CN113897391B

CN113897391B - Recombinant adenovirus vaccine for African swine fever and construction method thereof

Info

Publication number: CN113897391B
Application number: CN202110762391.0A
Authority: CN
Inventors: 祝志刚; 陈平; 张婷婷; 钟鑫涛; 李娜; 张利娟; 王书芳; 叶宏宇
Original assignee: Jiaxing Anyu Biotechnology Co ltd
Current assignee: Jiaxing Anyu Biotechnology Co ltd
Priority date: 2020-07-06
Filing date: 2021-07-06
Publication date: 2023-08-22
Anticipated expiration: 2041-07-06
Also published as: CN113897391A

Abstract

The invention discloses an African swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells. Wherein, four antigen genes of African swine fever virus are F317L, A151R, P and pp62 respectively. The construction of recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus mainly comprises the steps of knocking out E1, E3, E2a and E4 genes of the adenovirus vector through CRISPR/cas9, constructing shuttle plasmids of E1 and E4 regions, and respectively expressing EF317L and A151R, P and pp62 genes, thereby obtaining a brand-new adenovirus vector. Compared with the first generation adenovirus vector, the vector increases the vector capacity by about 3kb, and then the recombinant adenovirus with higher titer is obtained by packaging the 293TD37 cell line, so that the recombinant adenovirus vaccine for African swine fever is prepared. The invention can greatly improve the capacity of the adenovirus vector vaccine, and enhances the specific immune response to the African swine fever virus by using a mode of simultaneously expressing four independent antigens of the African swine fever on one adenovirus vector.

Description

Recombinant adenovirus vaccine for African swine fever and construction method thereof

The application claims priority of China prior application, application number 2020106427542, 7/6 of the application date 2020; all of which are included as part of the present application.

Technical Field

The application relates to the technical field of genetic engineering and the field of immunology, in particular to a recombinant adenovirus vaccine of African swine fever virus and a construction method thereof.

Background

African Swine Fever (ASF) is a highly contagious swine virus disease. High mortality rates of nearly 100% can result in pigs at home. ASF is caused by ASF virus (ASFVirus, ASFV), a large double-stranded DNA virus that replicates predominantly in the cytoplasm of macrophages, has a 20-sided structure, is 175-215 nm in diameter, and has a genome of 170-190 kb in length, contains 151 open reading frames, can encode 150-200 proteins, and has a bursa. Structural proteins constituting ASFV virions are the P30, P72, P49, P54, P220, P62, pB602L, CD v proteins, etc., and vaccines based on one or two subunits have heretofore failed to induce immunity sufficiently strong to have significant protective effects for vaccinators.

ASF epidemic situation is found in 2018 in China, and huge direct and indirect economic losses are brought. Thus, there is an urgent need to develop a vaccine against ASFV. Previous studies of ASFV vaccines have been reported to focus mainly on inactivated and attenuated vaccines. However, inactivated vaccines do not induce an effective protective response; the biosafety of attenuated vaccines is a major limiting factor in their use, and attenuated strains are not allowed to be studied in China. However, in the case where live virus experiments cannot be performed at this stage, it is necessary to provide a vaccine to elicit an immune response against as many antigens as possible.

There is therefore a need to develop new ASFV vaccines. Potential candidate vaccines are live vector vaccines. The advantages of live vector vaccines compared to other vaccines are represented by: (1) The target tissue or the cell can be actively infected, and the efficiency of the exogenous gene entering the cell is improved; (2) The carrier itself has adjuvant effect, and can induce the production of cytokines and chemokines; (3) most induce long-term immune responses. Advantageously, it is desirable to deliver as much pathogen protein as possible with as few live carriers as possible.

Live vector vaccines refer to cloning a gene encoding a protein of a pathogen into a live viral vector, which is then used to immunize an animal, expressing the protein in the animal, thereby inducing an immune response against the protein. Adenovirus type 5 has many advantages as a vector for expressing african swine fever antigen protein: (1) the adenovirus expression vector is replication defective, can only be produced and prepared in a unique complementary cell line, meanwhile, adenovirus does not need to be integrated into a host cell genome, a target gene is expressed in a free state outside the host cell genome, the possibility of mutation carcinogenesis is low, the genotoxicity is low, and the safety of preparing vaccines is good; (2) the recombinant adenovirus vector can obtain higher titer, is beneficial to large-scale production, and has high factory efficiency and low production cost; (3) the structure, the characteristics and the functions of adenovirus type 5 are deeply studied at present, and adenovirus vectors are easy to replicate and simple to operate, so that the research is facilitated; (4) the genome of the common first-generation adenovirus vector knocks out the 6K gene, can be inserted into the exogenous gene 7.5K, and has larger capacity; (5) adenovirus is relatively stable and can be purified, concentrated and stored.

Some live vector vaccines are reported in the prior art. For example, ASFV p32, p54, p72 and pp62 genes are respectively recombined into a human adenovirus Ad5 vector to carry out cocktail immunity, so that good antigen-specific CTL reaction is obtained; they recombined 7 ASFV antigen genes of ASFV A151R, B119L, B602L, EP R delta PRR, B438L and K205R-A104R into replication defective adenovirus vector, and can induce strong humoral immune response and cell immune response after mixed immunization by "cocktail". However, in "cocktail" type immunization, each ASFV antigen gene must be recombined into a replication-defective adenovirus vector, and therefore a very large number of vectors are required, risking an immune response against the adenovirus vector during immunization. CN108504686a and CN108504687a provide recombinant adenovirus vectors expressing the EP153R and EP402R genes of ASFV, respectively. CN109652449a discloses recombinant adenovirus vectors co-expressed by two antigen genes, EP153R and EP402R, and CN109735567a discloses recombinant adenovirus vectors co-expressed by two antigen genes, EP153R and P54.

However, in order to further enhance the specific immune response to ASF, it is necessary to further increase the antigen gene capacity of the adenovirus vector, and to deliver as many pathogen proteins as possible with as few live vectors to elicit an immune response against as many antigens as possible.

CN110269932a discloses that 5-7 antigen genes of ASFV a104R, A151R, B119L, B602L, CD v, K205R, P49, etc. are fused together based on adenovirus vectors for the preparation of live vector vaccines. However, fusion of multiple antigen genes presents a risk of reduced immunogenicity and potential to cause immune failure, and thus, to increase vaccine activity, it is also necessary to express a completely independent antigen gene on each adenovirus vector.

However, there is no recombinant adenovirus vector coexpressed by four antigen genes in the prior art, and there is no recombinant adenovirus vector coexpressed by four antigen genes F317L, A151R, P and pp62 of ASFV and applied to the development of live vector vaccines.

Disclosure of Invention

In order to solve the problems, the invention provides an African swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector for coexpression of four antigen genes of African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells; the four antigen genes are F317L, A151R, P and pp62 respectively, wherein F317L and A151R are expressed in an E1 region, P34 and pp62 are expressed in an E4 region, and the recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-pp62 with the four antigen genes coexpressed is formed.

Wherein, the recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-pp62 can realize the recombinant adenovirus package by the 293TD37 cell constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the cell strain preservation number of the 293TD37 cell is: CCTCC NO. C201996, which is preserved in China center for type culture Collection.

Common 293 cells contain adenovirus type 5E 1 genes, adenovirus knocked out E1 and E3 can replicate in the cell line, but adenovirus knocked out E4 and E2a genes cannot replicate in the 293 cells.

The 293TD37 cell strain is invented by the group of the invention and has been applied for the invention patent CN201911033247.2, the preservation number is CCTCC NO: C201996 in 5-8 days of 2019 and the classification naming is human embryo kidney transformed cell AY293-TD-37, the cell strain comprises E2a-DBP gene and E4-ORF6/7 gene of adenovirus, and can be used for packaging E2a-DBP gene and E4-gene deficient second-generation adenovirus to form complete infectious second-generation adenovirus particles, compared with first-generation adenovirus, the probability of RCA occurrence of the second-generation adenovirus is greatly reduced, a foundation is laid for preparing live vector vaccine, and the packaging capacity is increased again compared with E2a mutation or E4 deleted second-generation adenovirus due to simultaneous deletion of E2a-DBP and E4 gene, so that the insertion amount of adenovirus vector exogenous gene is further improved, and the method has important significance for enhancing the application level of adenovirus vector.

Wherein F317L, A151R, P, pp62, pAd5LCL3 have the nucleotide sequences shown as Seq ID No.1, seq ID No.2, seq ID No.3, seq ID No.4, and Seq ID No.5 in the sequence Listing, respectively.

The total number of antigen genes of African swine fever virus is 160 or more, and the inventor selects 20 antigen genes with stronger immune effect through a large number of screening experiments, wherein the antigen genes are respectively: p72, B602L, P, P54, CP129R, MGF5L6L, CP312R, MGF110-4L, L8L, I215L, I73R, E146L, EP402R, EP153R, I177L, K205R, F317L, A151R, P, pp62; the 20 antigen genes are divided into five groups according to the size of gene fragments, and 4 antigen genes in each group can be co-expressed in the recombinant adenovirus vector pAd5LCL3 provided by the invention, namely, four antigen genes can be completely and independently expressed in the same vector. The five groups of antigen gene vaccines (comprising 5 recombinant adenovirus vectors pAd5LCL 3) form a complete African swine fever virus vaccine, and a very good immune effect is achieved. The invention selects four antigen genes of F317L, A151R, P and pp62, and can be well matched and assembled in the same recombinant adenovirus vector, thereby completely and independently expressing the four antigen genes.

The research proves that the expression level of the E3 region of the table on the exogenous protein is not high, and the expression level of the antigen genes is higher when the E1 and E4 regions are expressed, so that four antigens can be respectively expressed in the E1 region and the E4 region.

E3 gene is related to replication, so that the gene needs to be knocked out to cause replication defect; e3 functions in relation to the immune escape of adenovirus; knocking out the E3 region can increase the capacity of the adenovirus vector; and enables normal packaging of the adenovirus vector.

On the other hand, the invention also provides a construction method of the recombinant adenovirus vector for coexpression of four antigen genes of African swine fever virus, which comprises the following steps:

1) E1 genes of adenovirus circular vector plasmids are knocked out by using CRISPR/cas9, swaI enzyme cutting sites are introduced, fused fragments are seamlessly cloned with the vector, E3 genes are knocked out by using CRISPR/cas9, and then the adenovirus circular vector plasmids with E1 and E3 genes deleted are obtained by connecting in a seamless cloning mode.

2) And knocking out the E4 gene of the adenovirus circular vector plasmid by using CRISPR/cas9, amplifying by using PCR, introducing an I-sceI enzyme cutting site, and obtaining the adenovirus vector plasmid with the E1, E3 and E4 genes deleted by using a seamless cloning method.

On the basis of knocking out the E1 and E3 genes, knocking out the E4 gene can improve the capacity of the adenovirus vector and reduce the immunogenicity of the adenovirus vector, and simultaneously, the exogenous gene can be inserted into the E4 region and can be expressed in a large quantity at the E4 position without influencing the packaging of the adenovirus vector. The exogenous genes are expressed at the E1 and E4 genes, so that the mutual interference of the expression of a plurality of exogenous genes in the same region can be avoided, the expression is facilitated, meanwhile, unnecessary E4 related genes are reduced, the immunogenicity of adenovirus is reduced, adenovirus can exist in host cells for a long time, and the exogenous genes are expressed for a longer time.

The E4 region gene plays a key role in immunogenicity, and the expression of a large amount of E4 region genes can lead a host to generate stronger immune response and induce antibody generation, which is unfavorable for the long-term expression of target proteins in the host by adenovirus vectors, so that the immunogenicity of the adenovirus vectors can be reduced by knocking out unnecessary genes in the E4 region, and the vectors can be expressed for a longer time.

In order to make E4 gene knocked out completely and facilitate the connection of large carrier plasmid, the CRISPR/cas9 method is used for knocking out the upstream Fiber gene of E4 region and E4 gene, the PCR method is used for amplifying part of Fiber and introducing I-sceI single enzyme cutting site, the Gibson seamless cloning method is used for connecting redundant resected fragments to carrier, and the carrier plasmid with I-sceI single enzyme cutting site introduced by E4 knockout is obtained again. The vector plasmid was linearized using I-sceI to construct a shuttle plasmid for the E4 region, allowing the exogenous gene to recombine into the E4 region and be expressed in large quantities in the E4 region.

3) The E2a gene of the adenovirus circular vector plasmid is knocked out by using CRISPR/cas9, the ORF6/7 expression frame of the E4 region is placed at the sequence position of the knocked-out E2a region, and then a seamless cloning method is used to obtain the adenovirus vector plasmid pAd5LCL3 with the E1, E3, E4 and E2a genes deleted.

The sequence of ORF1 to ORF5 in the E4 region is knocked out, and the E4 promoter, ORF6, ORF7 and polyA sequences are retained and inserted into the E2a position, so that the E4 position can express the foreign gene. The DBP sequence of the E2a region is also knocked out. The adenovirus E2a gene is DNA binding protein, and is related to adenovirus replication, and knocking out the gene does not affect adenovirus structural protein and adenovirus packaging. DBP deletion can prevent or greatly reduce back mutations. The knockout of the E2a and E4 partial sequences increased the vector capacity by about 3 kb.

The research shows that the genes related to adenovirus replication are E1, E2, E3 and E4, and the deletion of the genes does not influence the expression of adenovirus structural proteins and does not prevent the packaging of adenovirus, but can prevent the adenovirus from replication; thus, the construction of these replication-related cell lines enables replication-defective adenovirus vectors that are knocked out of the replication gene to be replication-packaged in their own cell lines. Meanwhile, it is found that the adenovirus with E4 knocked out can be duplicated and packaged as long as ORF6 or ORF3 in the E4 gene of the adenovirus can replace the whole E4 gene. By further sequence analysis of the E4, E2a genes, the E4 gene can be expressed at E2 a. Therefore, the invention carries out sequence analysis on the E4 gene, finds out several basic elements of the promoter, the ORF6/7 and the polyA of the E4, integrates the basic elements into a complete expression frame, constructs the complete expression frame at the sequence position of the knocked-out E2a gene, ensures that the ORF6 and the ORF7 genes are normally expressed, finally obtains the replication defective adenovirus 5 type vector knocked out E1, E3, E4 and E2a, and places the E4 expression frame at the E2a position, and can carry out replication packaging in 293TD37 cells containing DBP sequences.

It was found that E4 gene contains 7 expression frames of ORF1,2,3,4,5,6 and 7, wherein ORF6/7 cannot be deleted, and once deleted, the packaging of adenovirus and the expression of antigen gene are obviously affected, so that ORF6/7 needs to be complemented, and in order to obtain larger vector space, ORF6/7 needs to be expressed at E2a, so that adenovirus vector with larger capacity and better expression effect is prepared.

4) Constructing an adenovirus E1 region shuttle plasmid pS5E1, and respectively connecting the adenovirus E1 region shuttle plasmid pS5E1-F317L-IRES-A151R with F317L, IRES and A151R gene fragments through DNA ligase to construct an African swine fever adenovirus 5 type vector E1 region shuttle plasmid pS5E1-F317L-IRES-A151R.

The shuttle plasmid pS5E1 is firstly connected with a ribosome entry site IRES fragment to obtain a pS5E1-IRES vector, then connected with an F317L fragment to obtain pS5E1-F317L-IRES, and the pS5E1-F317L-IRES is subjected to enzyme digestion and connection with an A151R fragment to obtain an E1 region shuttle plasmid pS5E1-F317L-IRES-A151R, and colony PCR verification is carried out.

5) Construction of adenovirus E4 region shuttle plasmid pS5E4-EGFP, obtaining P34-2A-pp62 gene fragment by fusion PCR technology from P34, 2A, pp gene, cutting the shuttle plasmid pS5E4-EGFP, knocking out EGFP, connecting with P34-2A-pp62 by DNA ligase, constructing African swine fever adenovirus 5 type vector E4 region plasmid pS5E4-P34-2A-pp62.

The EGFP was replaced with pS5E4-P34-2A-pp62 by cleavage of the E4 shuttle plasmid pS5E 4-EGFP. P34-2A-pp62 is P34, pp62 is linked by a 2A sequence. The addition of the 2A sequence is for protein cleavage, the EF1 alpha promoter is expressed in series, and the 2A sequence is further cleaved to obtain the P34 and pp62 antigens.

6) The shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3 are subjected to homologous recombination to obtain the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R.

7) The shuttle plasmid pS5E4-P34-2A-pp62 and adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R are subjected to homologous recombination to obtain four recombinant adenovirus vectors pAd5LCL3-F317L-A151R-P34-pp62 with coexpression of antigen genes, and pAd5LCL3-F317L-A151R-P34-pp62 has a nucleotide sequence shown as a sequence table of Seq ID No. 6.

Shuttle plasmids are commonly adopted in the construction of the existing adenovirus vectors, and a single enzyme cutting site needs to be searched. The invention creatively adopts CRISPR/cas9 to construct a recombinant adenovirus vector, selects proper E1, E3, E4 and E2a knockout sites through comparison, selects CRISPR sites according to the number of knocked-out gene bases of the positions of E1, E3, E4 and E2a sequences, and designs the optimal gRNA, thereby completing the construction of the recombinant adenovirus vector.

Further, the adenovirus circular vector plasmid in the step 1) is derived from amplifying wild type human adenovirus type 5 virus in A549 cells, collecting and concentrating virus liquid, extracting adenovirus type 5 genome by adopting a HirtVirual DNA Extract method, and constructing linear adenovirus type 5 genome into circular adenovirus circular vector plasmid by adopting a cosmid method.

Further, the ORF6/7 expression cassette gene in the step 3) has a nucleotide sequence shown as Seq ID No.7 in the sequence table; the IRES in the step 4) has a nucleotide sequence shown as a Seq ID No.8 in a sequence table; the 2A in the step 5) has a nucleotide sequence shown as a Seq ID No.9 in a sequence table.

Further, the shuttle plasmid pS5E1 skeleton in the step 4) adopts basic elements such as pucorigin, amp and the like, the partial sequence of ITR of the left arm of Ad5, the partial sequences of PIX and PIVa2 of the right arm, and CMV-MCS SV40 early polyA; the skeleton of the E4 region shuttle plasmid pS5E4-EGFP adopts basic elements such as puc origin, amp and the like, the Ad5E4 region left arm ITR sequence, the right arm partial fiber gene sequence and the EF1 alpha-EGFP-HBV polyA gene; wherein, the basic elements such as pucorigin, amp and the like have nucleotide sequences shown as SEQ ID NO.10 in the sequence table, and the EF1 alpha-EGFP-HBV polyA gene has nucleotide sequences shown as SEQ ID NO.11 in the sequence table.

The backbone of the shuttle plasmid pS5E1 is synthesized by Beijing Bomaide gene technology Co., ltd, and the synthesis adopts the basic elements (2796 bp) of puc origin, amp and the like, the partial sequence of the ITR of the left arm of Ad5 (400 bp), the partial sequences of the PIX and PIVa2 of the right arm (2100 bp), and the SV40 early polyA (160 bp) of CMV-MCS (944 bp). After PCR amplification and gene fragment purification, carrying out seamless cloning connection, converting a connection product into competent cells, coating an ampicillin resistance plate, and selecting positive clones for enzyme digestion verification after culture to obtain the adenovirus E1 region shuttle plasmid pS5E1.

The skeleton of the shuttle plasmid pS5E4 adopts basic elements such as puc origin, amp and the like, the left arm ITR sequence (370 bp) of the Ad5E4 region, the right arm fiber gene sequence (1746 bp) and the EF1 alpha-EGFP-HBV polyA gene. And (3) carrying out PCR amplification and gene fragment purification, carrying out seamless cloning connection, converting a connection product into competent cells, coating an ampicillin resistance plate, and selecting positive clones for enzyme digestion verification after culturing to obtain adenovirus E4 region shuttle plasmid pS5E4-EGFP.

Further, step 6) homologous recombination of the shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3 is carried out by enzyme digestion of the shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3 by PacI and SwaI, dephosphorylation of enzyme digestion products, gel recovery of vectors and fragments by OMEGA Ultra-Sep Gel Extraction Kit, plating of transformed products, picking of colonies, and XhoI enzyme digestion verification.

Further, step 7) homologous recombination of the shuttle plasmid pS5E4-P34-2A-pp62 with the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R was performed by enzyme digestion of the shuttle plasmid pS5E4-P34-2A-pp62 with the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R by PacI and I-sceI, dephosphorylation of the enzyme digestion products, gel recovery of the vector and fragment by OMEGA Ultra-Sep Gel Extraction Kit, plating of the transformed products, picking colonies, and XhoI enzyme digestion verification.

In another aspect, the present invention provides a method for packaging a recombinant adenovirus vector, characterized in that the recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-pp62 of claim 1 or 2 is digested with PacI, and the linearized plasmid is used for transfection; 293TD37 cells constructed from pcDNA3.1+ (hyg) -ORF6-IRES-DBP were transfected and cell suspensions were collected to achieve recombinant adenovirus packaging. The 293TD37 cell strain is preserved in China center for type culture collection (China center for type culture collection) on 5 and 8 days, and has the preservation number of CCTCC NO: C201996, and is classified and named as human embryo kidney transformed cells AY293-TD37, and the cell strain comprises adenovirus type 5E 2a genes and E4-ORF6/7 genes, is obtained by genetically engineering HEK293 cells, and can be used for packaging second-generation recombinant adenovirus with deleted E2a genes and E4 genes to form complete second-generation adenovirus particles with infectivity.

Further, the packaging method of the recombinant adenovirus vector is prepared by the following steps:

1) The pAd5LCL3-F317L-A151R-P34-pp62 co-expressed recombinant adenovirus vector is digested with PacI, and the linearized plasmid is used for transfection; transfecting 293TD37 cells with PEI transfection reagent;

2) Transfected 293TD37 cells were incubated at 37℃with 5% CO ₂ Culturing in an incubator for 72-96 hours, and collecting cell suspension, namely TP0 adenovirus;

3) TP0 adenovirus infection 293TD37 cells at 37 ℃,5% CO ₂ Culturing in incubator for 72 hr, collecting fine powderCell suspension, namely TP1 adenovirus;

4) Repeating the step 3), and collecting cell suspension, namely TP2 generation adenovirus;

5) The inoculation is continued until the cells are diseased.

On the other hand, the invention also provides the application of 293TD37 cells in packaging recombinant adenovirus vectors co-expressed by four antigen genes of African swine fever virus, which is characterized in that the four antigen genes are F317L, A151R, P and pp62 respectively, wherein F317L and A151R are expressed in an E1 region, P34 and pp62 are expressed in an E4 region, and the recombinant adenovirus vectors pAd5LCL3-F317L-A151R-P34-pp62 co-expressed by the four antigen genes are formed; wherein, 293TD37 cells are constructed by E2a genes, and the cell strain preservation number is: CCTCC NO. C201996, which is preserved in China center for type culture Collection.

The invention provides an African swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells. Wherein, four antigen genes of African swine fever virus are F317L, A151R, P and pp62 respectively. The construction of recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus mainly comprises the steps of knocking out E1, E3, E2a and E4 genes of the adenovirus vector through CRISPR/cas9, constructing shuttle plasmids of E1 and E4 regions, and respectively expressing F317L and A151R, P and pp62 genes, thereby obtaining a brand-new adenovirus vector. The beneficial effects of the invention are mainly as follows:

1) Provides a brand-new construction method of adenovirus type 5 vector CRISPR/cas9, selects the optimal knockout site, designs the optimal gRNA, and avoids the need of finding a single enzyme cleavage site by knocking out shuttle plasmid for constructing the vector in the past.

2) Because the E4 region gene plays a key role in immunogenicity, the expression of a large amount of E4 region genes can lead a host to generate stronger immune response, induce antibody generation and be unfavorable for the long-term expression of target proteins in the host by the adenovirus vector, the invention can reduce the immunogenicity of the adenovirus vector by knocking out unnecessary genes in the E4 region, so that the vector can be expressed in a longer time.

3) The invention knocks out the sequence of ORF 1-ORF 5 of the E4 region, retains the E4promoter, ORF6, ORF7 and polyA sequences, and inserts the sequences into the E2a position, so that the E4 position can express exogenous genes.

4) The invention further knocks out DBP (E2 a) sequences, and DBP deletion can prevent or greatly reduce back mutation. (4) The knockout of E2a and E4 partial sequences increased the vector capacity by about 3kb relative to a generation of vectors.

5) E2a and E4 of adenovirus vector are knocked out, E4promoter-ORF6/7-polyA is placed in E2a region, so that E2a complementary cell line can be used for packaging, simultaneously, exogenous genes can be expressed in E1 and E4 regions simultaneously without mutual interference, and the adenovirus vaccine can be saved in a complementary cell line-293 TD37 cell line constructed by our company, and the cell line can express DBP protein permanently.

