagctggc 600

caaaacctgc ccgccggcta tacactgcag ggaaccggga ctggaacaat gacagtggag 660

agcccaggac tcgtaaccat ggatcatcat gctcgtcatg atatcaatgt tggcacaaca 720

caggcacacg tgcatacact tcctcaggat tacaagctcc tcccgcgtta gaaccatatc 780

ccagggaaca acccattcct gaatcagcgt aaatcccaca ctgcagggaa gacctcgcac 840

gtaactcacg ttgtgcattg tcaaagtgtt acattcgggc agcagcggat gatcctccag 900

tatggtagcg cgggtttctg tctcaaaagg aggtagacga tccctactgt acggagtgcg 960

ccgagacaac cgagatcgtg ttggtcgtag tgtcatgcca aatggaacgc cggacgtagt 1020

cat 1023

<210> 10

<211> 644

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggactataag gatgatgacg acaaataata gcaattcctc gacgactgca tagggttacc 60

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 120

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 180

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 240

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 300

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 360

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 420

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 480

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 540

cacatgcttt acatgtgttt agtcgaggtt aaaaaacgtc taggcccccc gaaccacggg 600

gacgtggttt tcctttgaaa aacacgatga taatggccac aacc 644

<210> 11

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60

ggacct 66

<210> 12

<211> 2796

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaattccgtg tattctatag tgtcacctaa atcgtatgtg tatgatacat aaggttatgt 60

attaattgta gccgcgttct aacgacaata tgtacaagcc taattgtgta gcatctggct 120

tactgaagca gaccctatca tctctctcgt aaactgccgt cagagtcggt ttggttggac 180

gaaccttctg agtttctggt aacgccgttc cgcaccccgg aaatggtcag cgaaccaatc 240

agcagggtca tcgctagcca gatcctctac gccggacgca tcgtggccgg catcaccggc 300

gccacaggtg cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct 360

cgccacttcg ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc 420

gggggactgt tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac 480

ggcctcaacc tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga 540

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 600

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 660

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcattcacc gtcatcaccg 720

aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 780

ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 840

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 900

atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 960

attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 1020

gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 1080

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 1140

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 1200

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 1260

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 1320

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 1380

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 1440

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 1500

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 1560

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 1620

aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 1680

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 1740

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 1800

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 1860

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 1920

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 1980

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 2040

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 2100

ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 2160

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 2220

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 2280

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 2340

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 2400

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 2460

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 2520

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 2580

ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 2640

accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 2700

gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 2760

gttggccgat tcattaatgc agctggctta tcgaaa 2796

<210> 13

<211> 1722

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaattca aaattttatc 120

gtactagtgg atctgcgatc gctccggtgc ccgtcagtgg gcagagcgca catcgcccac 180

agtccccgag aagttggggg gaggggtcgg caattgaacg ggtgcctaga gaaggtggcg 240

cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc ctttttcccg agggtggggg 300

agaaccgtat ataagtgcag tagctcccta tcagtgatag agatctccct atcagtgata 360

gagattcgcc gtgaacgttc tttttcgcaa cgggtttgcc gccagaacac agctgaagct 420

tcgaggggct cgcatctctc cttcacgcgc ccgccgccct acctgaggcc gccatccacg 480

ccggttgagt cgcgttctgc cgcctcccgc ctgtggtgcc tcctgaactg cgtccgccgt 540

ctaggtaagt ttaaagctca ggtcgagacc gggcctttgt ccggcgctcc cttggagcct 600

acctagactc agccggctct ccacgctttg cctgaccctg cttgctcaac tctacgtctt 660

tgtttcgttt tctgttctgc gccgttacag atccaagctg tgaccggcgc ctacggatcc 720

gccaccatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 780

ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 840

acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 900

cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 960

atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca ggagcgcacc 1020

atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac 1080

accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg 1140

gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag 1200

aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag 1260

ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac 1320

aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac 1380

atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga cgagctgtac 1440

aagtaactcg agtctagagg gcccgtttaa acccgctgat cagcctcgat aatcatctct 1500

tgtacatgtc ccactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 1560

attgaccctt ataaagaatt tggagctact gtggagttac tctcgttttt gccttctgac 1620

ttctttcctt ccgtcagaga tctcctagac accgcctcag ctctgtatcg agaagcctta 1680

gagtctcctc ttctgaggcg gaaagaacca gctggggctc ta 1722

<210> 14

<211> 957

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtatctgctc cctgcttgtg tgttggaggt cgctgagtag tgcgcgagca aaatttaagc 60