6) The invention constructs shuttle plasmids of E1 and E4 regions, which are used for expressing exogenous genes of the E1 and E4 regions.

7) The recombinant adenovirus prepared by the 293TD37 cell line packaging has higher titer.

Based on the principle, the invention can greatly improve the capacity of the vaccine of the adenovirus vector, and the mode of simultaneously expressing four independent antigens of African swine fever on one adenovirus vector is used for enhancing the specific immune response to the African swine fever virus, so that the domestic pig can obtain better immune protection.

Drawings

FIG. 1 is a schematic representation of the cleavage site and PAM site of Ad5-E4-up-gRNA of example 2

FIG. 2 is a schematic representation of the cleavage site and PAM site of Ad5-E4-down-gRNA of example 2

FIG. 3 shows the results of the "double digestion" vector plasmid electrophoresis of the Ad5-E4-up-gRNA, ad5-E4-down-gRNA and cas9 of example 2, wherein lane 1 is Ad5-E4-up-gRNA, ad5-E4-down-gRNA and cas9, and M is Marker

FIG. 4 shows the result of electrophoresis detection of amplification of a fiber and ITR fragment containing partial knockdown in example 2, wherein lane 1 shows the result of amplification of a fiber partial fragment, lane 2 shows the result of amplification of an ITR partial fragment, and M shows the Marker

FIG. 5 shows the result of electrophoresis detection of the Fiber-ITR fusion fragment of example 2, wherein lane 1 is the Fiber-ITR fusion fragment and M is Marker

FIG. 6 shows the result of colony PCR-based electrophoresis verification in example 2, wherein lanes 1-24 are colonies and M is Marker

FIG. 7 shows the result of an electrophoresis test of the BamHI and XhoI cleavage test of the positive clone colony plasmid of FIG. 6 in example 2, wherein 1-5 is BamHI cleavage, 6-10 is XhoI cleavage, 1, 10 is pAd5 control (true E4 gene), and M is Marker

FIG. 8 is a schematic representation of 100k-gRNA cleavage sites and PAM sites of example 3

FIG. 9 is a schematic representation of the cleavage site and PAM site of the protease-gRNA of example 3

FIG. 10 shows the results of electrophoresis of 100k-gRNA, protease-gRNA and cas9 "double digested" vector plasmid of example 3, lane 1 is 100k-gRNA, protease-gRNA and cas9 "double digested" vector plasmid, and M is Marker

FIG. 11 shows the results of PCR amplification and electrophoresis of 100k, E4ORF6/7 expression cassettes and protease of example 3, wherein lane 1 is the E4ORF6/7 expression cassette, lane 2 is 100k and M is Marker

FIG. 12 shows the results of fusion PCR detection of 100k, E4ORF6/7 expression cassettes, and Protease fragments of example 3, wherein lane 1 is the fragment 100k, E4ORF6/7 expression cassette, and Protease fusion PCR product, and M is Marker

FIG. 13 shows the result of colony PCR-based electrophoresis verification in example 3, wherein lanes 1-24 are colonies and M is Marker

FIG. 14 shows the result of an electrophoresis test performed by XhoI digestion of colonies of positive clones 9, 18, 21 and 24 of FIG. 13 in example 3, wherein lane 1 is the XhoI digestion of positive clone 9, lane 2 is the XhoI digestion of positive clone 18, lane 3 is the XhoI digestion of positive clone 21, lane 4 is the XhoI digestion of positive clone 24, lane 5 is the XhoI digestion of control plasmid pAd5LCL3, and M is Marker

FIG. 15 shows the results of an electrophoresis test for the amplification of CMV-MCS and SV40 earlypolyA fragment of example 4, wherein lane 1 is CMV-MCS fragment, lane 2 is SV40 earlypolyA fragment and M is 2000Marker

FIG. 16 shows the results of an electrophoresis detection of CMV-MCS-SV40 earlypolyA, PUC, ad right arm and Ad5 left arm amplification of example 4, wherein lane 1 is CMV-MCS-SV40 earlypolyA fusion fragment, lane 2 is PUC, lane 3 is Ad5 right arm, lane 4 is Ad5 left arm, and M is 2000Marker

FIG. 17 shows the results of PCR-validated electrophoresis assays of four fragment-ligation product-transformed competent cell colonies of pS5E1 backbone, ad5 left arm, ad5 right arm, CMV-MCS-SV40 earlypolyA of example 4, wherein lanes 1-6 are colonies and M is Marker

FIG. 18 shows the result of electrophoresis test performed by selecting the colonies 1-6 of FIG. 17 in example 4, wherein the left 1-6 is plasmid pS5E1NcoI single cut, the right 1-6 is plasmid pS5E1 PacI single cut, and M is 15000bp Marker

FIG. 19 shows the result of electrophoresis of PCR amplification of IRES fragment of example 4, wherein lanes 1 and 2 are the products of PCR amplification of IRES fragment, M is 15000bp Marker

FIG. 20 shows the results of the cleavage electrophoresis of the fragment IRES and pS5E1 vector of example 4, in which lane 1 is the cleavage of the fragments IRES EcoRV and NotI, lane 2 is the cleavage of the fragments pS5E1 EcoRV and NotI, and M is 15000bp Marker

FIG. 21 shows the result of PCR-validated electrophoresis of competent cell colonies transformed with the ligation product of pS5E1 vector and IRES fragment of example 4, wherein numbers 1-9 are colonies, and M is Marker

FIG. 22 shows the result of the digestion and electrophoresis of the pS5E1-IRES plasmids NotI and EcoRV of example 4, the plasmids 2 and 6 of FIG. 21 were selected for plasmid extraction, and digestion and verification, wherein the plasmids NotI and EcoRV of lane No. 2 were identified by digestion and verification, and the plasmids NotI and EcoRV of lane No. 6 were identified by digestion and verification

FIG. 23 shows the result of the electrophoresis of the cleavage of the F317L and pS5E1-IRES vector of example 4, wherein lane 1 is pS5E1-IRES, bamHI and EcorV double-digested, lane 2 is fragment F317L, bamHI and EcoRV double-digested, and M is 15000bp Marker

FIG. 24 is a PCR-validated electrophoresis of competent cell colonies transformed with the ligation product of F317L and pS5E1-IRES of example 4, wherein numbers 1-14 are colonies, and M is a 2000bp Marker

FIG. 25 shows the result of the plasmid restriction enzyme electrophoresis of pS5E1-F317L-IRES in example 4, the colonies 9 and 10 in FIG. 24 were selected for plasmid extraction, the plasmid restriction enzyme assay of lane 1, the plasmid restriction enzyme assay of lane 9, and the Marker M

FIG. 26 shows the result of electrophoresis detection of the cleavage products of the fragment A151R and pS5E1-F317L-IRES vector of example 4, wherein lane 1 is the cleavage of pS5E1-F317L-IRES, notI and XhoI; lanes 2 and 3 are A151R fragment, notI and XhoI cut, M is 15000bp Marker

FIG. 27 shows the result of PCR-validated electrophoresis of competent cell colonies transformed with the pS5E1-F317L-IRES vector and the A151R ligation product of example 4, wherein numbers 1-24 are colonies, and M is 2000bp Marker

FIG. 28 shows the result of the plasmid pS5E1-F317L-IRES-A151R digestion assay of example 4, wherein lanes 1, 2, 3 and 4 are identified by digestion with BamHI and EcoRV, and lanes 4, 15, 23 and 24 of FIG. 27, and M is a 2000bp Marker

FIG. 29 shows the results of electrophoresis of the amplification of the pS5E4-EGFP shuttle plasmid left arm, pS5E4-EGFP shuttle plasmid right arm, EF 1. Alpha. -EGFP-HBV, pS5E4-EGFP shuttle plasmid backbone of example 5, wherein lane 1 is the pS5E4-EGFP shuttle plasmid left arm, lane 2 is the pS5E4-EGFP shuttle plasmid right arm, lane 3 is EF 1. Alpha. -EGFP-HBV, lane 4 is the pS5E4-EGFP shuttle plasmid backbone, M is 2000Marker

FIG. 30 shows the results of PCR-validated electrophoresis assays of four fragment ligation products transformed competent cell colonies of the pS5E4-EGFP shuttle plasmid left arm, pS5E4-EGFP shuttle plasmid right arm, EF 1. Alpha. -EGFP-HBV, pS5E4-EGFP shuttle plasmid backbone of example 5, wherein lanes 1-20 are colonies and M is Marker

FIG. 31 shows the result of the electrophoresis test of colony Nos. 3, 4, 5 and 6 of FIG. 30 of example 5, in which 1-4 are 3, 4, 5 and 6 positive clones PacI single cut, 5-8 are 3, 4, 5 and 6 positive clones HindIII single cut, M1 and M3 are 15000bp Marker,M2 and 2000bp Marker

FIG. 32 shows the result of the electrophoresis detection of the PCR products of the target fragments P34, 2A, pp62 of example 4, wherein lane 1 is fragment P34;2 is fragment 2A;3 is fragment pp62, M is 15000bp Marker

FIG. 33 shows the result of electrophoresis of the fusion PCR amplified P34-2A fragment of example 5, wherein lane 1 is the P34-2A fragment and M is the 2000bp Marker

FIG. 34 shows the result of the digestion electrophoresis of the fragment pS5E4-EGFP vector of example 5, in which lane 1 is the recovery of the double digestion with BamHI and XhoI fragments pS5E4-EGFP, M15000 bp Marker

FIG. 35 shows the result of PCR-validated electrophoresis of competent cell colonies obtained by seamless cloning of the pS5E4-EGFP gel recovery vector and the P34-2A fragment, pp62, of example 5, wherein the numbers 1-12 are colonies and M is a 15000bp Marker

FIG. 36 is the result of an electrophoresis test for BamHI and XhoI double digestion test of the extracted plasmid of positive clone No. 1, 2, 9 and 11 of FIG. 34 in example 5, wherein lanes 1, 2, 3 and 4 are respectively identified as BamHI and XhoI double digestion test of positive clone No. 1, 2, 9 and 11, and M is 15000bp Marker

FIG. 37 shows the result of agarose gel verification electrophoresis of pAd5LCL3 and pS5E1-F317L-IRES-A151R of example 6, wherein lane 1 is pAd5LCL3, lane 2 is pS5E1-F317L-IRES-A151R, and M is 15000bp Marker

FIG. 38 shows the result of the electrophoresis test of the plasmid pAd5LCL3-F317L-IRES-A151R obtained by homologous recombination of the shuttle plasmid pS5E1-F317L-IRES-A151R of example 6 and the adenovirus vector plasmid pAd5LCL3, wherein lanes 1-7 are pAd5LCL3-F317L-IRES-A151R and M is 15000bp Marker

FIG. 39 is a schematic diagram showing the result of performing restriction enzyme digestion on plasmid XhoI obtained by picking the positive plasmid No. 3 of FIG. 38 to competent cells, extracting the plasmid, wherein lanes 1 and 2 are pAd5LCL3-P72-IRES-B602L, and M is 15000bp Marker

FIG. 40 shows the result of agarose gel-verification electrophoresis of shuttle plasmid pS5E4-P34-2A-pp62 and adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R, wherein lane 1 is pS5E4-P34-2A-pp62, lane 2 is pAd5LCL3-F317L-IRES-A151R, M is 15000bp Marker

FIG. 41 shows the result of the electrophoresis test of the recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-pp62 plasmid obtained by homologous recombination of the shuttle plasmid pS5E4-P34-2A-pp62 and the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R of example 6, wherein lanes 1-4 are plasmids and M is a 15000bp Marker

FIG. 42 is a schematic diagram showing the result of performing restriction enzyme test on plasmid XhoI in lane 2, pAd5LCL3-F317L-A151R-P34-pp62 plasmid XhoI, M15000 bp Marker, obtained by picking the positive plasmid No. 2 of FIG. 41 of example 6 and transforming it into competent cells

FIG. 43 is a photograph of 293TD37 cells taken by TP0 of example 7

FIG. 44 is a photograph of 293TD37 cells taken by TP1 of example 7

FIG. 45 is a photograph of a 293TD37 cell derived from TP2 of example 7

FIG. 46 is a photograph of 293TD37 cells taken by TP3 of example 7

FIG. 47 is a photograph of a TP 4-induced 293TD37 cytopathic effect of example 7

FIG. 48 is a schematic diagram showing the results of Western Blot to detect pp62 protein in African swine fever multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 of example 11

FIG. 49 is a vector map of pAd5LCL3

FIG. 50 is a vector map of pS5E1

FIG. 51 is a vector map of pS5E1-F317L-IRES-A151R

FIG. 52 is a vector map of pS5E4-EGFP

FIG. 53 is a vector map of pS5E4-P34-2A-pp62

FIG. 54 is a vector map of pAd5LCL3-F317L-A151R-P34-pp62

FIG. 55 is a schematic diagram showing the results of ELISA method of example 12 for detecting IgG antibody titer against African swine fever target protein pp62 in serum

FIG. 56 is a schematic representation of the results of a CD8+ T cell reaction induced by pAd5LCL3-F317L-A151R-P34-pp62 of example 12

FIG. 57 is a schematic diagram showing the results of a CD4+ T cell reaction induced by pAd5LCL3-F317L-A151R-P34-pp62 of example 12

FIG. 58 is a representation of the cellular immune response of example 12 after intramuscular injection of pAd5LCL3-F317L-A151R-P34-pp62

FIG. 59 is a schematic representation of the immune response of a blank in example 12

Detailed Description

The following description of the preferred embodiments of the present invention is further detailed in conjunction with the accompanying drawings, and it should be noted that the embodiments described below are intended to facilitate an understanding of the present invention, and are not intended to limit the invention in any way.

EXAMPLE 1 construction of adenovirus vector plasmids deleted for E1 and E3 genes

In A549 cellsWild type adenovirus type 5 (/ -for medium amplification)>VR-1516, gene sequence AC_ 000008.1), collecting and concentrating the virus solution, extracting the adenovirus genome by HirtVirual DNA Extract method, constructing the linear hAD5 gene into circular supercos-Ad5 vector plasmid by cosmid method, excision of hAD5 adenovirus E1 region by CRISPR/cas9, designing gRNA as follows:

hAD5-E1 upstream gRNA:

GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E1 downstream gRNA:

GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

designing gRNA sites on the upstream and downstream of the hAD 5E 1 region, cutting, recovering a large fragment vector, designing primers, respectively inserting ITR and PIX sequences on the upstream and downstream by fusion PCR, introducing SwaI enzyme cutting sites, then performing seamless cloning on the fused fragments and the vector to obtain an E1 knocked-out supercos-Ad5 delta E1 adenovirus vector, then performing E3 region excision on the supercos-Ad5 delta E1 plasmid, and designing gRNA as follows:

hAD5-E3 upstream gRNA:

GCGGGACAUUUCAGAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E3 downstream gRNA:

GUAAGGGUACUGCUAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

gRNA sites are designed at the upstream and downstream of the hAD 5E 3 region, large fragment vectors are recovered after cutting, primers are designed, fusion PCR is carried out on Fiber with excessive excision of the upstream and downstream of E3 and pVIII sequences, a seamless cloning mode is used for connection, E1 and E3 genes are deleted, and adenovirus vector plasmid pAd5 with SwaI enzyme cutting sites is introduced.

EXAMPLE 2 construction of adenovirus vector plasmid pAd5ΔE4 with deletion of E1, E3 and E4 genes

The vector plasmid pAd5 obtained in example 1, from which the E1 and E3 genes have been knocked out, was used to further knock out the E4 gene, to increase the capacity of the adenovirus vector, to reduce the immunogenicity thereof, to amplify a portion of the fiber and introduce NdeI single cleavage sites by PCR, to join the superfluous excised fragments to the vector by the Gibson seamless cloning method, to obtain the vector plasmid pAd5ΔE4 from which the E1, E3 and E4 genes have been deleted and to which SwaI and I-sceI cleavage sites have been introduced.

1. Selection of target sequence of target gene E4 CRISPR

1) Selection of E4 Gene upstream fiber Gene CRISPR target sequence

Using the Semer flying GeneArt ^TM CRISPR Search and Design tool (thermosusher. Com/crisprdesign) software, the first 400 bases of the fiber gene were entered and the software automatically analyzed the 400 base sequence, providing 6 potential CRISPR target sequences. Considering the length of the E4 gene knockout sequence and the requirement of constructing a live vector, GCTACTAAACAATTCCTTCC was selected as a targeting sequence, and the finally obtained gRNA was named Ad5-E4-up-gRNA, and the cleavage site and PAM site are shown in FIG. 1.

2) E4 downstream non-coding sequence CRISPR target sequence selection

Using the Semer flying GeneArt ^TM CRISPR Search and Design tool (thermosusher. Com/crisprdesign) software, 300 bases downstream of E4 were entered and the software was automatically analyzed to provide 6 potential CRISPR target sequences, AGGTTCGCGTGCGGTTTTCT was selected as the targeting sequence, and the resulting gRNA was designated Ad5-E4-down-gRNA, cleavage site and PAM site as shown in FIG. 2.

2. DNA amplification of Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

1) DNA template design of Ad5-E4-up-gRNA

5’-TAATACGACTCACTATAGTACTAAACAATTCCTTCCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

2) DNA template design of Ad5-E4-Down-gRNA

5’-TAATACGACTCACTATAGGTTCGCGTGCGGTTTTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

3. Designing upstream and downstream primers of DNA templates for amplifying Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

The upstream and downstream primers were designed to amplify the DNA template of Ad5-E4-up-gRNA and the DNA template of Ad5-E4-down-gRNA by PCR, respectively, using GeneArt ^TM Precision gRNA Synthesis Kit kit for amplification.

Primer design:

Ad5-E4-up-gRNA-Forward：TAATACGACTCACTATAGTACTAAACAATTCCT

Ad5-E4-up-gRNA-Reverse：TTCTAGCTCTAAAACGGAAGGAATTGTTTAGTA

Ad5-E4-down-gRNA-Forward：TAATACGACTCACTATAGGTTCGCGTGCGGTTT

Ad5-E4-down-gRNA-Reverse：TTCTAGCTCTAAAACAGAAAACCGCACGCGAAC

4. DNA templates for amplifying Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

1) Preparation of 0.3. Mu.M Ad5-E4-up-gRNA-Forward/Reverse primer mix working solution

mu.M of Ad5-E4-up-gRNA-Forward primer 3. Mu.l, 10. Mu.M of Ad5-E4-up-gRNA-Reverse primer 3. Mu.l, make up water to 100. Mu.l.

2) Preparation of 0.3. Mu.M Ad5-E4-Down-gRNA-Forward/Reverse primer mix working solution

mu.M of Ad5-E4-down-gRNA-Forward primer 3. Mu.l, 10. Mu.M of Ad5-E4-down-gRNA-Reverse primer 3. Mu.l, make up water to 100. Mu.l.

3) PCR reaction system

PCR reaction for DNA template amplification of Ad5-E4-up-gRNAThe method comprises the following steps: phusion ^TM High-Fidelity PCR Master Mix (2X) 12.5. Mu.l, tracr fragment+T7 Primer Mix 1. Mu.l, 0.3. Mu.M Ad5-E4-up-gRNA-Forward/Reverse Primer Mix working solution 1. Mu.l, and make up water to 25. Mu.l.

The PCR reaction system for amplifying the DNA template of the Ad5-E4-down-gRNA is as follows: phusion ^TM High-Fidelity PCR Master Mix (2X) 12.5. Mu.l, tracr fragment+T7 Primer Mix 1. Mu.l, 0.3. Mu.M Ad5-E4-down-gRNA-Forward/Reverse Primer Mix 1. Mu.l, and make up to 25. Mu.l.

4) PCR program

Initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 55 ℃,15sec,32 cycles; extending at 72 ℃,1min,1 cycle; the temperature was kept at 4 ℃.

5. In vitro transcription to obtain Ad5-E4-up-gRNA and Ad5-E4-down-gRNA

Using Transcriptaid ^TM The Enzyme Mix carries out in vitro transcription on the template DNA to obtain Ad5-E4-up-gRNA and Ad5-E4-down-gRNA.

The reaction system for obtaining Ad5-E4-up-gRNA through in vitro transcription is as follows: NTP mix 8. Mu.l, E1A-gRNA DNA template 6. Mu.l, 5 XTranscriptaid ^TM Reaction Buffer 4μl，TranscriptAid ^TM Enzyme Mix 2 μl. After 4 hours incubation at 37℃1. Mu.l DNase I was added and incubated for 15 minutes at 37 ℃.

The reaction system for obtaining Ad5-E4-down-gRNA through in vitro transcription is as follows: NTP mix 8. Mu.l, E1B-gRNA DNA template 6. Mu.l, 5 XTranscriptaid ^TM Reaction Buffer 4μl，TranscriptAid ^TM Enzyme Mix 2 μl. After 4 hours incubation at 37℃1. Mu.l DNase I was added and incubated for 15 minutes at 37 ℃.

In vitro transcription to obtain Ad5-E4-up-gRNA, ad5-E4-down-gRNA

6. Purification of in vitro transcription products

1) Supplementing the transcribed reaction system to 200 μl with nuclease-free water;

2) Adding 100 μl of Binding buffer, and mixing thoroughly;

3) Adding 300 μl ethanol (> 96%) and mixing thoroughly;

4) Transferring the mixture to the Gene JET ^TM RNA Purification Micro Column, centrifuging at 14000 Xg for 30-60 s, and discarding the lower solution;

5) 700. Mu.l of Wash Buffer1 (13 mL of ethanol) was added, and the mixture was centrifuged at 14000 Xg for 30-60 seconds, and the lower solution was discarded;

6) 700. Mu.l of Wash Buffer2 (30 mL of ethanol) was added, and the mixture was centrifuged at 14000 Xg for 30-60 seconds, and the lower solution was discarded, and the above steps were repeated once;

7) 14000 Xg air was taken for 60 seconds, all eluent was completely removed, and the empty tube was placed in a 1.5mL collection tube;

8) 10. Mu.l of nuclease-free water was added to the center of the column and the gRNA was collected by centrifugation at 14000 Xg for 60 seconds.

Wherein, wash Buffer1 and Wash Buffer2 are Transcriptaid ^TM The RNA sequences of the Ad5-E4-up-gRNA and Ad5-E4-down-gRNA obtained by transcription of the reagents in the Enzyme Mix kit are shown below:

Ad5-E4-up-gRNA:GUACUAAACAAUUCCUUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCC GUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

Ad5-E4-down-gRNA:GGUUCGCGUGCGGUUUUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCC GUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

7. CRISPR/Cas9 "restriction enzyme" method "

The vector plasmid was obtained using the two digestion examples of Ad5-E4-up-gRNA, ad5-E4-down-gRNA and Cas9, with a reaction system of 3. Mu.g of Cas9 protein, 6. Mu.g of Ad5-E4-up-gRNA, 6. Mu.g of Ad5-E4-down-gRNA, 3. Mu.g of pAd5-REBP vector plasmid, 3.1. Mu.l of NEB buffer, and additional water to 50. Mu.l.

The cleavage reaction was incubated overnight at 37 ℃. The agarose gel verification is carried out by taking 3 μl of sample, and the electrophoresis chart of the experimental result is shown in FIG. 3. Lane 1 shows the results of the Ad5-E4-up-gRNA, ad5-E4-down-gRNA and cas9 "double digestion" pAd5 vector plasmids, with fragments of the target size of 2500bp-5000bp, and the correct digestion results were seen. The vector was purified using the Axygen gel recovery kit.

8. Obtaining a fiber containing partial knockdown, ITR fragments and introducing an I-SceI cleavage site, knocking down, amplifying the fiber fragments and introducing the I-SceI cleavage site using a primer containing the knockdown partial fiber

1) Amplification of fragment fiber

Amplification primers:

Fiber-RH-F：GAGTGCTACTAAACAATTCCTTCCTGGACCCAGAATATTGG

Fiber-ISceI-ITR-R：TGGTGTTATTACCCTGTTATCCCTAGCAATTGAAAAATAAACACGTTG

the amplification sequence is as follows:

TGGTGTTATTACCCTGTTATCCCTAGCAATTGAAAAATAAACACGTTGAAACATAACACAAACGATTCTTTATTCTTGGGCAATGTATGAAAAAGTGTAAGAGGATGTGGCAAATATTTCATTAATGTAGTTGTGGCCAGACCAGTCCCATGAAAATGACATAGAGTATGCACTTGGAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTAATGGTTAGTGTTACAGGTTTAGTTTTGTCTCCGTTTAAGTAAACTTGACTGACAATGTTACTTTTGGCAGTTTTACCGTGAGATTTTGGATAAGCTGATAGGTTAGGCATAAATCCAACAGCGTTTGTATAGGCTGTGCCTTCAGTAAGATCTCCATTTCTAAAGTTCCAATATTCTGGGTCCAGGAAGGAATTGTTTAGTAGCACTC

the amplification system is as follows: 10. Mu.M Fiber-RH-F primer 1. Mu.l; 10. Mu.M Fiber-ISceI-ITR-R primer 1. Mu.l; template pAd5 (100 ng/. Mu.l) 0.5. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending the temperature to 72 ℃,10sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. As shown in FIG. 4, lane 1 shows the result of amplification of a portion of the fiber fragment, M is 2000Marker, and the result of amplification is correct, and the fragment was purified using the Axygen gel recovery kit.

2) Amplification of ITR fragments

Amplification primers:

ISceI-ITR-F：TAGGGATAACAGGGTAATAACACCACTCGACACGGCAC

ITR-RH-R：GGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTT

the amplification sequence is as follows:

GGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTTTAACCGTTACGTCATTTTTTAGTCCTATATATACTCGCTCTGCACTTGGCCCTTTTTTACACTGTGACTGATTGAGCTGGTGCCGTGTCGAGTGGTGTTATTACCCTGTTATCCCTA

the amplification system is as follows: 1 μl of 10 μM ISceI-ITR-F primer; 1 μl of 10 μM ITR-RH-R primer; template pAd5 (100 ng/. Mu.l) 0.5. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending the temperature to 72 ℃,10sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. As shown in FIG. 4, lane 2 shows the amplification result of the ITR partial fragment, M is 2000Marker, and the amplification result is correct, and the fragment was purified using the Axygen gel recovery kit.

3) Fusion PCR to obtain Fiber-ITR fusion fragment

The amplification system is as follows: 10. Mu.M Fiber-RH-F primer 1. Mu.l, 10. Mu.M Fiber-ISceI-ITR-R primer 1. Mu.l, template pAd5 (100 ng/. Mu.l) 0.5. Mu.l, Q5 Hi-Fi enzyme 25. Mu.l, and water to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending for 72 ℃,20sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. As shown in FIG. 5, lane 1 shows the fusion fragment of Fiber-ITR, M is 2000Marker, and the fusion result is correct. Fragments were purified using the Axygen gel recovery kit.

9. Carrier connection

The Fiber-ITR fragment was ligated to the E4 knock-out vector plasmid using Gibson of NEB, the ligation system was as follows: gel recovery product vector plasmid fragment 100ng, gel recovery product fiber-ITR fragment 50ng, gibson premix 10. Mu.l, and water make up to 20. Mu.l. Incubate at 50℃for 40 min.

10. Transformation

Taking out the plate of the kana resistance culture medium, putting the prepared NEB 10 beta competent cells on ice to melt, adding 10 mu l of a connecting product, gently sucking and beating uniformly by a liquid-transfering device, and standing on ice for 30 minutes; the tube was placed in a 42℃water bath, heat-shocked for 90 seconds, and transformants were selected by means of kanagacillin resistance.

11. Colony PCR for transformant screening

Colony PCR verification was performed on the transformants using PCR amplification.

Downstream primers for colony PCR were designed

E4-cexu-F：AGTGACGATTTGAGGAAGTTG

E4-cexu-R：TCAATTGCAGAAAATTTCAAGTC

The reaction system is as follows: mu. M E4-cexu-F primer 1. Mu.l, 10. Mu. M E4-cexu-R primer 1. Mu.l, Q5 high-fidelity enzyme 10. Mu.l, and water to 20. Mu.l were added, and monoclonal colonies were picked up in the reaction system. The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending for 72 ℃,20sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. Agarose gel electrophoresis was performed to verify that most colonies appeared positive bands except for numbers 2, 8, 11, and 17, as shown in fig. 6.

12. Plasmid enzyme digestion verification

4 positive clone colonies are selected, plasmids are extracted, bamHI and XhoI digestion verification is carried out, the digestion results are shown in FIG. 7, and the digestion results of the No. 2-5 plasmids BamHI and XhoI are correct as shown in FIG. 7, and meanwhile, the sequencing results are correct, so that the adenovirus vector plasmid pAd5DeltaE 4 with the E1, E3 and E4 genes deleted is obtained.

EXAMPLE 3 construction of adenovirus vector plasmid pAd5LCL3 deleted of E1, E3, E4 and E2a genes

1. Selection of target sequence of target gene E2a CRISPR

1) Selection of a CRISPR target sequence for the 100k gene upstream of the E2a gene

Using the Semer flying GeneArt ^TM CRISPR Search and Design tool (thermosusher. Com/crisprdesign) software, the first 400 bases of the 100k gene were entered and the software automatically analyzed the sequence of the 400 bases, providing 6 potential CRISPR target sequences. Considering the length of the E2a knockout sequence and the requirement for constructing a live vector, ATAGGTGGCGTTCGTAGGCA was selected as a targeting sequence, and the finally obtained gRNA was designated as 100k-gRNA, and the cleavage site and PAM site are shown in FIG. 8.

2) Selection of E2a downstream non-coding sequence CRISPR target sequence

Using the Semer flying GeneArt ^TM CRISPR Search and Design tool (thermosusher. Com/crisprdesign) software, 300 bases downstream of E4 were entered, software automated analysis provided 6 potential CRISPR target sequences, TACCCCGGTAATAAGGTTCA was selected as the targeting sequence, The final obtained gRNA was designated as protease-gRNA, and cleavage site and PAM site are shown in FIG. 9.

2. DNA amplification of 100k-gRNA and protease-gRNA

1) DNA template design of 100k-gRNA

5’-TAATACGACTCACTATAGAGGTGGCGTTCGTAGGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

2) DNA template design of protease-gRNA

5’-TAATACGACTCACTATAGCCCCGGTAATAAGGTTCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’

3. Designing upstream and downstream primers of DNA templates for amplifying 100k-gRNA and protease-gRNA

The upstream and downstream primers were designed to amplify the DNA template of 100k-gRNA and the DNA template of protease-gRNA by PCR, respectively, using GeneArt ^TM Precision gRNA Synthesis Kit kit for amplification.

1) Primer design

100k-gRNA-Foward：TAATACGACTCACTATAG AGGTGGCGTTCGTAG

100k-gRNA-Reverse：TTCTAGCTCTAAAAC TGCCTACGAACGCCACCT

protease-gRNA-Foward：TAATACGACTCACTATAG CCCCGGTAATAAGGT

protease-gRNA-Reverse：TTCTAGCTCTAAAAC TGAACCTTATTACCGGGG

2) DNA template for amplifying 100k-gRNA and protease-gRNA

(1) A0.3. Mu.M 100k-gRNA-Forward/Reverse primer mix was prepared, including 10. Mu.M 100k-gRNA-Forward primer 3. Mu.l, 10. Mu.M 100k-gRNA-Reverse primer 3. Mu.l, and water was supplemented to 100. Mu.l.

(2) A0.3. Mu.M Apase-gRNA-Forward/Reverse primer mix working solution was prepared, including 10. Mu.M protease-gRNA-Forward primer 3. Mu.l, 10. Mu.M protease-gRNA-Reverse primer 3. Mu.l, and water was made up to 100. Mu.l.

(3) PCR reaction system

The PCR reaction system for amplifying the DNA template of the 100k-gRNA comprises: phusion ^TM High-Fidelity PCR Master Mix (2X) 12.5. Mu.l, tracr fragment+T7 Primer Mix 1. Mu.l, 0.3. Mu.M 100k-gRNA-Forward/Reverse Primer Mix 1. Mu.l, and water to 25. Mu.l.

The PCR reaction system for amplifying the DNA template of the protease-gRNA comprises the following steps: phusion ^TM High-Fidelity PCR Master Mix (2X) 12.5. Mu.l, tracr fragment+T7 Primer Mix 1. Mu.l, 0.3. Mu.M protease-gRNA-Forward/Reverse Primer Mix 1. Mu.l, and make up to 25. Mu.l.

(4) PCR program

3. In vitro transcription to obtain 100k-gRNA and protease-gRNA

Using Transcriptaid ^TM The Enzyme Mix carries out in vitro transcription on the template DNA to obtain 100k-gRNA and protease-gRNA.

1) In vitro transcription to obtain 100k-gRNA, protease-gRNA

The reaction system for obtaining 100k-gRNA through in vitro transcription is as follows: NTP mix 8. Mu.l, 100k-gRNA DNA template 6. Mu.l, 5 XTranscriptaid ^TM Reaction Buffer 4μl，TranscriptAid ^TM Enzyme Mix 2 μl. After 4 hours incubation at 37℃1. Mu.l DNase I was added and incubated for 15 minutes at 37 ℃.

The reaction system for obtaining the protease-gRNA through in vitro transcription is as follows: NTP mix 8. Mu.l, protease-gRNA DNA template 6. Mu.l, 5 XTranscriptaid ^TM Reaction Buffer 4μl，TranscriptAid ^TM Enzyme Mix 2 μl. After 4 hours incubation at 37℃1. Mu.l DNase I was added and incubated for 15 minutes at 37 ℃.

2) Purification of in vitro transcription products

Supplementing the transcribed reaction system to 200 mu l with nuclease-free water, adding 100 mu l of Binding buffer, fully and uniformly mixing, and adding 300 mu l of ethanol >96%) was thoroughly mixed and the mixture was transferred to the Gene JET ^TM RNA Purification Micro Column, centrifuging at 14000 Xg for 30-60 s, and discarding the lower solution; 700. Mu.l of Wash Buffer1 (13 mL of ethanol) was added, and the mixture was centrifuged at 14000 Xg for 30-60 seconds, and the lower solution was discarded; 700. Mu.l Wash Buffer2 (30 mL ethanol) was added, 1400Centrifuging at 0 Xg for 30-60 s, discarding the lower solution, and repeating the above steps once. 14000 Xg of air was left for 60 seconds, all the eluate was completely removed, the empty tube was placed in a 1.5mL collection tube, 10. Mu.l of nuclease-free water was added to the center of the column, and the gRNA was collected by centrifugation at 14000 Xg for 60 seconds.

Wherein, wash Buffer1 and Wash Buffer2 are Transcriptaid ^TM The RNA sequences of the 100k-gRNA and the protease-gRNA obtained by transcription of the reagents in the Enzyme Mix kit are shown below:

100k-gRNA:GAGGUGGCGUUCGUAGGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU ^p rotease-gRNA:GCCCCGGUAAUAAGGUUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

4. CRISPR/Cas9 "restriction enzyme" method "

The adenovirus vector plasmid obtained in practical example 2, which is 100k-gRNA, protease-gRNA and Cas9 double enzyme, lacks the E1, E3 and E4 genes, and the reaction system is 3 mug of Cas9 protein; 100k-gRNA 6. Mu.g; 6 μg of protease-gRNA; 3. Mu.g of the vector plasmid obtained in example 2; NEB buffer 3.1 μl; make up water to 50 μl.

The cleavage reactions described above were incubated overnight at 37 ℃. The agarose gel verification was performed on 3. Mu.l of the sample, and the experimental results are shown in FIG. 10. Lane 1 shows the result of the double cleavage of 100k-gRNA, protease-gRNA and cas9 "double cleavage" vector plasmid, a fragment of the target size of 1000-2500bp was present, and the correct cleavage result was seen. The vector was purified using the Axygen gel recovery kit.

5. Obtaining a 100k, E4 ORF6/7 expression cassette containing a partial knockout, a Protease fragment

1) Amplification of the partially knocked out 100k, E4 ORF6/7 expression cassette, protease fragment

(1) Partial knockdown 100k amplification primer:

100k-F：TGAGAATAGGTGGCGTTCGTAGGCAAGGCTGACATCCGCTATGG

100k-ORF6/7-R：TACAATTCCCAACACATACAAGTTTCCTTCTCCTATAGGCAGAA

the amplification system is as follows: 1 μl of 10 μM 100k-F primer; 1 μl of 10 μM 100k-ORF6/7-R primer; template pAd5ΔE4 (100 ng/. Mu.l) 0.5. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending for 72 ℃,20sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃.

(2) E4 ORF6/7 expression cassette amplification primers:

ORF6/7-F：ACTTGTATGTGTTGGGAATTGTA

ORF6/7-R：ATCGTTTGTGTTATGTTTCAACG

the amplification system is as follows: 1 μl of ORF6/7-F primer; 10. Mu.M ORF6/7-R primer 1. Mu.l; template ORF6/7 expression cassette gene (100 ng/. Mu.l) 0.5. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending the temperature to 72 ℃,10sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃.

(3) Amplification of partially knocked out Protease fragments

ORF6/7-Protease-F：CCCACCCTTGCCGTCTGCGCCGTATCGTTTGTGTTATGTTTCAACG

Protease-R：ATGGATCACAACCCCACCATGAACCTTATTACCGGGGTACCCA

The amplification system is as follows: 10. Mu.M ORF6/7-Protease-F primer 1. Mu.l; 10. Mu.M Protease-R primer 1. Mu.l; template pAd5ΔE4 (100 ng/. Mu.l) 0.5. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

(4) The results of the 100k, E4 ORF6/7 expression cassettes and protease PCR amplification are shown in FIG. 11, in which lane 1 is the E4 ORF6/7 expression cassette, lane 2 is 100k and M is 15000bpMark

The amplification result is correct, and fragments are respectively subjected to gel recovery and purification by using an Axygen gel recovery kit.

6. Fusion PCR to obtain fusion fragment of 100k, E4 ORF6/7 expression cassette and Protease fragment

The amplification system is as follows: 1 μl of 10 μM 100k-F primer; 10. Mu.M Protease-R primer 1. Mu.l; template 100k gel recovery product (50 ng/. Mu.l) 1. Mu.l template E4 ORF6/7 expression cassette recovery product (50 ng/. Mu.l) 1. Mu.l; 25 μl of Q5 high-fidelity enzyme; the water was made up to 50. Mu.l.

The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending for 72 ℃,50sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. The amplification results are shown in FIG. 12, wherein lane 1 shows fragment 100k, E4 ORF6/7 expression cassette, and protease fusion PCR product, and the amplification results are correct. Fragments were purified using the Axygen gel recovery kit.

7. Carrier connection

The 100k, E4 ORF6/7 expression cassettes, protease fusion PCR glue recovery products were ligated to the E2a knockdown vector of step 4 using Gibson of NEB, the ligation system was as follows: 100ng of vector fragment after knocking out E2a of the gel recovery product, 100k of gel recovery product, 50ng of protease fusion PCR fragment, 10 μl of Gibson premix, and 20 μl of water were added. Incubate at 50℃for 40 min.

8. Transformation

9. Colony PCR for transformant screening

Downstream primers for colony PCR were designed

DBP-upsteam-F：GTTGGGCTCGCATGTGCCG

DBP-downsteam-R：ACTCCCATGGATCACAACCC

The reaction system is as follows: mu.M of DBP-up-stream-F primer 1. Mu.l, 10. Mu.M of DBP-down-stream-R primer 1. Mu.l, and 10. Mu.l of Q5 high-fidelity enzyme were added with water to 20. Mu.l, and monoclonal colonies were picked up in the reaction system. The PCR procedure was: initial denaturation 98 ℃,10sec,1 cycle; denaturation at 98 ℃,5sec; annealing at 60 ℃ for 30sec; extending for 72 ℃,20sec,35 cycles; extending at 72 ℃, for 5min, and circulating for 1; the temperature was kept at 4 ℃. Agarose gel electrophoresis was performed to verify that positive bands appeared at 9, 18, 21, 24 as shown in fig. 13.

10. Plasmid enzyme digestion verification

The 4 positive clone colonies of 9, 18, 21 and 24 are picked, plasmids are extracted, xhoI digestion verification is carried out, and digestion results are shown in FIG. 14, wherein lane 1 is the XhoI digestion of the 9 positive clone, lane 2 is the XhoI digestion of the 18 positive clone, lane 3 is the XhoI digestion of the 21 positive clone, lane 4 is the XhoI digestion of the 24 positive clone, and lane 5 is the XhoI digestion of the control plasmid pAd5LCL 3. As can be seen from FIG. 14, the results of the XhoI digestion of the plasmid were all correct, while the sequencing results were correct, i.e., the plasmid pAd5LCL3 was obtained with deletion of E1, E3, E4 and E2a genes, and the ORF6/7 expression cassette of the E4 region was placed in the position of the sequence from which the E2a region was knocked out, and the vector map thereof was as shown in FIG. 49.

EXAMPLE 4 construction of African swine fever adenovirus type 5 vector E1 region shuttle plasmid pS5E1-F317L-IRES-A151R

1. Construction of E1 region shuttle plasmid of human adenovirus type 5 vector

The backbone of the shuttle plasmid pS5E1 was composed of the basic elements (2796 bp) of pucorigin, amp, etc. (pS 5E1 backbone was synthesized by Beijing Bomaide Gene technologies Co., ltd.), the partial sequence of the ITR of the left arm of Ad5 (355 bp), the partial sequence of the PIX and PIVa2 of the right arm (2100 bp), and the SV40 earlypolyA of CMV-MCS (Seq ID No. 12) (944 bp) (160 bp).

1) Primer design

puc-Ad5-right arm-F：TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT

Ad5-right arm-CMV-R：ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATATAAG

CMV-F：GTATCTGCTCCCTGCTTGTG

CMV-SV40-R：TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG

SV40-F：CTTCGCCCACCCCAACTTGT

SV40-R：AGAGGTCGACGGTATACAGAC

SV40-Ad5-left arm-F：TGTCTGTATACCGTCGACCTCTCCGAAAAACACCTGGGCGAGTCTCC

Ad5-left arm-puc-R：ACACTATAGAATACACGGAATTCTTAATTAAATCATCAATAATATACCTTATTTTG

puc-F：GAATTCCGTGTATTCTATAGTGT

puc-R：TTTCGATAAGCCAGCTGCATTA

2) Amplification of fragments of interest

(1) The CMV promoter MCS fragment of the pS5E1 shuttle plasmid was amplified using pCDNA3.1 (+) as template (this plasmid was purchased from Sieimer), CMV-F and CMV-SV40-R as primers; amplification system: 50ng of pCDNA3.1 (+) plasmid, 1ul of 10uM CMV-F primer, 1ul of 10uM CMV-SV40-R primer and 20ul of Q5 high-fidelity enzyme; supplementing water to 40ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 1min,35 cycles; 72℃for 5min.

(2) The SV40-earlypolyA fragment of the pS5E1 shuttle plasmid was amplified using pCDNA3.1 (+) as template (this plasmid was purchased from Sieimer femto) and SV40-F and SV40-R as primers; amplification system: 50ng of pCDNA3.1 (+) plasmid, 1ul of 10uM SV40-F primer, 1ul of 10uM SV40-R primer and 20ul of Q5 high-fidelity enzyme; supplementing water to 40ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃,10 sec,35 cycles; 72℃for 5min.

The agarose gel of the amplified product is shown in FIG. 15, in which lane 1 is CMV-MCS fragment, lane 2 is SV40 earlypolyA fragment and M is 2000Marker. As can be seen from FIG. 15, the amplification results were correct.

(3) Purification was performed using the Axygen gel recovery kit.

(4) PCR amplification of pS5E1 shuttle plasmid skeleton with template pS5E1 skeleton plasmid synthesized by Bomeid company and primers puc-F and puc-R, amplification system: 50ng of pS5E1 backbone plasmid, 1ul of 10uM puc-F primer, 1ul of 10uM puc-R primer and 20ul of Q5 high-fidelity enzyme; supplementing water to 40ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 1min20sec,35 cycles; 72℃for 5min.

(5) The left arm of pS5E1 shuttle plasmid was amplified using pAd5LCL3 plasmid as template and SV40-Ad5-left arm-F and Ad5-left arm-puc-R as primers, amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM SV40-Ad5-left arm-F primer, 1ul of 10uM Ad5-left arm-puc-R primer, 20ul of Q5 high-fidelity enzyme, and 40ul of water are added. The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 20s,35 cycles; 72℃for 5min.

(6) The right arm of the pS5E1 shuttle plasmid was amplified using pAd5LCL3 plasmid as template and puc-Ad5-right arm-F and Ad5-right arm-CMV-R as primers, amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM puc-Ad5-right arm-F primer, 1ul of 10uM Ad5-right arm-CMV-R primer, 20ul of Q5 high fidelity enzyme, and 40ul of water. The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 15s,35 cycles; 72℃for 5min.

(7) The CMV-MCS-SV40 earlypolyA fragment of the pS5E1 shuttle plasmid was amplified using the gel recovery product CMV-MCS as template and CMV-F and SV40-R as primers, amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM CMV-F primer, 1ul of 10uM SV40-R primer, 20ul of Q5 high-fidelity enzyme, and 40ul of water are added. The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 40s,35 cycles; 72℃for 5min.

The agarose gel of the amplified product is shown in FIG. 16, in which lane 1 is CMV-MCS-SV40 earlypolyA fusion fragment, lane 2 is PUC, lane 3 is Ad5 right arm, and lane 4 is Ad5 left arm.

3) Ligation transformation of fragments

The fragments were purified using Axygen gel recovery kit, and then the four fragments of pS5E1 backbone, ad5 left arm, ad5 right arm, CMV-MCS-SV40 earlypolyA were ligated using Bomad corporation seamless cloning kit in a ligation system of 2X Smealess Cloning Mix. Mu.l, pS5E1 backbone fragment 50ng, ad5 left arm 50ng, ad5 right arm 50ng, CMV-MCS-SV40 polyA 50ng, water make up to 20. Mu.l, and incubated at 50℃for 40 minutes to obtain ligation product plasmid pS5E1. The ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

4) Verification of plasmids

(1) Colony PCR verification

Colonies were picked for agarose gel verification and positive bands were seen as shown in FIG. 17.

(2) Enzyme digestion verification

The positive clone is selected and placed in 5mL LB liquid medium containing ampicillin resistance for culturing for 12-15 hours, the plasmid is extracted for enzyme digestion verification, the electrophoresis result is shown in FIG. 18, wherein the left 1-6 is plasmid pS5E1 NcoI single enzyme digestion, the right 1-6 is plasmid pS5E1 PacI single enzyme digestion, M is 15000bp Marker, the enzyme digestion result is correct, and the shuttle plasmid pS5E1 in E1 region of human adenovirus type 5 vector is successfully constructed, and the vector map is shown in FIG. 50.

2. Construction of African swine fever adenovirus 5-type vector shuttle plasmid pS5E1-F317L-IRES-A151R

1) Ligation of pS5E1 with IRES fragment

(1) Primer synthesis

IRES-EcoRV-F：ccg GATATC TGTCGTCATCATCCTTATAGTCC

IRES-NotI-R：aaatat GCGGCCGC GGTTGTGGCCATTATCATCGTG

(2) Amplification of IRES fragments

Amplification system: 25ul of Q5 enzyme, 10uM primer IRES-EcoRV-F1 ul,10uM primer IRES-NotI-R1 ul, 2ul of template IRES template, and water supplementing to 50ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃,20 s,35 cycles; 72℃for 5min. The result of the amplification is shown in FIG. 19, wherein lanes 1 and 2 are IRES fragment PCR amplification products, M is 15000bp Marker, and the amplification result is correct.

(3) IRES fragments were purified using the Axygen PCR purification kit.

(4) Cleavage of the desired fragment IRES from the pS5E1 vector

Enzyme digestion reaction system: vector pS5E1, IRES fragment-2 ug, ecoRV and NotI each 1ul;10 Xcutmark buffer 5ul; moisturizing to 50ul; reaction conditions: 37 ℃ for 30min; inactivating at 65deg.C for 20 min; and (5) recycling and purifying the glue. The electrophoresis detection of the digested products is shown in FIG. 20, wherein lane 1 is the fragment IRES EcoRV and NotI digested, lane 2 is pS5E1 EcoRV and NotI digested, and M is 15000bp Marker.

(5) Ligation of pS5E1 vector with IRES fragment

The connection system is as follows: pS5E1 (100 ng); IRES fragments (vector: fragment=1:5, molar ratio); 1ul of T4 DNA ligase; 10 Xligase buffer1ul; water was added to 10ul. Reaction conditions: room temperature for 30min. The ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

(6) Colony PCR verification

Amplification system: q5 enzyme 10ul,10uM primer IRES-EcoRV-F1 ul,10uM primer IRES-NotI-R1 ul, and water to 20ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃,20 s,35 cycles; 72℃for 5min. Electrophoresis was performed, as shown in FIG. 21, wherein the numbers 1 to 9 are colonies, M is Marker, and positive bands appear on the numbers 2 and 6 as seen in FIG. 21.

(7) And (3) carrying out restriction enzyme digestion verification on plasmids NotI and EcoRV, selecting 2 and 6 for plasmid extraction, and carrying out restriction enzyme digestion verification, wherein the results are shown in figure 22, the restriction enzyme digestion verification on plasmids NotI and EcoRV No. 2 is carried out, the restriction enzyme digestion verification on plasmids NotI and EcoRV No. 6 is carried out, and the correct restriction enzyme digestion result is seen.