tacaacaagg caaggcttga ccgacaattg catgaagaat ctgcttaggg ttaggcgttt 120

tgcgctgctt cgcgatgtac gggccagata tacgcgttga cattgattat tgactagtta 180

ttaatagtaa tcaattacgg ggtcattagt tcatagccca tatatggagt tccgcgttac 240

ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc cattgacgtc 300

aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac gtcaatgggt 360

ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac 420

gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac 480

cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggt 540

gatgcggttt tggcagtaca tcaatgggcg tggatagcgg tttgactcac ggggatttcc 600

aagtctccac cccattgacg tcaatgggag tttgttttgg caccaaaatc aacgggactt 660

tccaaaatgt cgtaacaact ccgccccatt gacgcaaatg ggcggtaggc gtgtacggtg 720

ggaggtctat ataagcagag ctctctggct aactagagaa cccactgctt actggcttat 780

cgaaattaat acgactcact atagggagac ccaagctggc tagcgtttaa acttaagctt 840

ggtaccgagc tcggatccac tagtccagtg tggtggaatt ctgcagatat ccagcacagt 900

ggcggccgct cgagtctaga gggcccgttt aaacccgctg atcacttcgc ccacccc 957

<210> 15

<211> 147

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

tatcatgtct gtataccgtc gacctct 147

Claims

1. An African swine fever virus vaccine is characterized in that the vaccine is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of the African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells;

the four antigen genes are respectively L8Lubiqutin, I215L, I73Rhbsag and E146L, wherein L8Lubiqutin is obtained by adding a molecular adjuvant ubiqutin on L8L, I73Rhbsag is obtained by adding a molecular adjuvant hbsag on 173R, L8Lubiqutin and I215L are expressed in an E1 region, and I73Rhbsag and E146L are expressed in an E4 region, so that a recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L with the co-expression of the four antigen genes is formed;

wherein, the recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73 Rhbbsag-E146L needs to realize recombinant adenovirus packaging through 293TD37 cells constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the cell strain preservation number of the 293TD37 cell is as follows: CCTCC NO of C201996, preserved in China center for type culture Collection;

2. The method for constructing the recombinant adenovirus vector co-expressed by the four antigen genes of the African swine fever virus of claim 1, which comprises the following steps:

1) e1 gene of adenovirus circular carrier plasmid is knocked out by CRISPR/cas9, SwaI restriction enzyme cutting site is introduced, fused fragments and carrier are seamlessly cloned, E3 gene is knocked out by CRISPR/cas9, and seamless cloning mode is used for connection to obtain adenovirus carrier plasmid pAd5 with deletion of E1 and E3 genes;

2) knocking out the E4 gene of the adenovirus circular vector plasmid pAd5 by using CRISPR/cas9, amplifying by using PCR, introducing an I-sceI enzyme cutting site, and obtaining an adenovirus vector plasmid pAd5 delta E4 with E1, E3 and E4 genes deleted by using a seamless cloning method;

3) e2a gene of adenovirus circular vector plasmid pAd5 delta E4 is knocked out by using CRISPR/cas9, ORF6/7 expression frame of E4 region is placed at the sequence position where E2a region is knocked out, and then, E1, E3, E4 and E2a gene deleted adenovirus vector plasmid pAd5LCL3 is obtained by using a seamless cloning method;

4) constructing a shuttle plasmid pS5E1 in the adenovirus E1 region, and respectively connecting the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L in the African swine fever adenovirus 5 type vector E1 region with L8Lubiqutin, IRES and I215L gene segments through DNA ligase;

5) constructing shuttle plasmid pS5E4-EGFP in adenovirus E4 region, obtaining I73Rhbsag-2A-E146L gene fragment by fusion PCR technology of I73Rhbsag and 2A, E146L genes, knocking out EGFP by enzyme digestion of shuttle plasmid pS5E4-EGFP, connecting the EGFP with I73Rhbsag-2A-E146L by DNA ligase, and constructing shuttle plasmid pS5E4-I73Rhbsag-2A-E146L in African swine fever adenovirus 5 type-5 vector E4 region;

6) homologous recombination of the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and the adenovirus vector plasmid pAd5LCL3 to obtain an adenovirus vector plasmid pAd5LCL3-L8 Lubiqutin-IRES-I215L;

7) homologous recombination of the shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and an adenovirus vector plasmid pAd5LCL3-L8 Lubiqlutin-IRES-I215L is carried out, and a recombinant adenovirus vector pAd5LCL3-L8 Lubiqlutin-I215L-I73 Rhbsag-E146L co-expressed by four antigen genes, pAd5LCL3-L8 Lubiqlutin-I215L-I73 Rhbsag-E146L have a nucleotide sequence shown as Seq ID No.8 in a sequence table.