2) Ligation of pS5E1-IRES with F317L fragment

(1) Primer synthesis

F317L-BamHI-F：cgc GGATCC gccaccATGGTGGAGACCCAGATGGACA

F317L-EcoRV-R：ccg GATATC TCAGTGGTGGTGGTGGTGGTG

(2) PCR amplification of F317L fragment

Amplification system: q5 enzyme 25ul,10uM primer F317L-BamHI-F1 ul,10uM primer F317L-EcoRV-R1 ul, template F317L1ul, and water to 50ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃,20 s,35 cycles; 72℃for 5min.

(3) The F317L fragment was purified using the Axygen PCR purification kit.

(4) Cleavage of the desired fragment F317L with the pS5E1-IRES vector

Enzyme digestion reaction system: vector pS5E1-IRES, F317L fragment-2 ug, bamHI and EcoRV each 1ul;10 Xcutmark buffer 5ul; water was added to 50ul. Reaction conditions: 37 ℃ for 30min; inactivating at 65deg.C for 20 min. And (5) recycling and purifying the glue. The electrophoresis detection of the digested products is shown in FIG. 23, wherein lane 1 shows pS5E1-IRES, bamHI and EcorV double digestion, lane 2 shows fragment F317L, bamHI and EcoRV double digestion, and M shows 15000bp Marker.

(5) Ligation of the fragment of interest F317L with pS5E1-IRES

The connection system is as follows: pS5E1-IRES (100 ng); F317L fragment (vector: fragment=1:3 molar ratio); 1ul of T4 DNA ligase; 10 Xligase buffer 1ul; water was added to 10ul. Reaction conditions: room temperature for 30min. The ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

(6) Colony PCR verification

Amplification system: q5 enzyme 10ul,10uM primer F317L-BamHI-F1 ul,10uM primer IRES-NotI-R1 ul, and water to 20ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃, 20s,35 cycles; 72℃for 5min. Electrophoresis was performed, as shown in FIG. 24, wherein the numbers 1-24 were colonies, and M was a 2000bp Marker. As can be seen from FIG. 24, the numbers 9 and 10 are positive colonies.

(7) Plasmid restriction enzyme (BamHI and EcoRV) was verified, and 9 and 10 colonies were selected for plasmid extraction and restriction enzyme verification. The results are shown in FIG. 25, which shows positive plasmids.

3) Ligation of pS5E1-F317L-IRES with fragment A151R

(1) Primer synthesis

A151R-NotI-F：aaatat GCGGCCGC ATGAACAAGAAGATCATCGTGATG

A151R-6His-XhoI-R：

cggCTCGAGTCAGTGGTGGTGGTGATGGTGCTGGAAGATGTTGGGGGACATGA

(2) PCR amplification of A151R fragment

Amplification system: q5 enzyme 25ul, primer A151R-NotI-F1 ul, primer A151R-6 His-XhoI-R1 ul, template A151R, and water to 50ul; reaction conditions: 30S at 98 ℃;98℃10s,68℃30s,72℃30s,35 cycles; and at 72℃for 5min.

(3) The a151R fragment was purified using the Axygen PCR purification kit.

(4) Cleavage of the target fragment A151R with the pS5E1-F317L-IRES vector

Enzyme digestion reaction system: the vector pS5E1-F317L-IRES, fragment A151R-2 ug, notI and XhoI each 1ul;10 Xcutmark buffer 5ul; water was added to 50ul. Reaction conditions: 37 ℃ for 30min; inactivating at 65deg.C for 20 min. And (5) recycling and purifying the glue. The electrophoresis detection of the digested products is shown in FIG. 26, wherein lane 1 is pS5E1-F317L-IRES, notI and XhoI digested; lanes 2 and 3 are the A151R fragment, notI and XhoI cut, M15000 bp Marker.

(5) Ligation of pS5E1-F317L-IRES vector with A151R fragment

The connection system is as follows: pS5E1-F317L-IRES 100ng; 50ng of A151R fragment; 1ul of T4 DNA ligase; 10 Xligase buffer 1ul; water was added to 10ul. Reaction conditions: room temperature for 30min. The ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

(6) Colony PCR verification

Amplification system: q5 enzyme 10ul,10uM primer IRES-ECoRV-F1 ul,10uM primer A151R-6 His-XhoI-R1 ul, moisturizing to 20ul; the PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃,30 s,72 ℃,20 s,35 cycles; 72 ℃ for 5min; electrophoresis was performed as shown in FIG. 27, wherein numbers 1-24 are colonies, and M is 2000bp Marker.

(7) Plasmid BamHI and XhoI are subjected to digestion verification, 4, 15, 23 and 24 colonies are selected for plasmid extraction, the digestion verification results are shown in FIG. 28, the digestion verification results are shown in the drawings, and the digestion verification results are shown in the drawings, wherein M is 2000bp Marker. As can be seen from FIG. 28, the result of the digestion is correct, the successful construction of the African swine fever adenovirus type 5 vector E1 region shuttle plasmid pS5E1-F317L-IRES-A151R, the sequencing is correct, and the vector map is shown in FIG. 51.

EXAMPLE 5 construction of African swine fever adenovirus type 5 vector E4 region shuttle plasmid pS5E4-P34-2A-pp62

1. Construction of E4 region shuttle plasmid of human adenovirus type 5 vector

The skeleton of the shuttle plasmid pS5E4 adopts basic elements such as puc origin, amp and the like, the left arm ITR sequence (370 bp) of the Ad5E4 region, the right arm fiber gene sequence (1746 bp) and the EF1 alpha-EGFP-HBV polyA gene.

1) Gene synthesis

The EF1 alpha-EGFP-HBV polyA gene was synthesized by Bomaide company.

2) Primer design

puc-Ad5E4-left arm-F：AGGTGACACTATAGAATACACGTTAATTAAATCATCAATAATATACCTTATTTTG

Ad5E4-left arm-EF1α-R：caatccccccttttcttttaaaaAACACCACTCGACACGGCAC

EF1α-F：ttttaaaagaaaaggggggattg

EF1α-R：TAGAGCCCCAGCTGGTTCTTT

EF1α-Ad5E4-right arm-F：GGAAAGAACCAGCTGGGGCTCTAGCAATTGAAAAATAAACACGTTGA

Ad5E4-right arm-puc-R：TAATACGACTCACTATAGGGAGACCCAAAATGTAACCACTGTGAG

puc-F：TCTCCCTATAGTGAGTCGTATT

puc-R：CGTGTATTCTATAGTGTCACCT

ORF6/7-Protease-F：CGTTGAAACATAACACAAACGATACGGCGCAGACGGCAAGGGTGGG

3) Amplification of fragments of interest

(1) The EF1 alpha-EGFP-HBV polyA fragment of the pS5E4-EGFP shuttle plasmid is amplified by taking the EF1 alpha-EGFP-HBV gene synthesis fragment as a template and EF1 alpha-F and EF1 alpha-R as primers; amplification system: 50ng of EF1 alpha-EGFP-HBV gene synthesis fragment, 1ul of 10uM EF1 alpha-F primer, 1ul of 10uM EF1 alpha-R primer and 20ul of Q5 high-fidelity enzyme; water was added to 40ul. The PCR procedure was: 98℃for 10sec;98 ℃, 5sec,60 ℃, 30sec,72 ℃, 40sec,35 cycles; 72℃for 5min.

(2) The left arm fragment of the pS5E1 shuttle plasmid was amplified using pAd5LCL3 as template and puc-Ad5E4-left arm-F and Ad5E4-left arm-EF 1. Alpha. -R as primers. Amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM puc-Ad5E4-left arm-F primer, 1ul of 10uM Ad5E4-left arm-EF1 alpha-R primer and 20ul of Q5 high-fidelity enzyme; water was added to 40ul. The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃,10 sec,35 cycles; 72℃for 5min.

(3) Amplifying the right arm fragment of the pS5E4-EGFP shuttle plasmid with pAd5LCL3 as a template and EF1 alpha-Ad 5E4-right arm-F and Ad5E4-right arm-puc-R as primers; amplification system: 50ng of pAd5LCL3 plasmid, 1ul of 10uM EF1α -Ad5E4-right arm-F primer, 1ul of 10uM Ad5E4-right arm-puc-R primer, and 20ul of Q5 high fidelity enzyme; water was added to 40ul.

The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 40sec,35 cycles; 72℃for 5min.

(4) PCR (polymerase chain reaction) amplification of pS5E4-EGFP shuttle plasmid skeleton by taking pS5E1 plasmid as a template and puc-F and puc-R as primers; amplification system: 50ng of pS5E1 backbone plasmid, 1ul of 10uM puc-F primer, 1ul of 10uM puc-R primer and 20ul of Q5 high-fidelity enzyme; water was added to 40ul. The PCR procedure was: 98 ℃ for 10s;98 ℃, 5s,60 ℃, 30s,72 ℃, 1min20sec,35 cycles; 72℃for 5min. Agarose verification of the amplified product is shown in FIG. 29, wherein lane 1 is the left arm of the pS5E4-EGFP shuttle plasmid, lane 2 is the right arm of the pS5E4-EGFP shuttle plasmid, lane 3 is EF 1. Alpha. -EGFP-HBV, lane 4 is the pS5E4-EGFP shuttle plasmid backbone, and M is 2000Marker. As can be seen from FIG. 29, the amplification results were correct.

4) The fragment of interest was purified using an Axygen gel recovery kit.

5) Ligation transformation of fragments

The four fragments, namely the left arm of the pS5E4-EGFP shuttle plasmid, the right arm of the pS5E4-EGFP shuttle plasmid, EF1 alpha-EGFP-HBV and the pS5E4-EGFP shuttle plasmid skeleton, were ligated by using a Bomader seamless cloning kit, the ligation system was 2X Smealess Cloning Mix. Mu.l, the left arm fragment of the pS5E4-EGFP shuttle plasmid 50ng, the right arm fragment of the pS5E4-EGFP shuttle plasmid 50ng, the EF1 alpha-EGFP-HBV fragment 50ng, the backbone fragment of the pS5E4-EGFP shuttle plasmid 50ng, and the backbone fragment of the pS5E4-EGFP shuttle plasmid was made up to 20. Mu.l, and incubated at 50℃for 40 minutes; the ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

6) Verification of plasmids

(1) Colony PCR verification

The target fragment was amplified by PCR using the primer puc-Ad5E4-left arm-F/ER1a-R as the primer colony, and the result was confirmed by agarose gel, as shown in FIG. 30, positive bands were present.

(2) Enzyme digestion verification

The 3, 4, 5 and 6 positive clones are selected and placed in 5mL LB liquid medium containing ampicillin resistance for culturing for 12-15 hours, plasmids are extracted for enzyme digestion verification, the electrophoresis result is shown in FIG. 31, wherein 1-4 is 3, 4, 5 and 6 positive clone PacI single enzyme digestion, 5-8 is 3, 4, 5 and 6 positive clone HindIII single enzyme digestion, M1 and M3:15000bp Marker; m2:2000bp Marker; the enzyme cutting result is correct, and the sequencing is correct; the human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-EGFP was successfully constructed, and the vector map thereof is shown in FIG. 52.

2. Construction of African swine fever adenovirus 5 type vector E4 region shuttle plasmid pS5E4-P34-2A-pp62

1) Primer design

EF1α-BamHI-P34-F：tccaagctgtgaccggcgcctacGGATCCGCCACCATGGGGAATCGCGGGTCTTCT

P34-2A-R：GCCCTTTTTGGCGCAGCTGTT

P34-2A-F：AGAACAGCTGCGCCAAAAAGGGCGGAAGCGGAGCTACTAACTTC

2A-pp62-R：AACTGCTTCATGTTGCTGGGCATAGGTCCAGGGTTCTCCTCCA

pp62-F：ATGCCCAGCAACATGAAGCAG

pp62-XhoI-pS5E4-R：GGGTTTAAACGGGCCCTCTAGACTCGAGttaCAGCAGCTTCA

GGATCTCGTT

2) Amplification of the fragment of interest P34, 2A, pp62

(1) Amplifying the P34 fragment by taking the P34 gene synthesis fragment as a template and EF1 alpha-BamHI-P34-F and P34-2A-R as primers; amplification system: 50ng of P34 gene synthesis fragment, 1ul of 10uM EF1α -BamHI-P34-F primer, 1ul of 10uM P34-2A-R primer and 20ul of Q5 high-fidelity enzyme; supplementing water to 40ul; the PCR procedure was: 98℃for 10sec;98 ℃, 5sec,60 ℃, 30sec,72 ℃, 40sec,35 cycles; 72℃for 5min.

(2) Amplifying the 2A fragment by taking the 2A gene synthesis fragment as a template and P34-2A-F and 2A-pp62-R as primers; amplification system: 2A Gene synthesis 50ng,10uM P34-2A-F primer 1ul,10uM 2A-pp62-R primer 1ul, Q5 high fidelity enzyme 20ul; supplementing water to 40ul; the PCR procedure was: 98℃for 10sec;98 ℃, 5sec,60 ℃, 30sec,72 ℃, 20sec,35 cycles; 72℃for 5min.

(3) Amplifying the 2A fragment by using the pp62 gene synthesis fragment as a template and pp62-F and pp62-XhoI-pS5E4-R as primers; amplification system: 50ng of pp62 gene synthesis fragment, 1ul of 10uM pp62-F primer, 1ul of 10uM pp62-XhoI-pS5E4-R primer, and 20ul of Q5 high-fidelity enzyme; supplementing water to 40ul; the PCR procedure was: 98℃for 10sec;98 ℃, 5sec,60 ℃, 30sec,72 ℃, 40sec,35 cycles; 72℃for 5min.

The electrophoretic detection of PCR products is shown in FIG. 32, where lane 1 is fragment p34;2 is fragment 2A;3 is fragment pp62, M is 15000bp Marker.

3) The fragment of interest was purified using an Axygen gel recovery kit.

4) Fusion PCR amplification of P34-2A fragment

Amplification system: 50ng of P34 gel recovery fragment, 50ng of 2A gel recovery fragment, 1ul of 10uM EF1α -BamHI-P34-F primer, 1ul of 10uM2A-pp62-R primer, and 25ul of Q5 high-fidelity enzyme; moisturizing to 50ul; the PCR procedure was: 98℃for 10sec;98 ℃, 5sec,60 ℃,30 sec,72 ℃,40 sec,35 cycles; 72℃for 5min. The fusion result is shown in FIG. 33, in which lane 1 is the P34-2A fragment and M is the 2000bp Marker

5) pS5E4-EGFP vector cleavage

Enzyme digestion reaction system: the vector pS5E4-EGFP 2ug, bamHI and XhoI each 1ul;10 Xcutmark buffer 5ul; water was added to 50ul. Reaction conditions: 37 ℃ for 30min; inactivating at 65deg.C for 20 min. Axygen kit gel is recovered and purified.

6) Purifying the vector fragment using an Axygen gel recovery kit;

the results of the gel recovery are shown in FIG. 34, wherein lane 1 is the fragment pS5E4-EGFP, bamHI, xhoI double cut gel recovery, M15000 bp Marker.

7) Seamless cloning connection and transformation of pS5E4-EGFP gel recovery vector and P34-2A fragment, pp62

The connection system is as follows: pS5E4-EGFP gel recovery product (100 ng), P34-2A fragment (50 ng), pp62 fragment (50 ng), 2X Smealess Cloning Mix ul, moisturizing to 10ul. Reaction conditions: 50℃for 40min. The ligation products were transformed into DH 5. Alpha. Competent cells, plated on ampicillin-resistant plates and incubated at 37℃for 12-16 hours.

8) Verification of plasmids

(1) Colony PCR verification

The target fragment was amplified by colony PCR using the primer EF 1. Alpha.2 (jd) -F, HBV (jd) -R as primer, and the result was verified by agarose gel, wherein the numbers 1-12 were colonies, and M was 15000bp Marker.

(2) Enzyme digestion verification

Selecting positive clones 1, 2, 9 and 11, placing the positive clones in 5mL LB liquid medium containing ampicillin resistance for culturing for 12-15 hours, extracting plasmids, and carrying out BmHI and XhoI double enzyme digestion verification; the cleavage results are shown in FIG. 36, wherein lanes 1, 2, 9 and 11 are identified by double cleavage of the positive clone BamHI and XhoI, and M is 15000bp Marker. The result of the enzyme digestion is correct, the sequencing is correct, and the shuttle plasmid pS5E4-P34-2A-pp62 in E4 region of the African swine fever adenovirus type 5 vector is successfully constructed, and the vector map is shown in figure 53.

EXAMPLE 6 recombinant construction of the shuttle plasmid pS5E1-F317L-IRES-A151R, pS E4-P34-2A-pp62 with pAd5LCL3-F317L-A151R-P34-pp62 plasmid

1. Homologous recombination of shuttle plasmid pS5E1-F317L-IRES-A151R and adenovirus vector plasmid pAd5LCL3

1) PacI and SwaI digested shuttle plasmid pS5E1-F317L-IRES-A151R and adenovirus vector plasmid pAd5LCL3, the digestion reaction was as follows:

A. shuttle plasmid pS5E1-F317L-IRES-A151R 3 μg; pacI 2 μl; buffer setmart 4 μl; the water was made up to 40. Mu.l.

B. Adenovirus vector plasmid pAd5LCL3 3ug; swaI 2 μl; buffer 3.1. Mu.l; the water was made up to 40. Mu.l.

The reaction condition is 37 ℃ for 1h; inactivating at 65deg.C for 20 min.

2ul agarose gel was taken and validated, and the validation result is shown in FIG. 37, wherein lane 1 is pAd5LCL3, and lane 2 is pS5E1-F317L-IRES-A151R.

2) Dephosphorylation of cleavage products

The reaction system: 37.5 mu.l of enzyme digestion reaction liquid; 1 μl of dephosphorylase; dephosphorylated buffer 5. Mu.l; the water was made up to 50. Mu.l. The reaction condition is 37 ℃ for 1h; inactivating at 65deg.C for 5 min.

3) The vectors and fragments were recovered using OMEGA Ultra-Sep Gel Extraction Kit.

4) And (3) co-transforming BJ5183 competent cells by using 100ng of the purified shuttle plasmid and 100ng of the purified adenovirus vector, coating an LB plate containing Kan on the transformed products, and culturing at 37 ℃ for 12-16 h.

5) Picking a colony in 5mL LB liquid medium containing Kan, carrying out shaking culture at 37 ℃ for 12-16 h, and extracting plasmids for XhoI digestion verification; the results are shown in FIG. 38, where lanes 1-7 are pAd5LCL3-F317L-IRES-A151R clone, M: as can be seen from FIG. 38, the cleavage of clone No. 3 was correct for 15000bp markers.

6) The positive plasmid No. 3 is transformed into DH5 alpha to be competent, a colony is picked up in 5mL LB liquid medium containing Kan, shaking culture is carried out for 12-16 h at 37 ℃, the plasmid is extracted and subjected to XhoI digestion verification again, the digestion result is shown in FIG. 39, and the accurate digestion result is shown in FIG. 39, so that adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R is successfully constructed.

2. Homologous recombination of the shuttle plasmid pS5E4-P34-2A-pp62 and the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R to obtain pAd5LCL3-F317L-A151R-P34-pp62

1) PacI and I-sceI the shuttle plasmid pS5E4-P34-2A-pp62 and the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R were digested with the following cleavage reaction system:

A. shuttle plasmid pS5E4-P34-2A-pp 62. Mu.g; pacI 2 μl;10 Xcutmart buffer 4. Mu.l; the water was made up to 40. Mu.l.

B. Adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R 3ug; I-sceI 2 μl; buffer setmart 4 μl; the water was made up to 40. Mu.l.

The reaction condition is 37 ℃ for 1h; inactivating at 65deg.C for 20 min.

2ul agarose gel was taken and validated and the validation result is shown in FIG. 40, wherein lane 1 is pS5E4-P34-2A-pp62 and lane 2 is pAd5LCL3-F317L-IRES-A151R.

2) Dephosphorylation of cleavage products

5) 6 colonies were picked up in 5mL LB liquid medium containing Kan, cultured with shaking at 37℃for 12-16 h, and the plasmid was extracted for XhoI cleavage, and the results were shown in FIG. 41, wherein lanes 1-4 were plasmids, M was 15000Marker, and it can be seen that plasmid No. 2 was correct.

6) Transforming the positive plasmid No. 2 to DH5 alpha competence; 1 colony is picked up in 5mL LB liquid medium containing Kan, shake-cultured for 12-16 h at 37 ℃, and plasmid is extracted for XhoI digestion verification again; the result of the digestion is shown in FIG. 42, wherein lane 1 is pAd5LCL3-F317L-A151R-P34-2A-pp62 plasmid XhoI, M is 15000Marker, and the result of the digestion is correct, and the adenovirus vector plasmid pAd5LCL3-F317L-A151R-P34-pp62 is successfully constructed, and the vector map is shown in FIG. 54.

EXAMPLE 7 packaging of recombinant adenoviruses

The pAd5LCL3-F317L-A151R-P34-pp62 plasmid was packaged using 293TD37 cells and the procedure was as follows:

293TD37 cells were prepared: cells were prepared the day before transfection, 293TD37 cells to be transfected were seeded into 6-well plates, 0.5X10 ⁶ Well at 37℃in 5% CO ₂ The cells were allowed to stand for 24 hours with 40-50% confluency on the day of transfection.

Plasmid pAd5LCL3-F317L-A151R-P34-pp62 linearization: the plasmid to be transfected was digested with PacI, incubated at 37℃for 40min and then inactivated at 65℃for 20min.

Transfection: linearized 2. Mu.g plasmid and PEI were diluted separately with 100. Mu.l serum-free medium; plasmid dilutions were added to PEI dilutions and the mixture was repeatedly aspirated 5 times or vortexed for 10 seconds and mixed well, and incubated at room temperature for 10 minutes to form transfection complexes. During incubation, the cell culture broth was gently aspirated from the plate, 2ml of fresh growth medium was added, and after 10 minutes the transfection complex was added to the fresh medium-changed cells.

Cell culture: the transfected 293TD37 cells are subjected to static culture in a 5% CO2 incubator at 37 ℃ for 72-96 hours; the 6-well plate cell suspension was collected 72-96 hours after virus plasmid transfection in a 1.5ml centrifuge tube, i.e., TP0.

Continuous inoculation: repeatedly freezing and thawing the collected cell suspension at-80deg.C for 3 times, centrifuging at 4deg.C for 10 min at 2000g, and collecting 500 μl of supernatant to infect 293TD37 cells (293 TD37 cells need to be prepared one day in advance), 37 deg.C, 5% CO ₂ Incubation was carried out for 60 min, supplemented with 2mL of FBS medium, 37℃and 5%CO ₂ Culturing for 72 hours, and collecting cell suspension, namely TP1; the previous step was repeated and the cell suspension, TP2, was collected. The inoculation is continued until the cells are diseased.

Cytopathy: after culturing 293TD37 cells from TP0 to TP4, the cells gradually lesion until 293TD37 cells were completely diseased at TP 4. Cytopathic effects caused by TP0 to TP4 are shown in FIGS. 43-47, respectively, TP4 has been completely diseased.

Example 8 detection of titers of African swine fever Multi-antigen recombinant adenovirus vaccine

293TD37 cells were prepared, well-grown cells in T75 flasks were removed, the supernatant was discarded, washed with PBS, digested with 0.25% trypsin, stopped with 10mL fresh DMEM medium containing 10% fetal bovine serum, and then blow-mixed and inoculated in 6-well plates (5X 10) ⁵ Per mL, 2mL per well), at 37℃5% CO ₂ And (5) standing and culturing in a carbon dioxide incubator. After 24 hours, after cells had grown as monolayer cells by adherence, the medium was discarded and the recombinant adenovirus was subjected to 10 with serum-free DMEM maintenance solution ^-3 ～10 ^-6 Serial dilutions were performed in duplicate, each dilution was inoculated in 2 wells, 250uL per well, after 1 hour of infection, the supernatant was discarded, complete medium was supplemented, and then the culture was allowed to stand in a 5% carbon dioxide incubator at 37 ℃. After 24h, the supernatant was discarded, the cells were washed with PBS, 1mL of cold formaldehyde was added to each well after discarding PBS, the wells were fixed with 1mL of cold formaldehyde at room temperature for 10min, formaldehyde was discarded, the cells were washed with PBS, 1mL of adenovirus antibody-FITC was added to each well, after 1h at room temperature, the cells were washed with PBS again, 1mL of PBS was added to each well after two passes, and the cells were counted under a fluorescence microscope (200-fold, 10 consecutive fields). And (3) calculating: viral titer (FFU/mL) =average×1013×4×10 ^(-n) . FFU of pAd5LCL3-F317L-A151R-P34-pp62 virus is 2.4X10 ⁸ FFU/mL, the titer is higher.

Example 9 detection of stability of African swine fever Multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62

Preparing 293TD37 cells, taking well-grown cells in a T75 culture flask, discarding the supernatant, washing the cells with PBS, digesting with 0.25% trypsin, adding 10mL of fresh DMEM medium containing 10% fetal bovine serum to terminate digestion, and thenBlowing and mixing well, seeding 293TD37 cells into 6-well plates (5×10) ⁵ cells/mL,2 mL/well), allowed to adhere to the surface of the substrate at room temperature for 1 hour, and examined the extent of adhesion by microscopic examination after incubation. Infection with pAd5LCL3-F317L-A151R-P34-pp62 virus particles was performed at a titer of 5 MOI/well. After the 293TD37 cells are diseased after 48 hours, the cells are collected, repeatedly frozen and thawed for 3 times, centrifuged at 2000g, the supernatant is collected, the collected supernatant is detected for FFU, and then the new 293TD37 cells are re-infected until 30 generations. The collected 5 th, 10 th, 15 th, 20 th, 25 th and 30 th generation virus solutions were examined, and the genome of the virus was found to be still intact, indicating that the replication defective pAd5LCL3-F317L-A151R-P34-pp62 virus could be stably packaged in 293TD37 cells.

Example 10 detection of the African swine fever Multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 recovery mutation (RCA)

pAd5LCL3-F317L-A151R-P34-pp62 virus RCA detection method is as follows:

1. pAd5LCL3-F317L-A151R-P34-pp62 virus solution was prepared, measured for virus titer, and the concentration of virus particles was measured, and the DNA of host cells was digested with the virus solution and 1%Universal nuclease (Universal nuclease 7.5.5-15 units/mL virus solution) in a water bath at 37℃for 40min. Virus particles were collected by centrifugation at 1000g for 30min using a 300Kd ultrafiltration centrifuge tube, eluting with 1 x PBS, and measuring a260, particle concentration = a260 x 1.1 x 10 x 12vp/mL.

2. Virus infection, 6-well plates of A549 cells were prepared, 2.5X10 cells per well ⁵ Well, medium was discarded, PBS was washed once, and adenovirus was washed 1X 10 ⁹ vp/well inoculated virus, infected A549 cells, wild type adenovirus type 5 as control, 37 ℃,5% CO ₂ After 1h, the virus solution was discarded, 5% complete medium was supplemented, 37℃and 5% CO ₂ Culturing for 48h.

3. Immunostaining, discarding cell supernatant, washing cells with PBS, fixing with ice methanol, standing at-20deg.C for 20min, washing with 1 XPBS three times for 5min each time, adding 2ml 1% BSA-PBS solution into each well, standing, and incubating for 1 hr. The supernatant was discarded, adenovirus type 5 fluorescent antibody (1:500 dilution) was added, incubated for 1h, and washed three times with 1 XPBS for 5min each.

Observation with a 10-fold fluorescence microscope, calculation of RCA using the formula

RCA＝(average positive cell field)×(374field/well)×(dilution factor))/Total VPs in 0.5ml viral sample

The judgment standard is that the RCA level is less than 1RCA/3×10 ¹⁰ vp. RCA levels of less than 1 RCA/3X 10 were obtained by counting pAd5LCL3-F317L-A151R-P34-pp62 ¹⁰ vp shows that the replication defective pAd5LCL3-F317L-A151R-P34-pp62 virus prepared by the invention can be stably packaged in 293TD37 cells, and can not be converted into a wild type or has a lower probability of being converted into the wild type.

Example 11 African swine fever Multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 protein expression detection

293TD37 cells are prepared one day in advance, placed in a 12-well cell culture plate, the 293TD37 cells are infected by using an African swine fever multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 virus, lesions are generated on the cells after 48 hours, all 1ml of cells are collected, washed by PBS, and prepared into a sample for Western Blot detection; the target protein was detected using the pp62 murine polyclonal antiserum prepared by this company, and the pp62 murine polyclonal antiserum was obtained from immunized mice with the pp62 protein expressed by the insect SF9 system. The pp62 protein has a size of 60kda;

as shown in FIG. 48, lane 4 is a sample of 293TD37 cells infected with pAd5LCL3-F317L-A151R-P34-pp 62; it is clear that the pp62 protein is normally expressed, and thus it is seen that the protein of the pAd5LCL3-F317L-A151R-P34-pp62 vaccine is normally expressed in 293 cells.

EXAMPLE 12 immunological evaluation of African swine fever Multi-antigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 on a mouse model

12.1 vaccine humoral immune response detection

20 SPF-class mice (6-8 weeks old) were randomly divided into 4 groups of 5 mice each. Mice were immunized with pAd5LCL3-F317L-A151R-P34-pp62 according to the groupings shown in Table 1. The injection mode is as follows: intramuscular injection of the inner thigh; injection dose: 100ul.

Table 1: vaccine immunodetection of grouping condition of mice

Mice were collected at 14 days post immunization, serum was isolated, and the serum was assayed for pp62 antibody titer against african swine fever target protein (pp 62 protein was prepared by the present company and expressed in insect cells) using an indirect ELISA method. The detection results are shown in fig. 55: after intramuscular injection of pAd5LCL3-F317L-A151R-P34-pp62, mice were able to produce higher concentrations of IgG antibodies against the pp62 protein. High dose group antibody titer averages up to 10 ⁵ The average value of the titer of the medium-dose group reaches 70000, and the medium-dose group has obvious difference from the control group.

12.2 cell immunoreaction detection

10 SPF-class mice (6-8 weeks old) were randomly divided into 2 groups of 5 mice each. Mice were immunized with pAd5LCL3-F317L-A151R-P34-pp62 according to the groupings shown in Table 2. The injection mode is as follows: intramuscular injection of the inner thigh; injection dose: 100ul.

Table 2: vaccine immunodetection of grouping condition of mice

Mice were sacrificed 14 days after immunization, spleen lymphocytes were isolated, and PK15 cells transfected with the shuttle plasmids pS5E1-F317L-IRES-A151R and pS5E4-P34-2A-pp62 were stimulated for 6 hours while cytokine secretion was blocked by the addition of a protein secretion blocking agent. After 6 hours, fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after cells were fixed and perforated. Cell surface markers include CD4, CD8, intracellular cytokines include ifnγ, IL2. The levels of ifnγ and IL2 expressed by cd4+ T cells and cd8+ T cells after stimulation with the protein of interest were analyzed using a flow cytometer (cyexper).

The pAd5LCL3-F317L-A151R-P34-pp62 induced CD8+ T cell and CD4+ T cell immunoreactions are shown in FIGS. 56 and 57, and representative results are shown in FIGS. 58-59, wherein FIG. 58 is a representative graph of the cell immunoreactions after intramuscular injection of pAd5LCL3-F317L-A151R-P34-pp62, and FIG. 59 is a representative graph of the blank immunoreactions. The results show that: 14 days after mice were immunized, splenocytes were stimulated with the protein of interest, and cd8+ T cells expressed ifnγ, tnfα, and IL2 levels significantly higher than Ad5 vector Control (Control) (P < 0.05). After stimulation, cd4+ T cells expressed ifnγ, tnfα and IL2 levels were significantly higher than Ad5 vector Control (Control) (P < 0.05).

12.3 mouse model immunogenicity evaluation node

pAd5LCL3-F317L-A151R-P34-pp62 recombinant adenovirus has good immunogenicity, and can induce mice to produce high-level serum IgG antibodies. Wherein the immune-induced titers of both high doses of 1 x 10 x 8FFU and medium doses of 1 x 10 x 7FFU are high. The cell immune response detection result shows that the adenovirus vector vaccine of 1 x 10 x 7FFU is injected into muscle and can induce the immunized mice to generate specific cell immune response.

Although the present invention is disclosed above, the present invention is not limited thereto. Various changes and modifications may be made by one skilled in the art without departing from the spirit and scope of the invention, and the scope of the invention should be assessed accordingly to that of the appended claims.

Sequence listing

<110> Jiaxing An Yu Biotech Co.Ltd

<120> a recombinant adenovirus vaccine for African swine fever and construction method thereof

<150> 2020106427542

<151> 2020-07-06

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 972

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggtggaga cccagatgga caagctgggg ttcctgctga accacatcgg caagcaggtg 60

accaccaagg tgctgagcaa cgcccacatc acccagacca tgaaggaaat catcctggag 120

aatcacagcg tggacggcgg cgccgccaag aacgtgagca agggcaagag cagccccaaa 180

gaaaaaaagc actggaccga gttcgagagc tgggagcagc tgagcaagag caagcgcagc 240

ttcaaggagt actgggccga gcgcaacgag atcgtgaaca ccctgctgct gaactgggac 300

aacgtgcgcg gcgccatcaa gaagttcctg gacgacgacc gcgagtggtg cggccggatc 360

aacatgatca acggcgtgcc cgagatcgtg gagatcatcc ccagccccta ccgcgccggc 420

gagaacatct acttcggcag cgaggccatg atgcccgccg acatctacag ccgcgtggcc 480

aacaagcccg ccatgttcgt gttccacacc caccccaacc tgggcagctg ctgcggcggc 540

atgcccagca tctgcgacat cagcaccacc ctgcgctacc tgctgatggg ctggaccgcc 600

ggccacctga tcatcagcag caaccaggtg ggcatgctga ccgtggacaa gcgcatcatc 660

gtggacctgt gggccaacga gaacccccgc tggctgatgg cccagaagat cctggacatc 720

ttcatgatgc tgaccagccg ccgcagcctg gtgaacccct ggaccctgcg cgacctgaag 780

aagatcctgc aggactacgg catcgagtac atcatcttcc ccagcaacga cttcttcatc 840

tacgaggacg agcgcctgct gatgttcagc aagaagtgga ccaacttctt caccctgcac 900

gagctgctgg acgacctgga gaccatcgag accaaggcca gcagcaccac ccaccaccac 960

caccaccact ga 972

<210> 2

<211> 495

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgaacaaga agatcatcgt gatgatggcc ctgctgcaca aggagaagct gatcgagtgc 60

atctaccacg agctggaaaa cggcggaacc atcctgctgc tgaccaagaa catcgtggtc 120

tccgagatca gctacattgg caacacctac aaatacttca ccttcaacga caaccacgac 180

ctcatcagca aagaagacct gaagggcgcc acctccaaaa acatcgccaa aatgatctac 240

aactggatca tcaaaaaccc ccagaacaac aagatctggt ccggcgaacc ccgcacccag 300

atctacttcg agaacgacct gtaccacacc aactacaacc acaaatgcat caaggacttc 360

tggaacgtga gcacctccgt gggcccccac atctttaacg accgctccat ctggtgcacc 420

aagtgcacca gcttttaccc cttcaccaac atcatgtccc ccaacatctt ccagcaccat 480

caccaccacc actga 495

<210> 3

<211> 1101

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggggaatc gcgggtcttc tacctcctct cgccccctgc cctcctccga agccaatatc 60

tatgccaagc tgcaggacca tatccagcgc cagacccgcc ccttctccgg aggaggatac 120

tttaacggag gcggcgacaa aaaccccgtg cagcacatca aggactacca catcgacagc 180

gtgagctcca aagccaagct cagaatcatc gaaggaatta tccgcgccat cgccaagatc 240

ggctttaagg tggacacaaa acagcccatc gaagacatcc tcaaggacat caagaaacag 300

ctgcccgacc cccgcgccgg ctctaccttt gtgaagaacg ccgaaaaaca ggaaaccgtc 360

tgcaagatga ttgccgacgc catcaaccag gaattcatcg acctgggcca ggacaagctg 420

atcgacacca ccgaaggggc cgcctccatc tgccgccaga tcgtcctcta tatcaatagc 480

ctgacccacg gactgcgggc cgaatacctg gacgtgcacg gcagcatcga gaacaccctg 540

gaaaacatca aactgctgaa cgacgccatc aaacagctgc acgaacggat ggtgaccgaa 600

gtgaccaagg ccgcccccaa cgaggaagtg attaacgctg tgacaatgat cgaagccgtg 660

taccgccgcc tgctcaacga gcagaacctc cagatcaaca tcctcaccaa cttcatcgac 720

aacatcctga cccccaccca gaaagaactg gacaagctcc agaccgacga agtcgacatc 780

atcaaactcc tcaacgacac caacagcgtc ctcggcacca aaaacttcgg caaagtgctg 840

agctacaccc tctgcaacct gggcatcgcc gccagcgtcg ccaacaagat caacaaggcc 900

ctccagaaag tgggactgaa ggtggagcag tatctccaga gcaagaactg ggccgaattc 960

gacaaagaac tcgacctgaa acgcttctcc ggcctggtga gcgccgagaa catcgccgaa 1020

ttcgagaagg ctgtgaacct gctgaggcag accttcaacg aaaggcacaa gatcctggag 1080

aacagctgcg ccaaaaaggg c 1101

<210> 4

<211> 1587

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgcccagca acatgaagca gttctgcaag atcagcgtgt ggctgcagca gcacgacccc 60