3. The method as claimed in claim 2, wherein the adenovirus circular vector plasmid in step 1) is derived from wild type human adenovirus type 5 virus amplified in A549 cells, the virus solution is collected and concentrated, adenovirus type 5 genome is extracted by HirtVirus DNA Extract method, and linear adenovirus type 5 genome is constructed into circular adenovirus circular vector plasmid by cosmid method.

4. The method as claimed in claim 2, wherein the ORF6/7 expression box gene of step 3) has the nucleotide sequence shown as Seq ID No.9 in the sequence listing; the IRES in the step 4) has a nucleotide sequence shown as Seq ID NO.10 in the sequence table; 2A in the step 5) has a nucleotide sequence shown as Seq ID No.11 in the sequence table.

5. The method according to claim 2, wherein the shuttle plasmid pS5E1 backbone in step 4) adopts puc origin, amp basic elements, Ad5 left arm ITR partial sequence, right arm PIX, PIVa2 partial sequence, and CMV-MCS SV40 early polyA; the skeleton of the shuttle plasmid pS5E4-EGFP in the E4 region in the step 5) adopts puc origin and amp basic elements, an ITR sequence of the left arm of the Ad5E4 region, a fiber gene sequence of the right arm of the Ad5E4 region and an EF1 alpha-EGFP-HBV polyA gene; wherein the puc origin and amp basic elements have the nucleotide sequence shown in Seq ID No.12 in the sequence table, and the EF1 alpha-EGFP-HBV polyA gene has the nucleotide sequence shown in Seq ID No.13 in the sequence table.

6. The method as claimed in claim 2, wherein the homologous recombination of shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3 in step 6) is carried out by digesting shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3 with PacI and SwaI, dephosphorylating the digested product, recovering the vector and fragment from Gel by OMEGA Ultra-Sep Gel Extraction Kit, coating the transformed product on a plate, picking colonies, and carrying out XhoI digestion verification.

7. The method of claim 2, wherein step 7) homologous recombination of shuttle plasmid pS5E4-I73Rhbsag-2A-E146L with adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L is performed by digesting shuttle plasmid pS5E4-I73Rhbsag-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L with PacI and I-sceI, dephosphorylating the digested product, recovering the vector and fragment from Gel by using OMEGA Ultra-sepgel Extraction Kit, plating the transformed product, picking colonies, and performing XhoI-validation digestion.

8. A method for packaging a recombinant adenovirus vector, which is characterized in that the recombinant adenovirus vector pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L of claim 1 or 2 is digested with PacI, and the linearized plasmid is used for transfection; 293TD37 cells constructed from pcDNA3.1+ (hyg) -ORF6-IRES-DBP were transfected and cell suspensions were collected.

9. The method for packaging a recombinant adenoviral vector according to claim 7, wherein the method comprises the steps of:

3) 293TD37 cells were infected with TP0 adenovirus at 37 ℃ and 5% CO₂Culturing for 72 hours in an incubator, and collecting cell suspension, namely TP1 generation adenovirus;

4) repeat 3), collecting cell suspension, namely TP2 generation adenovirus;

5) the inoculation was continued until TP4 generation adenovirus.

10.293 TD37 cell is used for packaging recombinant adenovirus vectors co-expressed by four antigen genes of African swine fever virus, and is characterized in that the four antigen genes are L8Lubiqutin, I215L, I73Rhbsag and E146L respectively, wherein L8Lubiqutin and I215L are expressed in an E1 region, and I73Rhbsag and E146L are expressed in an E4 region, so that the recombinant adenovirus vectors co-expressed by the four antigen genes, pAd5LCL3-L8Lubiqutin-I215L-I73Rhbsag-E146L, are formed;

wherein the 293TD37 cell is constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the collection number of the cell strain is as follows: CCTCC NO of C201996, and is preserved in China center for type culture Collection.