gacctcctgg agatcatcaa caacctctgc atgctgggga acctgagcgc cgccaagtac 120

aagcacggcg tgacattcat ctacccaaag caggccaaga tccgcgacga aattaaaaag 180

cacgcctaca gcaacgaccc cagccaggcc atcaagaccc tcgaatccct catcctccca 240

ttctacatcc ccacccccgc cgaattcacc ggagagatcg gcagctacac cggggtgaag 300

ctggaggtgg aaaaaaccga ggccaacaag gtgatcctga agaacggcga ggccgtgctg 360

gtgcccgccg ccgacttcaa gcccttcccc gaccgccgcc tggccgtgtg gatcatggag 420

agcggcagca tgcccctgga gggccccccc tacaagcgca agaaggaggg cggcggcaac 480

gacccccccg tgcccaagca catcagcccc tacacccccc gcacccgcat cgccatcgag 540

gtggagaagg ccttcgacga ctgcatgcgc cagaactggt gcagcgtgaa caacccctac 600

ctggccaaga gcgtgagcct gctgagcttc ctgagcctga accaccccac cgagttcatc 660

aaggtgctgc ccctgatcga cttcgacccc ctggtgacct tctacctgct gctggagccc 720

tacaagaccc acggcgacga cttcctgatc cccgagacca tcctgttcgg ccccaccggc 780

tggaacggca ccgacctgta ccagagcgcc atgctggagt tcaagaagtt cttcacccag 840

atcacccgcc agaccttcat ggacatcgcc gacagcgcca ccaaggaggt ggacgtgccc 900

atctgctaca gcgaccccga gaccgtgcac agctacgcca accacgtgcg caccgagatc 960

ctgcaccaca acgccgtgaa caaggtgacc acccccaacc tggtggtgca ggcctacaac 1020

gagctggagc agaccaacac catccgccac tacggcccca tcttccccga gagcaccatc 1080

aacgccctgc gcttctggaa gaagctgtgg caggacgagc agcgcttcgt gatccacggc 1140

ctgcaccgca ccctgatgga ccagcccacc tacgagacca gcgagttcgc cgagatcgtg 1200

cgcaacctgc gcttcagccg ccccggcaac aactacatca acgagctgaa catcaccagc 1260

cccgccatgt acggcgacaa gcacaccacc ggcgacatcg cccccaacga ccgcttcgcc 1320

atgctggtgg ccttcatcaa cagcaccgac ttcctgtaca ccgccatccc cgaggagaag 1380

gtgggcggca acgagaccca gaccagcagc ctgaccgacc tggtgcccac ccgcctgcac 1440

agcttcctga accacaacct gagcaagctg aagatcctga accgcgccca gcagaccgtg 1500

cgcaacatcc tgagcaacga ctgcctgaac cagctgaagc actacgtgaa gcacaccggc 1560

aagaacgaga tcctgaagct gctgtaa 1587

<210> 5

<211> 32619

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

agcttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca cttgataacc 60

ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc ggaatcgcag 120

accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct ccttcattac 180

agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa ttgcagtttc 240

atttgatgct cgatgagttt ttctaatcag aattggttaa ttggttgtaa cactggcaga 300

gcattacgct gacttgacgg gacggcggct ttgttgaata aatcgaactt ttgctgagtt 360

gaaggatcag atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt 420

caaaatcacc aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt 480

ctggctggat gatggggcga ttcaggcctg gtatgagtca gcaacacctt cttcacgagg 540

cagacctcag cgctcaaaga tgcaggggta aaagctaacc gcatctttac cgacaaggca 600

tccggcagtt caacagatcg ggaagggctg gatttgctga ggatgaaggt ggaggaaggt 660

gatgtcattc tggtgaagaa gctcgaccgt cttggccgcg acacgccgac atgatccaac 720

tgataaaaga gtttgatgct cagggtgtag cggttcggtt tattgacgac gggatcagta 780

ccgacggtga tatggggcaa atggtggtca ccatcctgtc ggctgtggca caggctgaac 840

gccggaggat cctagagcgc acgaatgagg gccgacagga agcaaagctg aaaggaatca 900

aatttggccg caggcgtacc gtggacagga gcgtcgattt ttgtgatgct cgtcaggggg 960

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 1020

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 1080

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 1140

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 1200

tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 1260

aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 1320

tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca 1380

tgattacgcc aagcttgcat gcctgcaggt cgatcgatta attaacgacc catcatcaat 1440

aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt ttgtgacgtg 1500

gcgcggggcg tgggaacggg gcgggtgacg taggttttag ggcggagtaa cttgtatgtg 1560

ttgggaattg tagttttctt aaaatgggaa gttacgtaac gtgggaaaac ggaagtgacg 1620

atttgaggaa gttgtgggtt ttttggcttt cgtttctggg cgtaggttcg cgtgcggttt 1680

tctgggtgtt ttttgtggac tttaaccgtt acgtcatttt ttagtcctat atatactcgc 1740

tctgcacttg gccctttttt acactgtgac tgattgagct ggtgccgtgt cgagtggtgt 1800

tattaccctg ttatccctag caattgaaaa ataaacacgt tgaaacataa cacaaacgat 1860

tctttattct tgggcaatgt atgaaaaagt gtaagaggat gtggcaaata tttcattaat 1920

gtagttgtgg ccagaccagt cccatgaaaa tgacatagag tatgcacttg gagttgtgtc 1980

tcctgtttcc tgtgtaccgt ttagtgtaat ggttagtgtt acaggtttag ttttgtctcc 2040

gtttaagtaa acttgactga caatgttact tttggcagtt ttaccgtgag attttggata 2100

agctgatagg ttaggcataa atccaacagc gtttgtatag gctgtgcctt cagtaagatc 2160

tccatttcta aagttccaat attctgggtc caggaaggaa ttgtttagta gcactccatt 2220

ttcgtcaaat cttataataa gatgagcact ttgaactgtt ccagatattg gagccaaact 2280

gcctttaaca gccaaaactg aaactgtagc aagtatttga ctgccacatt ttgttaagac 2340

caaagtgagt ttagcatctt tctctgcatt tagtctacag ttaggagatg gagctggtgt 2400

ggtccacaaa gttagcttat cattattttt gtttcctact gtaatggcac ctgtgctgtc 2460

aaaactaagg ccagttccta gtttaggaac catagccttg tttgaatcaa attctaggcc 2520

atggccaatt tttgttttga ggggatttgt gtttggtgca ttaggtgaac caaattcaag 2580

cccatctcct gcattaatgg ctatggctgt agcgtcaaac atcaacccct tggcagtgct 2640

taggttaacc tcaagctttt tggaattgtt tgaagctgta aacaagtaaa ggcctttgtt 2700

gtagttaata tccaagttgt gggctgagtt tataaaaaga gggccctgtc ctagtcttag 2760

atttagttgg ttttgagcat caaacggata actaacatca agtataaggc gtctgttttg 2820

agaatcaatc cttagtcctc ctgctacatt aagttgcata ttgccttgtg aatcaaaacc 2880

caaggctcca gtaactttag tttgcaagga agtattatta atagtcacac ctggaccagt 2940

tgctacggtc aaagtgttta ggtcgtctgt tacatgcaaa ggagccccgt actttagtcc 3000

tagttttcca ttttgtgtat aaatgggctc tttcaagtca atgcccaagc taccagtggc 3060

agtagttaga gggggtgagg cagtgatagt aagggtactg ctatcggtgg tggtgagggg 3120

gcctgatgtt tgcagggcta gctttccttc tgacactgtg aggggtcctt gggtggcaat 3180

gctaagtttg gagtcgtgca cggttagcgg ggcctgtgat tgcatggtga gtgtgttgcc 3240

cgcgaccatt agaggtgcgg cggcagccac agttagggct tctgaggtaa ctgtgagggg 3300

tgcagatatt tccaggttta tgtttgactt ggtttttttg agaggtgggc tcacagtggt 3360

tacattttgg gaggtaaggt tgccggcctc gtccagagag aggccgttgc ccattttgag 3420

cgcaagcatg ccattggagg taactagagg ttcggatagg cgcaaagaga gtaccccagg 3480

gggactctct tgaaacccat tgggggatac aaagggagga gtaagaaaag gcacagttgg 3540

aggaccggtt tccgtgtcat atggatacac ggggttgaag gtatcttcag acggtcttgc 3600

gcgcttcatc tgcaacaaca tgaagatagt gggtgcggat ggacaggaac aggaggaaac 3660

tgacattcca tttagattgt ggagaaagtt tgcagccagg aggaagctgc aataccagag 3720

ctgggaggag ggcaaggagg tgctgctgaa taaactggac agaaatttgc taactgattt 3780

taagtaagtg atgctttatt attttttttt attagttaaa gggaataaga tctttgagac 3840

cgcacagggt cttaataagg gtgcagagat cctcaggtcc ttgacaaggt gagtgaatgc 3900

agccttcggt ttctaccgag tgctgagtta tggtaatggg cttttctccc accatgacca 3960

ccaatttctg acgcttggtt ggcaacttgt agctaaggcg gtgtccggtg gtattactgt 4020

cgtaggtgac tttggcctgc tttaccagac aaaagatacc ccttttgcac tggtgcaagt 4080

taaccatgtc ttggagctct tgattcatgc gctgttgctc ggccgctgcc ctgcgtcttt 4140

ctagcaggcg ctgctctgta ataattccgt ccatttctag ctagagaaac ctgaattaga 4200

atagcccgta gagttgcttg aattgttcat aaaccccaca gtagctgcgc ctttggccta 4260

ataccctaag ggttttctaa gctcacctcc tgttctggta aacagagtta ttgaggtctg 4320

tccggaaaaa gtctggttta cggtcaggcg gtaggtgtgg tgcagcggcc ggtgacgcac 4380

tcgtacgttc ccggcaggta aggagggtgg tgttttttct gatggagtag ctgagctcgg 4440

agaggttctc tcgtagactc actccgtctg ggttgaaact gttgtaaatc acagagggag 4500

agatgttaaa agtaccaggt aaggttcgcc ttggtttgct tgggcgggtg aagacggtgg 4560

cgtttacagg atggcgatag gagccccagt atattttaat ttctgtattt attatactca 4620

gcacagagat ggcaacaaag atcttgatgt aatccagggt taggacagtt gcaaatcaca 4680

gtgagaacac agggtcccct gtcccgctca actagcaggg ggcgctgggt aaactcccga 4740

atcaggctac gggcaagctc tccctgggcg gtaagccgga cgccgtgcgc cgggccctcg 4800

atatgatcct cgggcaattc aaagtagcaa aactcaccgg agtcgcgggc aaagcacttg 4860

tggcggcgac agtggaccag gtgtttcagg cgcagttgct ctgcctctcc acttaacatt 4920

cagtcgtagc cgtccgccga gtcctttacc gcgtcaaagt taggaataaa ttgatccgga 4980

tagtggccgg gaggtcccga gaaggggtta aagtagaccg atggcacaaa ctcctcaata 5040

aattgcagag ttccaatgcc tccagagcgc ggctcagagg acgaggtctg cagagttagg 5100

attgcctgac gaggcgtgaa tgaagagcgg ccggcgccgc cgatctgaaa tgtcccgtcc 5160

ggacggagac caagcgagga gctcaccgac tcgtcgttga gctgaatacc tcgccctctg 5220

attgtcaggt gagttatacc ctgcccgggc gaccgcaccc tgtgacgaaa gccgcccgca 5280

agctgcgccc ctgagttagt catctgaact tcggcctggg cgtctctggg aagtaccaca 5340

gtggtgggag cgggactttc ctggtacacc agggcagcgg gccaactacg gggattaagg 5400

ttattacgag gtgtggtggt aatagccgcc tgttccagga gaattcggtt tcggtgggcg 5460

cgtattccgt tgacccggga tatcatgtgg ggtcccgcgc tcatgtagtt tattcgggtt 5520

gagtagtctt gggcagctcc agccgcaagt cccatttgtg gctggtaact ccacatgtag 5580

ggcgtgggaa tttccttgct cataatggcg ctgacaacag gtgctggcgc cgggtgtggc 5640

cgctggagat gacgtagttt tcgcgcttaa atttgagaaa gggcgcgaaa ctagtcctta 5700

agagtcagcg cgcagtattt actgaagaga gcctccgcgt cttccagcgt gcgccgaagc 5760

tgatcttcgc ttttgtgata caggcagctg cgggtgaggg atcgcagaga cctgtttttt 5820

attttcagct cttgttcttg gcccctgctc tgttgaaata tagcatacag agtgggaaaa 5880

atcctgtttc taagctcgcg ggtcgatacg ggttcgttgg gcgccagacg cagcgctcct 5940

cctcctgctg ctgccgccgc tgtggatttc ttgggctttg tcagagtctt gctatccggt 6000

cgcctttgct tctgtgtggc cgctgctgtt gctgccgctg ccgccggtgc agtatgggct 6060

gtagagatga cggtagtaat gcaggatgtt acgggggaag gccacgccgt gatggtagag 6120

aagaaagcgg cgggcgaagg agatgttgcc cccacagtct tgcaagcaag caactatggc 6180

gttcttgtgc ccgcgccatg agcggtagcc ttggcgctgt tgttgctctt gggctaacgg 6240

cggcggctgc ttggacttac cggccctggt tccagtggtg tcccatctac ggttgggtcg 6300

gcgaacgggc agtgccggcg gcgcctgagg agcggaggtt gtagccatgc tggaaccggt 6360

tgccgatttc tggggcgccg gcgaggggaa tgcgaccgag ggtgacggtg tttcgtctga 6420

cacctcttcg acctcggaag cttcctcgtc taggctctcc cagtcttcca tcatgtcctc 6480

ctcctcctcg tccaaaacct cctctgcctg actgtcccag tattcctcct cgtccgtggg 6540

tggcggcggc agctgcagct tctttttggg tgccatcctg ggaagcaagg gcccgcggct 6600

gctgctgata gggctgcggc ggcgggggga ttgggttgag ctcctcgccg gactgggggt 6660

ccaagtaaac cccccgtccc tttcgtagca gaaactcttg gcgggctttg ttgatggctt 6720

gcaattggcc aagaatgtgg ccctgggtaa tgacgcaggc ggtaagctcc gcattaggcg 6780

ggcgggattg gtcttcgtag aacctaatct cgtgggcgtg gtagtcctca ggtacaaatt 6840

tgcgaaggta agccgacgtc cacagccccg gagtgagttt caaccccgga gccgcggact 6900

tttcgtcagg cgagggaccc tgcagctcaa aggtaccgat aatttgactt tcgttaagca 6960

gctgcgaatt gcaaaccagg gagcggtgcg gggtgcatag gttgcagcga cagtgacact 7020

ccagtagacc gtcaccgctc acgtcttcca ttatgtcaga gtggtaggca aggtagttgg 7080

ctagctgcag aaggtagcag tggccccaaa gcggcggagg gcattcgcgg tacttaatgg 7140

gcacaaagtc gctaggaagt gcacagcagg tggcgggcaa gattcctgag cgctctagga 7200

taaagttcct aaagttctgc aacatgcttt gactggtgaa gtctggcaga ccctgttgca 7260

gggttttaag caggcgttcg gggaaaatga tgtccgccag gtgcgcggcc acggagcgct 7320

cgttgaaggc cgtccatagg tccttcaagt tttgctttag cagtttctgc agctccttga 7380

ggttgcactc ctccaagcac tgctgccaaa cgcccatggc cgtctgccag gtgtagcata 7440

gaaataagta aacgcagtcg cggacgtagt cgcggcgcgc ctcgcccttg agcgtggaat 7500

gaagcacgtt ttgcccaagg cggttttcgt gcaaaattcc aaggtaggag accaggttgc 7560

agagctccac gttggagatc ttgcaggcct ggcgtacgta gccctgtcga aaggtgtagt 7620

gcaatgtttc ctctagcttg cgctgcatct ccgggtcagc aaagaaccgc tgcatgcact 7680

caagctccac ggtaacgagc actgcggcca tcattagttt gcgtcgctcc tccaagtcgg 7740

caggctcgcg cgtttgaagc cagcgcgcta gctgctcgtc gccaactgcg ggtaggccct 7800

cctctgtttg ttcttgcaaa tttgcatccc tctccagggg ctgcgcacgg cgcacgatca 7860

gctcactcat gactgtgctc atgaccttgg ggggtaggtt aagtgccggg taggcaaagt 7920

gggtgacctc gatgctgcgt tttagtacgg ctaggcgcgc gttgtcaccc tcgagttcca 7980

ccaacactcc agagtgactt tcattttcgc tgttttcctg ttgcagagcg tttgccgcgc 8040

gcttctcgtc gcgtccaaga ccctcaaaga tttttggcac ttcgttgagc gaggcgatat 8100

caggtatgac agcgccctgc cgcaaggcca gctgcttgtc cgctcggctg cggttggcac 8160

ggcaggatag gggtatcttg cagttttgga aaaagatgtg ataggtggca agcacctctg 8220

gcacggcaaa tacggggtag aagttgaggc gcgggttggg ctcgcatgtg ccgttttctt 8280

ggcgtttggg gggtacgcgc ggtgagaata ggtggcgttc gtaggcaagg ctgacatccg 8340

ctatggcgag gggcacatcg ctgcgctctt gcaacgcgtc gcagataatg gcgcactggc 8400

gctgcagatg cttcaacagc acgtcgtctc ccacatctag gtagtcgcca tgcctttcgt 8460

ccccccgccc gacttgttcc tcgtttgcct ctgcgttgtc ctggtcttgc tttttatcct 8520

ctgttggtac tgagcggtcc tcgtcgtctt cgcttacaaa acctgggtcc tgctcgataa 8580

tcacttcctc ctcctcaagc gggggtgcct cgacggggaa ggtggtaggc gcgttggcgg 8640

catcggtgga ggcggtggtg gcgaactcag agggggcggt taggctgtcc ttcttctcga 8700

ctgactccat gatctttttc tgcctatagg agaaggaaac ttgtatgtgt tgggaattgt 8760

agttttctta aaatgggaag ttacgtaacg tgggaaaacg gaagtgacga tttgaggaag 8820

ttgtgggttt tttggctttc gtttctgggc gtaggttcgc gtgcggtttt ctgggtgttt 8880

tttgtggact ttaaccgtta cgtcattttt tagtcctata tatactcgct ctgcacttgg 8940

ccctttttta cactgtgact gattgagctg gtgccgtgtc gagtggtgtt tttttaatag 9000

gttttctttt ttactggtaa ggctgactgt tatgactacg tccggcgttc catttggcat 9060

gacactacga ccaacacgat ctcggttgtc tcggcgcact ccgtacagta gggatcgtct 9120

acctcctttt gagacagaaa cccgcgctac catactggag gatcatccgc tgctgcccga 9180

atgtaacact ttgacaatgc acaacgtgag ttacgtgcga ggtcttccct gcagtgtggg 9240

atttacgctg attcaggaat gggttgttcc ctgggatatg gttctaacgc gggaggagct 9300

tgtaatcctg aggaagtgta tgcacgtgtg cctgtgttgt gccaacattg atatcatgac 9360

gagcatgatg atccatggtt acgagtcctg ggctctccac tgtcattgtt ccagtcccgg 9420

ttccctgcag tgtatagccg gcgggcaggt tttggccagc tggtttagga tggtggtgga 9480

tggcgccatg tttaatcaga ggtttatatg gtaccgggag gtggtgaatt acaacatgcc 9540

aaaagaggta atgtttatgt ccagcgtgtt tatgaggggt cgccacttaa tctacctgcg 9600

cttgtggtat gatggccacg tgggttctgt ggtccccgcc atgagctttg gatacagcgc 9660

cttgcactgt gggattttga acaatattgt ggtgctgtgc tgcagttact gtgctgattt 9720

aagtgagatc agggtgcgct gctgtgcccg gaggacaagg cgccttatgc tgcgggcggt 9780

gcgaatcatc gctgaggaga ccactgccat gttgtattcc tgcaggacgg agcggcggcg 9840

gcagcagttt attcgcgcgc tgctgcagca ccaccgccct atcctgatgc acgattatga 9900

ctctaccccc atgtagacta gggttctgtg agtttgatta aggtacggtg atctgtataa 9960

gctatgtggt ggtggggcta tactactgaa tgaaaaatga cttgaaattt tctgcaattg 10020

aaaaataaac acgttgaaac ataacacaaa cgatacggcg cagacggcaa gggtgggggt 10080

aaataatcac ccgagagtgt acaaataaaa gcatttgcct ttattgaaag tgtctctagt 10140

acattatttt tacatgtttt tcaagtgaca aaaagaagtg gcgctcctaa tctgcgcact 10200

gtggctgcgg aagtagggcg agtggcgctc caggaagctg tagagctgtt cctggttgcg 10260

acgcagggtg ggctgtacct ggggactgtt gagcatggag ttgggtaccc cggtaataag 10320

gttcatggtg gggttgtgat ccatgggagt ttggggccag ttggcaaagg cgtggagaaa 10380

catgcagcag aatagtccac aggcggccga gttgggcccc tgtacgcttt gggtggactt 10440

ttccagcgtt atacagcggt cgggggaaga agcaatggcg ctacggcgca ggagtgactc 10500

gtactcaaac tggtaaacct gcttgagtcg ctggtcagaa aagccaaagg gctcaaagag 10560

gtagcatgtt tttgagtgcg ggttccaggc aaaggccatc cagtgtacgc ccccagtctc 10620

gcgaccggcc gtattgacta tggcgcaggc gagcttgtgt ggagaaacaa agcctggaaa 10680

gcgcttgtca taggtgccca aaaaatatgg cccacaacca agatctttga caatggcttt 10740

cagttcctgc tcactggagc ccatggcggc agctgttgtt gatgttgctt gcttctttat 10800

gttgtggcgt tgccggccga gaagggcgtg cgcaggtaca cggtttcgat gacgccgcgg 10860

tgcggctggt gcacacggac cacgtcaaag acttcaaaca aaacataaag aagggtgggc 10920

tcgtccatgg gatccacctc aaaagtcatg tctagcgcgt gggcggagtt ggcgtagaga 10980

aggttttggc ccaggtctgt gagtgcgccc atggacataa agttactgga gaatgggatg 11040

cgccaaaggg tgcgatcgca aagaaacttt ttctgggtaa tgctgtcaac tgcggtcttg 11100

cctataagcg gataggggaa gttagcaggg taggcctgtc cttcgcgcat ggtgggggca 11160

aggtagccaa caaatccaga gttgttgtgt tggtgtagga tgcccacctg ttggtagtcc 11220

ttgtatttag tatcatccac cacctgacgg ctcatgggct ggaagtttct aaagaaggag 11280

tacatgcggt ccttgtagct ctctgggata tagaagccct ggtagccaat gttatagtta 11340

gctagcattt gtaccaggaa ccagtctttg gtcatgttac actgggcaac gttgtaaccc 11400

tccccgtcaa ctgagcgctt aatttcaaac tcgttggggg taagcaggcg gtcattgcca 11460

ggccagctga cagaagagtc aaaggtaatg gccaccttct taaaggtgtg gttgaggtaa 11520

aaggttccat ctaggtaggg tatagagcca gagtaggtgt aataagggtc gtagcccgag 11580

cccagtgatg gggtttcctt agtcttaagg cgcgtgaagg cccagccgcg gaaagccgcc 11640

cagttgcggg aggggatgga tatgggcacg ttggtagcgt tggcgggtat agggtagagc 11700

atgttggcgg cggagagata gtcgttaaag gactggtcgt tggtgtcgtt tctaagcatg 11760

gcctcaagcg tggaggcggt gttgtgggcc atggggaaga aggtggcgta aaggcaaatg 11820

ctatcaaact taatgctggc tccgtcaacc cttaggtcat ttcctaggga gctctgcaga 11880

accatgttaa catccttcct gaagttccac tcgtaggtgt atgagcccgg caggagaagg 11940

aggtttttaa tggcaaagaa cttctgaggc acctggatgt ggaagggcac atagcgacca 12000

ttgcccagca acattgagcg gtagcgcagg ccagcattgc ggtggtggtt aaatgggttg 12060

acgttgtcca tatagtcaag ggaccagcgt gctccaaggt taatgtagca gtccactagc 12120

ccgggagcca ccactcgctt gttcatgtag tcgtaggtgt ttgggttatc agaaattttt 12180

acgttggaag gactgtactt tagcttgtcg ggcaaataca gcgctatgtt ggagtacagg 12240

aaatttctcc acaggttggc atttagattg atttccatgg caaaattatt tccaactctt 12300

atttcatttt tatctgaaaa ttctgtagca tctttttccc atccattttc ctgacctgtt 12360

ttaggtttta ccttggtaag agtctctgta ttaatcacac ctcccagtgg aaagcagtaa 12420

tttggaagtt catcttcagt tccatgattt tcaataattc taacatctgg atcatagctg 12480

tcaacagcct gattccacat agaaaagtac ctggttctat caccaatgga atcaagcaaa 12540

agctggtatg aaagctctgt gtttctgtct tgcaaatcta caacagcatt caactgcgat 12600

gcttggcccg ccagaacacc catattaccc gtgctgttgt aatacattag accaataaaa 12660

ttgtccctaa aagcaatgta attaggcctg ttgggcatag attgttggcc cattagttct 12720

cgtgagttac cttccttaat agtgggcatg taagaaatat gagtgtctgg ggtttctata 12780

tctacatctt cactgtacaa taccacttta ggagtcaagt tatcaccatt gcctgcggct 12840

gcctcagtag ttgagaaaaa ttgcatttcc acttgacttt ctagctttcc attttgttgc 12900

tttacaagaa tgccttgccc tccattttca tttgtgggtt ttgcatatga accgtaacat 12960

ggtttcattg gggtagtctt ttttaggact ctcccagctg catgattaat ttctgtttcg 13020

taccactgag attctcctat ttgaggttca ggttgaaatg ttttatcggc atatttaggt 13080

gtttgacctt cgacacctat ttgaataccc tcctttgtaa tatttatacc agaataaggc 13140

gcctgcccaa atacgtgagt tttttgctgc tcagcttgct cgtctacttc gtcttcgttg 13200

tcatcgtcct cttcttctag gtttatttca agagcagtag cagcttcatc ccattcgcaa 13260

ggatttgggg cacccttggg agccagggcg ttgtaggcag tgccagagta gggcttaaaa 13320

gtagggcccc tgtccagcac gccgcggatg tcaaagtacg tggaagccat gtccagcaca 13380

cggttatcac ccacagctag ggtgaaccgc gccttgtacg agtacgcagt atcctcacgg 13440

tccacaggga tgaaccgcag cgtcaaacgc tgggaccggt ctgtggtcac gtcgtgcgta 13500

ggcgccaccg tggggtttct aaacttgtta ttcaggctga agtacgtctc ggtggcgcgg 13560

gcaaactgca ccagcccggg gctcaggtac tccgaggcgt cctggcccga gatgtgcatg 13620

taagaccact gcggcatcat cgaaggggta gccatcttgg aaagcgggcg cgcggcggct 13680

cagcagctcc tctggcggcg acatggacgc atacatgaca cacatacgac acgttagcta 13740

tcagaagcat cgtcggcgct tcagggattg cacccccaga cccacgatgc tgttcagtgt 13800

gctttgccag ttgccactgg ctacgggccg caacgatcgc ggaccgctgg cggcgcggcg 13860

cagggacgcg cggctaggac gggttacaac aacggcggtc gggcctggca gcacaggttt 13920

ctgctgggtg tcggcggggg gaggcaggtc cagcgttacg ggtgtgtgct ggcccagcac 13980

tccggtagcc atgggcgcga tgggacgggt ggtgggcagg ccttgcttta gtgcctcctc 14040

gtacgaggga ggctcgtcta tttgcgtcac cagagtttct tccctgtcgg ggcgcggacg 14100

cttttcgcca cgcccctctg gagacactgt ctccacggcc ggtggaggct cctctacggg 14160

agggcgggga tcaagcttac tgttaatctt attttgcact gcctggttgg ccaggtccac 14220

caccccgcta atgccagagg ccaggccatc taccaccttt tgttggaaat tttgctcttt 14280

caacttatcc ctcagcatct ggcctgtgct gctgttccag gccttgctgc catagttctt 14340

aacggtggaa ccgaaatttt taatgccgct ccacagcgag ccccagctga aggcgccacc 14400

gctcatattg ctggtgccga tatcttgcca gtttcccatg aacgggcgcg agccgtgtcg 14460

cggggccaga gacgcaaagt tgatgtcttc cattctacaa aatagttaca ggaccaagcg 14520

agcgtgagag tccagacttt ttattttgat ttttccacat gcaacttgtt tttaatcagt 14580

gtctctgcgc ctgcaaggcc acggatgcaa ttccgggcac ggcgccaatc gccgcggcga 14640

tcagtggaat aaggaggggc aggataccgc cgcgcatgcg acggtgcgac gcgcgccgcc 14700

gccggtggtg cgcacgacgc atgccgcccg tcaggccgtg gccggccatg cccctcctac 14760

ggtgcattct tcctcggaat cccggcaccg ggaaacggag gcggcaggtg agggccatat 14820

ctgcaagaac cacaaagacc ggcttttaaa cgatgctggg gtggtagcgc gctgttggca 14880

gcaccagggt cctgcctcct tcgcgagcca ccctgcgcac ggaaatcggg gccagcacgg 14940

gctggcgacg gcgacggcgg cggcgggttc cagtggtggt tcggcgtcgg gtagttgctc 15000

gtcttctggg gcggtaggtg tagccacgat agccgggggt aggcgcaatg gaaggatgta 15060

gggcatattc gggcagtagc gcgctggcgg cgccgtactt cctcgaacgg cgcgggcgcc 15120

ggggggctga aacgcgaaac atccacgggt ccgtttgcac ctccgtagag gtcttggacg 15180

cggccgcagc gaccgcctgc accgcggcat ccgccaccgc tgaggcaacc ggggacgttt 15240

gtgtctccat gccctctgtg gcggtggcaa tactggtgct actggtagtg ggtatctgaa 15300

cgtccacggt ctgcacgccc agtcccggcg ccacctgctt gattggccgc acgcggacct 15360

cgggctccag cccaggttcc acggtcattt tttccaagac atcttccagt cgctggcgct 15420

tgggtaccat cagctgcacg gtgggtgcca agtcaccaga ctcgcgcttt aggccgcgct 15480

tttcttcgga cggtgcaagc gcgggcagca cctgctgcag tgttacgggc tttaggctag 15540

gtgttgggtt gccctcgtcc agcggcaacg ccagcatgtc cttatgccgc tttccgtagg 15600

caaactcccc gaggcgctcg ttggcctgct caagcaggtc ctcgtcgccg tacacctcat 15660

catacacgcg cttgtaggtg cgggtggagc gctcaccggg cgtaaagact acggtggtgc 15720

cgggtcgcaa aacacgtttt acgcgtcgac ctttccactg tacccgtcgc ctgggcgcgg 15780

tagcgtgcag cagttccacc tcgtcgtcaa gttcatcatc atcatctttc tttttctttt 15840

tgacccgctt tagctttcgg ggcttgtaat cctgctcttc cttcttcggg gggccataga 15900

tctccggcgc gatgacctgg agcatctctt ctttgatttt gcgcttggac atagcttcgt 15960

tgcgcgccgc cgccgctgga tacatacaac agtacgagtc taagtagttt tttcttgcaa 16020

tctagttgcg cggggggcgg gtgcgcacgg gcacgcgcag gccgctaacc gagtcgcgca 16080

cccaatacac gttgcccctg cgaccctgag tcatagcact aatggccgcg gctgctgcgg 16140

cggccgctcg tcgcctggac ctggggggca cagtgacaat acccgcggcc agccttcgag 16200

cggcccgcat ggccgcccgt cggccggtgc gacgtgcgcg gttaagcagg gccgccgccg 16260

cgcgttgggc ggcagtgccg ggtcggcggc ggtggcgacg tgctacgcgc ctccgccgtc 16320

tcttcatttt agcatagcgc cgggctccgc gcaccacggt ctgaatggcc gcgtccactg 16380

tggacactgg tggcggcgtg ggcgtgtagt tgcgcgcctc ctccaccacc gcgtcgatgg 16440

cgtcatcgac ggtggtgcgc ccagtgcggc cgcgtttgtg cgcgccccag ggcgcgcggt 16500

agtgcccgcg cacgcgcact gggtgttggt cggagcgctt cttggccccg ccaaacatct 16560

tgcttgggaa gcgcaggccc cagcctgtgt tattgctggg cgatataagg atggacatgc 16620

ttgctcaaaa agtgcggctc gataggacgc gcggcgagac tatgcccagg gccttgtaaa 16680

cgtaggggca ggtgcggcgt ctggcgtcag taatggtcac tcgctggact cctccgatgc 16740

tgttgcgcag cggtagcgtc ccgtgatctg tgagagcagg aacgttttca ctgacggtgg 16800

tgatggtggg ggctggcggg cgcgccaaaa tctggttctc gggaaagcga ttgaacacgt 16860

gggtcagaga ggtaaactgg cggatgagtt gggagtagac ggcctggtcg ttgtagaagc 16920

tcttggagtg cacgggcaac agctcggcgc ccaccaccgg aaagttgctg atctggcgcg 16980

tggagcggaa ggtcacgggg tcttgcatca tgtctggcaa cgaccagtag acctgctccg 17040

agccgcaggt tacgtcagga gtgcaaagca gggtccatga gcggattccg gtctgagggt 17100

cgccgtagtt gtatgcaagg taccagctgc ggtactgggt gaaggtgctg tcattgctta 17160

ttaggttgta actgcgtttc ttgctgtcct ctgtcagggg tttgatcacc ggtttcttct 17220

gaggcttctc gacctcgggt tgcgcagcgg gggcggcagc ttcggccgct gcttcggcct 17280

cagcgcgctt ctcctcagcc cgtgtggcaa aggtgtcgcc gcgaatggca tgatcgttca 17340

tgtcctccac cggctgcatt gccgcggctg ccgcgttgga gttctcttcc gcgccgctgc 17400

cactgctgtt gctgccgcct gcgccacccc cgccctgttc ggtgtcatct ttcaagctcg 17460

cctggtaggc gtccacatcc aacagtgcgg gaatgttacc accctccaga tcatcgtagg 17520

tgatcctaaa gccctcctgg aagggttgcc gcttgcggat gcccaacaag ttgctcaggc 17580

ggctgtgggt gaagtccacc ccgcatcctg gcagcaaaat gatgtctgga tggaaggctt 17640

cgtttgtata taccccaggc atgacaagac cagtgacggg gtcaaacccc agtctgaagt 17700

tgcgggtgtc aaactttacc ccgatgtcgc tttccagaac cccgttctgt ctgcccactt 17760

tcaagtagtg ctccacgatc gcgttgttca taaggtctat ggtcatggtc tcggagtagt 17820

tgccctcggg cagcgtgaac tccacccact cgtatttcag ctccacctga ttgtccttag 17880

taggcaagcg cgacaccatc acccgcgcct taaacttatt ggtaaacatg aactcgttca 17940

catttggcat gttggtatgc aggatggttt tcaggtcgcc gccccagtgc gaccggtcgt 18000

caagattgat ggtctgtgtg cttgcctccc ccgggctgta gtcattgttt tgaatgaccg 18060

tggtcagaaa gttgctgtgg tcgttctggt agttcaggga tgccacatcc gttgacttgt 18120

tgtccaccag gtacacacgg gtggtgtcga ataggggtgc caactcagag taacggatgc 18180

tgtttctccc cccggtaggc cgcaggtacc gcggaggcac aaacggcggg tccaggggag 18240

catcgaaggg agaacccagc gccgccgcca ctggcgccgc gctcaccaca ctctcgtagg 18300

agggaggagg accttcctca tacatcgccg cgcgccgcat actaagggga atacaagaaa 18360

accaacgctc ggtgccatgg ccttggtgag ttttttattt tgcatcatgc tttttttttt 18420

tttaaaacat tctccccagc ctggggcgaa ggtgcgcaaa cgggttgcca ctccctccca 18480

aatccaggac gctgctgtcg tctgccgagt catcgtcctc ccacaccaga ccccgctgac 18540

ggtcgtgcct ttgacgacgg gtgggcgggc gcgggcctgg cacgtccctg tgctcctgcg 18600

cgtacgtctt ccatctactc atcttgtcca ctaggctctc tatcccgttg ttgggaaatg 18660

ccggaggcag gtttttttcg cgctgcggct gcagcagcga gttgtttagg tactcctcct 18720

cgcccagcag gcgcgggcgg gtggtgcgag tgctggtaag agaccctatc aagcttggaa 18780

atgggctact agcatctgac cgcggggccg cagcgcctag atcggacaag ctgcttggcc 18840

tgcggaagct ttcctttcgc agcgccgcct ctgcctgctc gcgctgttgc aactctagca 18900

gggtctgcgg ttgcggggaa aacacgctgt cgtctatgtc gtcccagagg aatccatcgt 18960

taccctcggg cacctcgaat cccccggtgt agaaaccagg gggcggtagc cagtgcgggt 19020

tcaagatggc attggtgaaa tactcggggt tcacggcggc cgcgcgatgc aagtagtcca 19080

ttaggcggtt gataaacggc cggtttgagg catacatgcc cggttccatg ttgcgcgcgg 19140

tcatgtccag cgccacgctg ggcgttaccc cgtcgcgcat caggttaagg ctcacgctct 19200

gctgcacgta gcgcaaaatg cgctcctcct cgctgtttaa actgtgcaac gaggggatct 19260

tctgccgccg gttggtcagc aggtagttta gggttgcctc caggctgccc gtgtcctcct 19320

gccccagcgc gcggctgaca cttgtaatct cctggaaagt atgctcgtcc acatgcgcct 19380

gacctatggc ctcgcggtac agtgtcagca agtgacctag gtatgtgtcc cgggacacgc 19440

tgccactgtc cgtgaagggc gctattagca gcagcaacag gcgcgagttg ggcgtcagca 19500

agctagacac ggtcgcgcgg tcgcctgtgg gagcccgcac cccccacagc ccctgcaagt 19560

ttttgaaagc ctggctcagg tttacggtct gcaggccttg tctactggtc tggaaaaaat 19620

agtctggccc agactggtac acctcacttt gcggtgtctc agtcaccatt agccgcagtg 19680

cgctcacaaa gttggtgtag tcctcctgtc cccgcggcac gttggcgggc tgtgtactca 19740

ggaaggcgtt tagtgcaacc atggagccca ggttgccctg ctgctgcgcg cgctcacgct 19800

gcgccacggc ctcgcgcaca tcccccacca gccggtccag gttggtctgc acgttgccgc 19860

tgttgtaacg agccacgcgc tgaagcagcg cgtcgtagac caggccggcc tcgtcgggcc 19920

ggatggccct gttttcggcc agcgcgttta cgatcgccag caccttctcg tgcgtggggt 19980

ttgcgcgcgc cgggaccacc gcttccagaa ttgcggagag ccggttggcc tgcggctgct 20040

gccggaacgc gtcaggattg cgcgcagtca gcgacatgat gcggtccatg acctggcgcc 20100

agtcgtccgt ggagttaagg ccggacggct ggctctgcag cgccgcccgc accgccgggt 20160

ccgttgcgtc ttgcatcatc tgatcagaaa catcaccgct tagtactcgc cgtcctctgg 20220

ctcgtactca tcgtcctcgt catattcctc cacgccgccg acgttgccag cgcgcgcggg 20280

tgccaccgcc agcccaggtc cggccccagc tgcctccagg gcgcgtcggc ttggggccca 20340

gcgcaggtca gcgcccgcgt caaagtagga ctcggcctct ctatcgccgc tgcccgtgcc 20400

agccagggcc ctttgcaggc tgtgcatcag ctcgcggtcg ctgagctcgc gccgccggct 20460

cacgctcacg gccttgtgga tgcgctcgtt gcgataaacg cccaggtcgt cgctcaaggt 20520

aagcaccttc agcgccatgc gcatgtagaa cccctcgatc tttacctcct tgtctatggg 20580

aacgtaaggg gtatggtata tcttgcgggc gtaaaacttg cccaggctaa gcatggaata 20640

gttgatggcg gccaccttgt cagccaggct caagctgcgc tcctgcacca ctatgctctg 20700

caggatgttt atcaaatcga gcagccagcg gccctcgggc tctactatgt ttagcagcgc 20760

atccctgaat gcctcgttgt ccctgctgtg ctgcactata aggaacagct gcgccatgag 20820

cggcttgcta tttgggtttt gctccagcgc gcttacaaag tcccacagat gcatcagtcc 20880

tatagccacc tcctcgcgcg ccacaagcgt acgcacgtgg ttgttaaagc ttttttgaaa 20940

gttaatctcc tggttcaccg tctgctcgta tgcggttacc aggtcggcgg ccgccacgtg 21000

tgcgcgcgcg ggactaatcc cggttcgcgc gtcgggctca aagtcctcct cgcgcagcaa 21060

ccgctcgcga ttcaggccat gccgcagctc gcgccctgcg tggaactttc gatcccgcat 21120

ctcctcgggc tcctctccct cgcggtcgcg aaacaggttc tgccgcggca cgtacgcctc 21180

acgcgtatca cgcttcagct gcacccttgg gtgccgctca ggagagggcg ctcctagccg 21240

cgccaggccc tcgccctcct ccaagtccag gtagtgccgg gcccggcgcc gcgggggttc 21300

gtaatcacca tctgctgccg cgtcaaccgc ggatgtcgcc cctcctgacg cggtaggagg 21360

aggggagggt gccctgcatg tctgccgctg ctcttgctct tgccgctgct gaggaggggg 21420

gcgcatctgc cgcagcaccg gatgcatctg ggaaaagcaa aaaaggggct cgtccctgtt 21480

tccggaggaa tttgcaagcg gggtcttgca tgacggggag gcaaaccccc gttcgccgca 21540

gtccggccgg tccgagactc gaaccggggg tcccgcgact caacccttgg aaaataaccc 21600

tccggctaca gggagcgagc cacttaatgc tttcgctttc cagcctaacc gcttacgctg 21660

cgcgcggcca gtggccaaaa aagctagcgc agcagccgcc gcgcctggaa ggaagccaaa 21720

aggagcactc ccccgttgtc tgacgtcgca cacctgggtt cgacacgcgg gcggtaaccg 21780

catggatcac ggcggacggc cggatacggg gctcgaaccc cggtcgtccg ccatgatacc 21840

cttgcgaatt tatccaccag accacggaag agtgcccgct tacaggctct ccttttgcac 21900

gctagagcgt caacgattgc gcgcgcctga ccggccagag cgtcccgacc atggagcact 21960

ttttgccgct gcgcaacatc tggaaccgcg tccgcgactt tccgcgcgcc tccaccaccg 22020

ccgccggcat cacctggatg tccaggtaca tctacggata tcatcgcctt atgttggaag 22080

atctcgcccc cggagccccg gccaccctac gctggcccct ctaccgccag ccgccgccgc 22140

actttttggt gggataccag tacctggtgc ggacttgcaa cgactacgta tttgactcga 22200

gggcttactc gcgtctcagg tacaccgagc tctcgcagcc gggtcaccag accgttaact 22260

ggtccgttat ggccaactgc acttacacca tcaacacggg cgcataccac cgctttgtgg 22320

acatggatga cttccagtct accctcacgc aggtgcagca ggccatatta gccgagcgcg 22380

ttgtcgccga cctagccctg cttcagccga tgaggggctt cggggtcaca cgcatgggag 22440

gaagagggcg ccacctacgg ccaaactccg ccgccgccgc agcgatagat gcaagagatg 22500

caggacaaga ggaaggagaa gaagaagtgc cggtagaaag gctcatgcaa gactactaca 22560

aagacctgcg ccgatgtcaa aacgaagcct ggggcatggc cgaccgcctg cgcattcagc 22620

aggccggacc caaggacatg gtgcttctgt cgaccatccg ccgtctcaag accgcctact 22680

ttaattacat catcagcagc acctccgcca gaaacaaccc cgaccgccgc ccgctgccgc 22740

ccgccacggt gctcagccta ccttgcgact gtgactggtt agacgccttt ctcgagaggt 22800

tttccgatcc ggtcgatgcg gactcgctca ggtccctcgg cggcggagta cctacacaac 22860

aattgttgag atgcatcgtt agcgccgtat ccctgccgca tggcagcccc ccgccaaccc 22920

ataaccggga catgacgggc ggcgtcttcc aactgcgccc ccgcgagaac ggccgcgccg 22980

tcaccgagac catgcgccgt cgccgcgggg agatgatcga gcgctttgtc gaccgcctcc 23040

cggtgcgccg tcgtcgccgc cgtgtccccc ctcccccacc gccgccagaa gaagaagaag 23100

gggaggccct tatggaagag gagattgaag aagaagaaga ggcccctgta gcctttgagc 23160

gcgaggtgcg cgacactgtc gccgagctca tccgtcttct ggaggaggag ttaaccgtgt 23220

cggcgcgcaa ctcccagttt ttcaacttcg ccgtggactt ctacgaggcc atggagcgcc 23280

ttgaggcctt gggggatatc aacgaatcca cgttgcgacg ctgggttatg tacttcttcg 23340

tggcagaaca caccgccacc accctcaact acctctttca gcgcctgcga aactacgccg 23400

tcttcgcccg gcacgtggag ctcaatctcg cgcaggtggt catgcgcgcc cgcgatgccg 23460

aagggggcgt ggtctacagc cgcgtctgga acgagggagg cctcaacgcc ttctcgcagc 23520

tcatggcccg catttccaac gacctcgccg ccaccgtgga gcgagccgga cgcggagatc 23580

tccaggagga agagatcgag cagttcatgg ccgagatcgc ctatcaagac aactcaggag 23640

acgtgcagga gattttgcgc caggccgccg tcaacgacac cgaaattgat tctgtcgaac 23700

tctctttcag gttcaagctc accgggcccg tcgtcttcac gcagaggcgc cagattcagg 23760

agatcaaccg ccgcgtcgtc gcgttcgcca gcaacctacg cgcgcagcac cagctcctgc 23820

ccgcgcgcgg cgccgacgtg cccctgcccc ctctcccggc gggtccggag ccccccctac 23880

ctccgggggc tcgcccgcgt caccgctttt agatgcatca tccaaggaca cccccgcggc 23940

ccaccgcccg ccgcgcggta ccgtagtcgc gccgcgggga tgcggcctct tgcaagccat 24000

cgacgccgcc accaaccagc ccctggaaat taggtatcac ctggatctag cccgcgccct 24060

gacccgtcta tgcgaggtaa acctgcagga gctcccgcct gacctgacgc cgcgggagct 24120

ccagaccatg gacagctccc atctgcgcga tgttgtcatc aagctccgac cgccgcgcgc 24180

ggacatctgg actttgggct cgcgcggcgt ggtggtccga tccaccgtaa ctcccctcga 24240

gcagccagac ggtcaaggac aagcagccga agtagaagac caccagccaa acccgccagg 24300

cgaggggctc aaattcccac tctgcttcct tgtgcgcggt cgtcaggtca acctcgtgca 24360

ggatgtacag cccgtgcacc gctgccagta ctgcgcacgt ttttacaaaa gccagcacga 24420

gtgttcggcc cgtcgcaggg acttctactt tcaccacatc aatagccact cctccaattg 24480

gtggcgggag atccagttct tcccgatcgg ctcgcatcct cgcaccgagc gtctctttgt 24540

cacctacgat gtagagacct atacttggat gggggccttt gggaagcagc tcgtgccctt 24600

catgctggtc atgaagttcg gcggagatga gcctctagtg actgccgcgc gagacctagc 24660

cgcgaacctt ggatgggacc gctgggaaca agacccgctt accttctact gcatcacccc 24720

agaaaaaatg gccataggtc gccagtttag gacctttcgc gaccacctgc aaatgctaat 24780

ggcccgtgac ctgtggagct cattcgtcgc ttccaaccct catcttgcag actgggccct 24840

ttcagagcac gggctcagct cccctgaaga gctcacctac gaggaactta aaaaattgcc 24900

ttccatcaag ggcatcccgc gcttcttgga actttacatt gtgggccaca acatcaacgg 24960

ctttgacgag atcgtgctcg ccgcccaggt aattaacaac cgttccgagg tgccgggacc 25020

cttccgcatc acacgcaact ttatgcctcg cgcgggaaag atactcttca acgatgtcac 25080

cttcgccctg ccaaatccgc gttccaaaaa gcgcacggac tttttgctct gggagcaggg 25140

cggatgcgac gacactgact tcaaatacca gtacctcaaa gtcatggtca gggacacctt 25200

tgcgctcacc cacacctcgc tccggaaggc cgcgcaggca tacgcgctac ccgtagaaaa 25260

gggatgctgc gcctaccagg ccgtcaacca gttctacatg ctaggctctt accgttcgga 25320

ggccgacggg tttccgatcc aagagtactg gaaagaccgc gaagagtttg tcctcaaccg 25380

cgagctgtgg aaaaaaaagg gacaggataa gtatgacatc atcaaggaaa ccctggacta 25440

ctgcgcccta gacgtgcagg tcaccgccga gctggtcaac aagctgcgcg actcctacgc 25500

ctccttcgtg cgtgacgcgg taggtctcac agacgccagc ttcaacgtct tccagcgtcc 25560

aaccatatca tccaactcac atgccatctt caggcagata gtcttccgag cagagcagcc 25620

cgcccgtagc aacctcggtc ccgacctcct cgctccctcg cacgaactat acgattacgt 25680

gcgcgccagc atccgcggtg gaagatgcta ccctacatat cttggaatac tcagagagcc 25740

cctctacgtt tacgacattt gcggcatgta cgcctccgcg ctcacccacc ccatgccatg 25800

gggtccccca ctcaacccat acgagcgcgc gcttgccgcc cgcgcatggc agcaggcgct 25860

agacttgcaa ggatgcaaga tagactactt cgacgcgcgc ctgctgcccg gggtctttac 25920

cgtggacgca gaccccccgg acgagacgca gctagacccc ctaccgccat tctgctcgcg 25980

caagggcggc cgcctctgct ggaccaacga gcgcctacgc ggagaggtag ccaccagcgt 26040

tgaccttgtc accctgcaca accgcggttg gcgcgtgcac ctggtgcccg acgagcgcac 26100

caccgtcttt cccgaatggc ggtgcgttgc gcgcgaatac gtgcagctaa acatcgcggc 26160

caaggagcgc gccgatcgcg acaaaaacca aaccctgcgc tccatcgcca agttgctgtc 26220

caacgccctc tacgggtcgt ttgccaccaa gcttgacaac aaaaagattg tcttttctga 26280

ccagatggat gcggccaccc tcaaaggcat caccgcgggc caggtgaata tcaaatcctc 26340

ctcgtttttg gaaactgaca atcttagcgc agaagtcatg cccgcttttc agagggagta 26400

ctcaccccaa cagctggccc tcgcagacag cgatgcggaa gagagtgagg acgaacgcgc 26460

ccccaccccc ttttatagcc ccccttcagg aacacccggt cacgtggcct acacctacaa 26520

accaatcacc ttccttgatg ccgaagaggg cgacatgtgt cttcacaccc tggagcgagt 26580

ggacccccta gtggacaacg accgctaccc ctcccactta gcctccttcg tgctggcctg 26640

gacgcgagcc tttgtctcag agtggtccga gtttctatac gaggaggacc gcggaacacc 26700

gctcgaggac aggcctctca agtctgtata cggggacacg gacagccttt tcgtcaccga 26760

gcgtggacac cggctcatgg aaaccagagg taagaaacgc atcaaaaagc atgggggaaa 26820

cctggttttt gaccccgaac ggccagagct cacctggctc gtggaatgcg agaccgtctg 26880

cggggcctgc ggcgcggatg cctactcccc ggaatcggta tttctcgcgc ccaagctcta 26940

cgccctcaaa agtctgcact gcccctcgtg cggcgcctcc tccaagggca agctgcgcgc 27000

caagggccac gccgcggagg ggctggacta tgacaccatg gtcaaatgct acctggccga 27060

cgcgcagggc gaagaccggc agcgcttcag caccagcagg accagcctca agcgcaccct 27120

ggccagcgcg cagcccggag cgcacccctt caccgtgacc cagactacgc tgacgaggac 27180

cctgcgcccg tggaaagaca tgaccctggc ccgtctggac gagcaccgac tactgccgta 27240

cagcgaaagc cgccccaacc cgcgaaacga ggagatatgc tggatcgaga tgccgtagag 27300

caggtgaccg agctgtggga ccgcctggaa ctgcttggtc aaacgctcaa aagcatgcct 27360

acggcggacg gtctcaaacc gttgaaaaac tttgcttcct tgcaagaact gctatcgctg 27420

ggcggcgagc gccttctggc ggatttggtc agggaaaaca tgcgagtcag ggacatgctt 27480

aacgaagtgg cccccctgct cagggatgac ggcagctgca gctctcttaa ctaccagttg 27540

cagccggtaa taggtgtgat ttacgggccc accggctgcg gtaagtcgca gctgctcagg 27600

aacctgcttt cttcccagct gatctcccct accccggaaa ccgttttctt catcgccccg 27660

caggtagaca tgatcccccc atctgaactc aaagcgtggg aaatgcaaat ctgtgagggt 27720

aactacgccc ctgggccgga tggaaccatt ataccgcagt ctggcaccct ccgcccgcgc 27780

tttgtaaaaa tggcctatga cgatctcatc ctggaacaca actatgacgt tagtgatccc 27840

agaaatatct tcgcccaggc cgccgcccgt gggcccattg ccatcattat ggacgaatgc 27900

atggaaaatc ttggaggtca caagggcgtc tccaagttct tccacgcatt tccttctaag 27960

ctacatgaca aatttcccaa gtgcaccgga tacactgtgc tggtggttct gcacaacatg 28020

aatccccgga gggatatggc tgggaacata gccaacctaa aaatacagtc caagatgcat 28080

ctcatatccc cacgtatgca cccatcccag cttaaccgct ttgtaaacac ttacaccaag 28140

ggcctgcccc tggcaatcag cttgctactg aaagacattt ttaggcacca cgcccagcgc 28200

tcctgctacg actggatcat ctacaacacc accccgcagc atgaagctct gcagtggtgc 28260

tacctccacc ccagagacgg gcttatgccc atgtatctga acatccagag tcacctttac 28320

cacgtcctgg aaaaaataca caggaccctc aacgaccgag accgctggtc ccgggcctac 28380

cgcgcgcgca aaacccctaa ataaagacag caagacactt gcttgatcca aatccaaaca 28440

gagtctggtt ttttatttat gttttaaacc gcattgggag gggaggaagc cttcagggca 28500

gaaacctgct ggcgcagatc caacagctgc tgagaaacga cattaagttc ccgggtcaaa 28560

gaatttaaat tctactcgct ggcactcaag agtggcctct tgaggaactc accgggtata 28620

aatacactac acgtcagctg actataataa taaaacgcca actttgaccc ggaacgcgga 28680

aaacacctga gaaaaacacc tgggcgagtc tccacgtaaa cggtcaaagt ccccgcggcc 28740

ctagacaaat attacgcgct atgagtaaca caaaattatt cagatttcac ttcctcttat 28800

tcagttttcc cgcgaaaatg gccaaatctt actcggttac gcccaaattt actacaacat 28860

ccgcctaaaa ccgcgcgaaa attgtcactt cctgtgtaca ccggcgcaca ccaaaaacgt 28920

cacttttgcc acatccgtcg cttacatgtg ttccgccaca cttgcaacat cacacttccg 28980

ccacactact acgtcacccg ccccgttccc acgccccgcg ccacgtcaca aactccaccc 29040

cctcattatc atattggctt caatccaaaa taaggtatat tattgatgat gataagctat 29100

caaacatgag aattcggcgc gccattatca tttgcgggtc ctttccggcg atccgccttg 29160

ttacggggcg gcgacctcgc gggttttcgc tatttatgaa aattttccgg tttaaggcgt 29220

ttccgttctt cttcgtcata acttaatgtt tttatttaaa ataccctctg aaaagaaagg 29280

aaacgacagg tgctgaaagc gagctttttg gcctctgtcg tttcctttct ctgtttttgt 29340

ccgtggaatg aacaacgcgc ctcactgccc gctttccagt cgggaaacct gtcgtgccag 29400

ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgccagggt 29460

ggtttttctt ttcaccagtg agacgggcaa cagctgattg cccttcaccg cctggccctg 29520

agagagttgc agcaagcggt ccacgctggt ttgccccagc aggcgaaaat cctgtttgat 29580

ggtggttgac ggcgggatat aacatgagct gtcttcggta tcgtcgtatc ccactaccga 29640

gatatccgca ccaacgcgca gcccggactc ggtaatggcg cgcattgcgc ccagcgccat 29700

ctgatcgttg gcaaccagca tcgcagtggg aacgatgccc tcattcagca tttgcatggt 29760

ttgttgaaaa ccggacatgg cactccagtc gccttcccgt tccgctatcg gctgaatttg 29820

attgcgagtg agatatttat gccagccagc cagacgcaga cgcgccgaga cagaacttaa 29880

tgggcccgct aacagcgcga tttgctggtg acccaatgcg accagatgct ccacgcccag 29940

tcgcgtaccg tcttcatggg agaaaataat actgttgatg ggtgtctggt cagagacatc 30000

aagaaataac gccggaacat tagtgcaggc agcttccaca gcaatggcat cctggtcatc 30060

cagcggatag ttaatgatca gcccactgac gcgttgcgcg agaagattgt gcaccgccgc 30120

tttacaggct tcgacgccgc ttcgttctac catcgacacc accacgctgg cacccagttg 30180

atcggcgcga gatttaatcg ccgcgacaat ttgcgacggc gcgtgcaggg ccagactgga 30240

ggtggcaacg ccaatcagca acgactgttt gcccgccagt tgttgtgcca cgcggttggg 30300

aatgtaattc agctccgcca tcgccgcttc cactttttcc cgcgttttcg cagaaacgtg 30360

gctggcctgg ttcaccacgc gggaaacggt ctgataagag acaccggcat actctgcgac 30420

atcgtataac gttactggtt tcacattcac caccctgaat tgactctctt ccgggcgcta 30480

tcatgccata ccgcgaaagg ttttgcacca ttcacctgca caccgcgcct taattaagaa 30540

ttccgtgtat tctatagtgt cacctaaatc gtatgtgtat gatacataag gttatgtatt 30600

aattgtagcc gcgttctaac gacaatatgt acaagcctaa ttgtgtagca tctggcttac 30660

tgaagcagac cctatcatct ctctcgtaaa ctgccgtcag agtcggtttg gttggacgaa 30720

ccttctgagt ttctggtaac gccgttccgc accccggaaa tggtcagcga accaatcagc 30780

agggtcatcg ctagccagat cctctacgcc ggacgcatcg tggccaaaag gatctaggtg 30840

aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga 30900

gcgtcagacc ccttaataag atgatcttct tgagatcgtt ttggtctgcg cgtaatctct 30960

tgctctgaaa acgaaaaaac cgccttgcag ggcggttttt cgaaggttct ctgagctacc 31020

aactctttga accgaggtaa ctggcttgga ggagcgcagt caccaaaact tgtcctttca 31080

gtttagcctt aaccggcgca tgacttcaag actaactcct ctaaatcaat taccagtggc 31140

tgctgccagt ggtgcttttg catgtctttc cgggttggac tcaagacgat agttaccgga 31200

taaggcgcag cggtcggact gaacgggggg ttcgtgcata cagtccagct tggagcgaac 31260

tgcctacccg gaactgagtg tcaggcgtgg aatgagacaa acgcggccat aacagcggaa 31320

tgacaccggt aaaccgaaag gcaggaacag gagagcgcac gagggagccg ccagggggaa 31380

acgcctggta tctttatagt cctgtcgggt ttcgccacca ctgatttgag cgtcagattt 31440

cgtgatgctt gtcagggggg cggagcctat ggaaaaacgg ctttgccgcg gccctctcac 31500

ttccctgtta agtatcttcc tggcatcttc caggaaatct ccgccccgtt cgtaagccat 31560

ttccgctcgc cgcagtcgaa cgaccgagcg tagcgagtca gtgagcgagg aagcggaata 31620

tatcctgtat cacatattct gctgacgcac cggtgcagcc ttttttctcc tgccacatga 31680

agcacttcac tgacaccctc atcagtgcca acatagtaag ccagtataca ctccgctagc 31740

gctgaggtct gcctcgtgaa gaaggtgttg ctgactcata ccaggcctga atcgccccat 31800

catccagcca gaaagtgagg gagccacggt tgatgagagc tttgttgtag gtggaccagt 31860

tggtgatttt gaacttttgc tttgccacgg aacggtctgc gttgtcggga agatgcgtga 31920

tctgatcctt caactcagca aaagttcgat ttattcaaca aagccacgtt gtgtctcaaa 31980

atctctgatg ttacattgca caagataaaa atatatcatc atgaacaata aaactgtctg 32040

cttacataaa cagtaataca aggggtgtta tgagccatat tcaacgggaa acgtcttgct 32100

cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 32160

ataatgtcgg gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag 32220

agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 32280

gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc 32340

ctgatgatgc atggttactc accactgcga tccccgggaa aacagcattc caggtattag 32400

aagaatatcc tgattcaggt gaaaatattg ctgatgcgct ggcagtgttc ctgcgccggt 32460

tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 32520

aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 32580

atggctggcc tgttgaacaa gtctggaaag aaatgcata 32619

<210> 6

<211> 39784

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

agcttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca cttgataacc 60

ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc ggaatcgcag 120

accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct ccttcattac 180

agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa ttgcagtttc 240

atttgatgct cgatgagttt ttctaatcag aattggttaa ttggttgtaa cactggcaga 300

gcattacgct gacttgacgg gacggcggct ttgttgaata aatcgaactt ttgctgagtt 360

gaaggatcag atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt 420

caaaatcacc aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt 480

ctggctggat gatggggcga ttcaggcctg gtatgagtca gcaacacctt cttcacgagg 540

cagacctcag cgctcaaaga tgcaggggta aaagctaacc gcatctttac cgacaaggca 600

tccggcagtt caacagatcg ggaagggctg gatttgctga ggatgaaggt ggaggaaggt 660

gatgtcattc tggtgaagaa gctcgaccgt cttggccgcg acacgccgac atgatccaac 720

tgataaaaga gtttgatgct cagggtgtag cggttcggtt tattgacgac gggatcagta 780

ccgacggtga tatggggcaa atggtggtca ccatcctgtc ggctgtggca caggctgaac 840

gccggaggat cctagagcgc acgaatgagg gccgacagga agcaaagctg aaaggaatca 900

aatttggccg caggcgtacc gtggacagga gcgtcgattt ttgtgatgct cgtcaggggg 960

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 1020

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 1080

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 1140

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 1200

tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 1260

aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 1320

tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacca 1380

tgattacgcc aagcttgcat gcctgcaggt cgatcgatta attaacgacc catcatcaat 1440

aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt ttgtgacgtg 1500

gcgcggggcg tgggaacggg gcgggtgacg taggttttag ggcggagtaa cttgtatgtg 1560

ttgggaattg tagttttctt aaaatgggaa gttacgtaac gtgggaaaac ggaagtgacg 1620

atttgaggaa gttgtgggtt ttttggcttt cgtttctggg cgtaggttcg cgtgcggttt 1680

tctgggtgtt ttttgtggac tttaaccgtt acgtcatttt ttagtcctat atatactcgc 1740

tctgcacttg gccctttttt acactgtgac tgattgagct ggtgccgtgt cgagtggtgt 1800

tttttaaaag aaaagggggg attggggggt acagtgcagg ggaaagaata gtagacataa 1860

tagcaacaga catacaaact aaagaattac aaaaacaaat tacaaaattc aaaattttat 1920

cgtactagtg gatctgcgat cgctccggtg cccgtcagtg ggcagagcgc acatcgccca 1980

cagtccccga gaagttgggg ggaggggtcg gcaattgaac gggtgcctag agaaggtggc 2040

gcggggtaaa ctgggaaagt gatgtcgtgt actggctccg cctttttccc gagggtgggg 2100

gagaaccgta tataagtgca gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg 2160

ccagaacaca gctgaagctt cgaggggctc gcatctctcc ttcacgcgcc cgccgcccta 2220

cctgaggccg ccatccacgc cggttgagtc gcgttctgcc gcctcccgcc tgtggtgcct 2280

cctgaactgc gtccgccgtc taggtaagtt taaagctcag gtcgagaccg ggcctttgtc 2340

cggcgctccc ttggagccta cctagactca gccggctctc cacgctttgc ctgaccctgc 2400

ttgctcaact ctacgtcttt gtttcgtttt ctgttctgcg ccgttacaga tccaagctgt 2460

gaccggcgcc tacggatccg ccaccatggg gaatcgcggg tcttctacct cctctcgccc 2520

cctgccctcc tccgaagcca atatctatgc caagctgcag gaccatatcc agcgccagac 2580

ccgccccttc tccggaggag gatactttaa cggaggcggc gacaaaaacc ccgtgcagca 2640

catcaaggac taccacatcg acagcgtgag ctccaaagcc aagctcagaa tcatcgaagg 2700

aattatccgc gccatcgcca agatcggctt taaggtggac acaaaacagc ccatcgaaga 2760

catcctcaag gacatcaaga aacagctgcc cgacccccgc gccggctcta cctttgtgaa 2820

gaacgccgaa aaacaggaaa ccgtctgcaa gatgattgcc gacgccatca accaggaatt 2880

catcgacctg ggccaggaca agctgatcga caccaccgaa ggggccgcct ccatctgccg 2940

ccagatcgtc ctctatatca atagcctgac ccacggactg cgggccgaat acctggacgt 3000

gcacggcagc atcgagaaca ccctggaaaa catcaaactg ctgaacgacg ccatcaaaca 3060

gctgcacgaa cggatggtga ccgaagtgac caaggccgcc cccaacgagg aagtgattaa 3120

cgctgtgaca atgatcgaag ccgtgtaccg ccgcctgctc aacgagcaga acctccagat 3180

caacatcctc accaacttca tcgacaacat cctgaccccc acccagaaag aactggacaa 3240

gctccagacc gacgaagtcg acatcatcaa actcctcaac gacaccaaca gcgtcctcgg 3300

caccaaaaac ttcggcaaag tgctgagcta caccctctgc aacctgggca tcgccgccag 3360

cgtcgccaac aagatcaaca aggccctcca gaaagtggga ctgaaggtgg agcagtatct 3420

ccagagcaag aactgggccg aattcgacaa agaactcgac ctgaaacgct tctccggcct 3480

ggtgagcgcc gagaacatcg ccgaattcga gaaggctgtg aacctgctga ggcagacctt 3540

caacgaaagg cacaagatcc tggagaacag ctgcgccaaa aagggcggaa gcggagctac 3600

taacttcagc ctgctgaagc aggctggaga cgtggaggag aaccctggac ctatgcccag 3660

caacatgaag cagttctgca agatcagcgt gtggctgcag cagcacgacc ccgacctcct 3720

ggagatcatc aacaacctct gcatgctggg gaacctgagc gccgccaagt acaagcacgg 3780

cgtgacattc atctacccaa agcaggccaa gatccgcgac gaaattaaaa agcacgccta 3840

cagcaacgac cccagccagg ccatcaagac cctcgaatcc ctcatcctcc cattctacat 3900

ccccaccccc gccgaattca ccggagagat cggcagctac accggggtga agctggaggt 3960

ggaaaaaacc gaggccaaca aggtgatcct gaagaacggc gaggccgtgc tggtgcccgc 4020

cgccgacttc aagcccttcc ccgaccgccg cctggccgtg tggatcatgg agagcggcag 4080

catgcccctg gagggccccc cctacaagcg caagaaggag ggcggcggca acgacccccc 4140

cgtgcccaag cacatcagcc cctacacccc ccgcacccgc atcgccatcg aggtggagaa 4200

ggccttcgac gactgcatgc gccagaactg gtgcagcgtg aacaacccct acctggccaa 4260

gagcgtgagc ctgctgagct tcctgagcct gaaccacccc accgagttca tcaaggtgct 4320

gcccctgatc gacttcgacc ccctggtgac cttctacctg ctgctggagc cctacaagac 4380

ccacggcgac gacttcctga tccccgagac catcctgttc ggccccaccg gctggaacgg 4440

caccgacctg taccagagcg ccatgctgga gttcaagaag ttcttcaccc agatcacccg 4500

ccagaccttc atggacatcg ccgacagcgc caccaaggag gtggacgtgc ccatctgcta 4560

cagcgacccc gagaccgtgc acagctacgc caaccacgtg cgcaccgaga tcctgcacca 4620

caacgccgtg aacaaggtga ccacccccaa cctggtggtg caggcctaca acgagctgga 4680

gcagaccaac accatccgcc actacggccc catcttcccc gagagcacca tcaacgccct 4740

gcgcttctgg aagaagctgt ggcaggacga gcagcgcttc gtgatccacg gcctgcaccg 4800

caccctgatg gaccagccca cctacgagac cagcgagttc gccgagatcg tgcgcaacct 4860

gcgcttcagc cgccccggca acaactacat caacgagctg aacatcacca gccccgccat 4920

gtacggcgac aagcacacca ccggcgacat cgcccccaac gaccgcttcg ccatgctggt 4980

ggccttcatc aacagcaccg acttcctgta caccgccatc cccgaggaga aggtgggcgg 5040

caacgagacc cagaccagca gcctgaccga cctggtgccc acccgcctgc acagcttcct 5100

gaaccacaac ctgagcaagc tgaagatcct gaaccgcgcc cagcagaccg tgcgcaacat 5160

cctgagcaac gactgcctga accagctgaa gcactacgtg aagcacaccg gcaagaacga 5220

gatcctgaag ctgctgtaac tcgagtctag agggcccgtt taaacccgct gatcagcctc 5280

gataatcatc tcttgtacat gtcccactgt tcaagcctcc aagctgtgcc ttgggtggct 5340

ttggggcatg gacattgacc cttataaaga atttggagct actgtggagt tactctcgtt 5400

tttgccttct gacttctttc cttccgtcag agatctccta gacaccgcct cagctctgta 5460

tcgagaagcc ttagagtctc ctcttctgag gcggaaagaa ccagctgggg ctctagcaat 5520

tgaaaaataa acacgttgaa acataacaca aacgattctt tattcttggg caatgtatga 5580

aaaagtgtaa gaggatgtgg caaatatttc attaatgtag ttgtggccag accagtccca 5640

tgaaaatgac atagagtatg cacttggagt tgtgtctcct gtttcctgtg taccgtttag 5700

tgtaatggtt agtgttacag gtttagtttt gtctccgttt aagtaaactt gactgacaat 5760

gttacttttg gcagttttac cgtgagattt tggataagct gataggttag gcataaatcc 5820

aacagcgttt gtataggctg tgccttcagt aagatctcca tttctaaagt tccaatattc 5880

tgggtccagg aaggaattgt ttagtagcac tccattttcg tcaaatctta taataagatg 5940

agcactttga actgttccag atattggagc caaactgcct ttaacagcca aaactgaaac 6000

tgtagcaagt atttgactgc cacattttgt taagaccaaa gtgagtttag catctttctc 6060

tgcatttagt ctacagttag gagatggagc tggtgtggtc cacaaagtta gcttatcatt 6120

atttttgttt cctactgtaa tggcacctgt gctgtcaaaa ctaaggccag ttcctagttt 6180

aggaaccata gccttgtttg aatcaaattc taggccatgg ccaatttttg ttttgagggg 6240

atttgtgttt ggtgcattag gtgaaccaaa ttcaagccca tctcctgcat taatggctat 6300

ggctgtagcg tcaaacatca accccttggc agtgcttagg ttaacctcaa gctttttgga 6360

attgtttgaa gctgtaaaca agtaaaggcc tttgttgtag ttaatatcca agttgtgggc 6420

tgagtttata aaaagagggc cctgtcctag tcttagattt agttggtttt gagcatcaaa 6480

cggataacta acatcaagta taaggcgtct gttttgagaa tcaatcctta gtcctcctgc 6540

tacattaagt tgcatattgc cttgtgaatc aaaacccaag gctccagtaa ctttagtttg 6600

caaggaagta ttattaatag tcacacctgg accagttgct acggtcaaag tgtttaggtc 6660

gtctgttaca tgcaaaggag ccccgtactt tagtcctagt tttccatttt gtgtataaat 6720

gggctctttc aagtcaatgc ccaagctacc agtggcagta gttagagggg gtgaggcagt 6780

gatagtaagg gtactgctat cggtggtggt gagggggcct gatgtttgca gggctagctt 6840

tccttctgac actgtgaggg gtccttgggt ggcaatgcta agtttggagt cgtgcacggt 6900

tagcggggcc tgtgattgca tggtgagtgt gttgcccgcg accattagag gtgcggcggc 6960

agccacagtt agggcttctg aggtaactgt gaggggtgca gatatttcca ggtttatgtt 7020

tgacttggtt tttttgagag gtgggctcac agtggttaca ttttgggagg taaggttgcc 7080

ggcctcgtcc agagagaggc cgttgcccat tttgagcgca agcatgccat tggaggtaac 7140

tagaggttcg gataggcgca aagagagtac cccaggggga ctctcttgaa acccattggg 7200

ggatacaaag ggaggagtaa gaaaaggcac agttggagga ccggtttccg tgtcatatgg 7260

atacacgggg ttgaaggtat cttcagacgg tcttgcgcgc ttcatctgca acaacatgaa 7320

gatagtgggt gcggatggac aggaacagga ggaaactgac attccattta gattgtggag 7380

aaagtttgca gccaggagga agctgcaata ccagagctgg gaggagggca aggaggtgct 7440

gctgaataaa ctggacagaa atttgctaac tgattttaag taagtgatgc tttattattt 7500

ttttttatta gttaaaggga ataagatctt tgagaccgca cagggtctta ataagggtgc 7560

agagatcctc aggtccttga caaggtgagt gaatgcagcc ttcggtttct accgagtgct 7620

gagttatggt aatgggcttt tctcccacca tgaccaccaa tttctgacgc ttggttggca 7680

acttgtagct aaggcggtgt ccggtggtat tactgtcgta ggtgactttg gcctgcttta 7740

ccagacaaaa gatacccctt ttgcactggt gcaagttaac catgtcttgg agctcttgat 7800

tcatgcgctg ttgctcggcc gctgccctgc gtctttctag caggcgctgc tctgtaataa 7860

ttccgtccat ttctagctag agaaacctga attagaatag cccgtagagt tgcttgaatt 7920

gttcataaac cccacagtag ctgcgccttt ggcctaatac cctaagggtt ttctaagctc 7980

acctcctgtt ctggtaaaca gagttattga ggtctgtccg gaaaaagtct ggtttacggt 8040

caggcggtag gtgtggtgca gcggccggtg acgcactcgt acgttcccgg caggtaagga 8100

gggtggtgtt ttttctgatg gagtagctga gctcggagag gttctctcgt agactcactc 8160

cgtctgggtt gaaactgttg taaatcacag agggagagat gttaaaagta ccaggtaagg 8220

ttcgccttgg tttgcttggg cgggtgaaga cggtggcgtt tacaggatgg cgataggagc 8280

cccagtatat tttaatttct gtatttatta tactcagcac agagatggca acaaagatct 8340

tgatgtaatc cagggttagg acagttgcaa atcacagtga gaacacaggg tcccctgtcc 8400

cgctcaacta gcagggggcg ctgggtaaac tcccgaatca ggctacgggc aagctctccc 8460

tgggcggtaa gccggacgcc gtgcgccggg ccctcgatat gatcctcggg caattcaaag 8520

tagcaaaact caccggagtc gcgggcaaag cacttgtggc ggcgacagtg gaccaggtgt 8580

ttcaggcgca gttgctctgc ctctccactt aacattcagt cgtagccgtc cgccgagtcc 8640

tttaccgcgt caaagttagg aataaattga tccggatagt ggccgggagg tcccgagaag 8700

gggttaaagt agaccgatgg cacaaactcc tcaataaatt gcagagttcc aatgcctcca 8760

gagcgcggct cagaggacga ggtctgcaga gttaggattg cctgacgagg cgtgaatgaa 8820

gagcggccgg cgccgccgat ctgaaatgtc ccgtccggac ggagaccaag cgaggagctc 8880

accgactcgt cgttgagctg aatacctcgc cctctgattg tcaggtgagt tataccctgc 8940

ccgggcgacc gcaccctgtg acgaaagccg cccgcaagct gcgcccctga gttagtcatc 9000

tgaacttcgg cctgggcgtc tctgggaagt accacagtgg tgggagcggg actttcctgg 9060

tacaccaggg cagcgggcca actacgggga ttaaggttat tacgaggtgt ggtggtaata 9120

gccgcctgtt ccaggagaat tcggtttcgg tgggcgcgta ttccgttgac ccgggatatc 9180

atgtggggtc ccgcgctcat gtagtttatt cgggttgagt agtcttgggc agctccagcc 9240

gcaagtccca tttgtggctg gtaactccac atgtagggcg tgggaatttc cttgctcata 9300

atggcgctga caacaggtgc tggcgccggg tgtggccgct ggagatgacg tagttttcgc 9360

gcttaaattt gagaaagggc gcgaaactag tccttaagag tcagcgcgca gtatttactg 9420

aagagagcct ccgcgtcttc cagcgtgcgc cgaagctgat cttcgctttt gtgatacagg 9480

cagctgcggg tgagggatcg cagagacctg ttttttattt tcagctcttg ttcttggccc 9540

ctgctctgtt gaaatatagc atacagagtg ggaaaaatcc tgtttctaag ctcgcgggtc 9600

gatacgggtt cgttgggcgc cagacgcagc gctcctcctc ctgctgctgc cgccgctgtg 9660

gatttcttgg gctttgtcag agtcttgcta tccggtcgcc tttgcttctg tgtggccgct 9720

gctgttgctg ccgctgccgc cggtgcagta tgggctgtag agatgacggt agtaatgcag 9780

gatgttacgg gggaaggcca cgccgtgatg gtagagaaga aagcggcggg cgaaggagat 9840

gttgccccca cagtcttgca agcaagcaac tatggcgttc ttgtgcccgc gccatgagcg 9900

gtagccttgg cgctgttgtt gctcttgggc taacggcggc ggctgcttgg acttaccggc 9960

cctggttcca gtggtgtccc atctacggtt gggtcggcga acgggcagtg ccggcggcgc 10020

ctgaggagcg gaggttgtag ccatgctgga accggttgcc gatttctggg gcgccggcga 10080

ggggaatgcg accgagggtg acggtgtttc gtctgacacc tcttcgacct cggaagcttc 10140

ctcgtctagg ctctcccagt cttccatcat gtcctcctcc tcctcgtcca aaacctcctc 10200

tgcctgactg tcccagtatt cctcctcgtc cgtgggtggc ggcggcagct gcagcttctt 10260

tttgggtgcc atcctgggaa gcaagggccc gcggctgctg ctgatagggc tgcggcggcg 10320

gggggattgg gttgagctcc tcgccggact gggggtccaa gtaaaccccc cgtccctttc 10380

gtagcagaaa ctcttggcgg gctttgttga tggcttgcaa ttggccaaga atgtggccct 10440

gggtaatgac gcaggcggta agctccgcat taggcgggcg ggattggtct tcgtagaacc 10500

taatctcgtg ggcgtggtag tcctcaggta caaatttgcg aaggtaagcc gacgtccaca 10560

gccccggagt gagtttcaac cccggagccg cggacttttc gtcaggcgag ggaccctgca 10620

gctcaaaggt accgataatt tgactttcgt taagcagctg cgaattgcaa accagggagc 10680

ggtgcggggt gcataggttg cagcgacagt gacactccag tagaccgtca ccgctcacgt 10740

cttccattat gtcagagtgg taggcaaggt agttggctag ctgcagaagg tagcagtggc 10800

cccaaagcgg cggagggcat tcgcggtact taatgggcac aaagtcgcta ggaagtgcac 10860

agcaggtggc gggcaagatt cctgagcgct ctaggataaa gttcctaaag ttctgcaaca 10920

tgctttgact ggtgaagtct ggcagaccct gttgcagggt tttaagcagg cgttcgggga 10980

aaatgatgtc cgccaggtgc gcggccacgg agcgctcgtt gaaggccgtc cataggtcct 11040

tcaagttttg ctttagcagt ttctgcagct ccttgaggtt gcactcctcc aagcactgct 11100

gccaaacgcc catggccgtc tgccaggtgt agcatagaaa taagtaaacg cagtcgcgga 11160

cgtagtcgcg gcgcgcctcg cccttgagcg tggaatgaag cacgttttgc ccaaggcggt 11220

tttcgtgcaa aattccaagg taggagacca ggttgcagag ctccacgttg gagatcttgc 11280

aggcctggcg tacgtagccc tgtcgaaagg tgtagtgcaa tgtttcctct agcttgcgct 11340

gcatctccgg gtcagcaaag aaccgctgca tgcactcaag ctccacggta acgagcactg 11400

cggccatcat tagtttgcgt cgctcctcca agtcggcagg ctcgcgcgtt tgaagccagc 11460

gcgctagctg ctcgtcgcca actgcgggta ggccctcctc tgtttgttct tgcaaatttg 11520

catccctctc caggggctgc gcacggcgca cgatcagctc actcatgact gtgctcatga 11580

ccttgggggg taggttaagt gccgggtagg caaagtgggt gacctcgatg ctgcgtttta 11640

gtacggctag gcgcgcgttg tcaccctcga gttccaccaa cactccagag tgactttcat 11700

tttcgctgtt ttcctgttgc agagcgtttg ccgcgcgctt ctcgtcgcgt ccaagaccct 11760

caaagatttt tggcacttcg ttgagcgagg cgatatcagg tatgacagcg ccctgccgca 11820

aggccagctg cttgtccgct cggctgcggt tggcacggca ggataggggt atcttgcagt 11880

tttggaaaaa gatgtgatag gtggcaagca cctctggcac ggcaaatacg gggtagaagt 11940

tgaggcgcgg gttgggctcg catgtgccgt tttcttggcg tttggggggt acgcgcggtg 12000

agaataggtg gcgttcgtag gcaaggctga catccgctat ggcgaggggc acatcgctgc 12060

gctcttgcaa cgcgtcgcag ataatggcgc actggcgctg cagatgcttc aacagcacgt 12120

cgtctcccac atctaggtag tcgccatgcc tttcgtcccc ccgcccgact tgttcctcgt 12180

ttgcctctgc gttgtcctgg tcttgctttt tatcctctgt tggtactgag cggtcctcgt 12240

cgtcttcgct tacaaaacct gggtcctgct cgataatcac ttcctcctcc tcaagcgggg 12300

gtgcctcgac ggggaaggtg gtaggcgcgt tggcggcatc ggtggaggcg gtggtggcga 12360

actcagaggg ggcggttagg ctgtccttct tctcgactga ctccatgatc tttttctgcc 12420

tataggagaa ggaaacttgt atgtgttggg aattgtagtt ttcttaaaat gggaagttac 12480

gtaacgtggg aaaacggaag tgacgatttg aggaagttgt gggttttttg gctttcgttt 12540

ctgggcgtag gttcgcgtgc ggttttctgg gtgttttttg tggactttaa ccgttacgtc 12600

attttttagt cctatatata ctcgctctgc acttggccct tttttacact gtgactgatt 12660

gagctggtgc cgtgtcgagt ggtgtttttt taataggttt tcttttttac tggtaaggct 12720

gactgttatg actacgtccg gcgttccatt tggcatgaca ctacgaccaa cacgatctcg 12780

gttgtctcgg cgcactccgt acagtaggga tcgtctacct ccttttgaga cagaaacccg 12840

cgctaccata ctggaggatc atccgctgct gcccgaatgt aacactttga caatgcacaa 12900

cgtgagttac gtgcgaggtc ttccctgcag tgtgggattt acgctgattc aggaatgggt 12960

tgttccctgg gatatggttc taacgcggga ggagcttgta atcctgagga agtgtatgca 13020

cgtgtgcctg tgttgtgcca acattgatat catgacgagc atgatgatcc atggttacga 13080

gtcctgggct ctccactgtc attgttccag tcccggttcc ctgcagtgta tagccggcgg 13140

gcaggttttg gccagctggt ttaggatggt ggtggatggc gccatgttta atcagaggtt 13200

tatatggtac cgggaggtgg tgaattacaa catgccaaaa gaggtaatgt ttatgtccag 13260

cgtgtttatg aggggtcgcc acttaatcta cctgcgcttg tggtatgatg gccacgtggg 13320

ttctgtggtc cccgccatga gctttggata cagcgccttg cactgtggga ttttgaacaa 13380

tattgtggtg ctgtgctgca gttactgtgc tgatttaagt gagatcaggg tgcgctgctg 13440

tgcccggagg acaaggcgcc ttatgctgcg ggcggtgcga atcatcgctg aggagaccac 13500

tgccatgttg tattcctgca ggacggagcg gcggcggcag cagtttattc gcgcgctgct 13560

gcagcaccac cgccctatcc tgatgcacga ttatgactct acccccatgt agactagggt 13620

tctgtgagtt tgattaaggt acggtgatct gtataagcta tgtggtggtg gggctatact 13680

actgaatgaa aaatgacttg aaattttctg caattgaaaa ataaacacgt tgaaacataa 13740

cacaaacgat acggcgcaga cggcaagggt gggggtaaat aatcacccga gagtgtacaa 13800

ataaaagcat ttgcctttat tgaaagtgtc tctagtacat tatttttaca tgtttttcaa 13860

gtgacaaaaa gaagtggcgc tcctaatctg cgcactgtgg ctgcggaagt agggcgagtg 13920

gcgctccagg aagctgtaga gctgttcctg gttgcgacgc agggtgggct gtacctgggg 13980

actgttgagc atggagttgg gtaccccggt aataaggttc atggtggggt tgtgatccat 14040

gggagtttgg ggccagttgg caaaggcgtg gagaaacatg cagcagaata gtccacaggc 14100

ggccgagttg ggcccctgta cgctttgggt ggacttttcc agcgttatac agcggtcggg 14160

ggaagaagca atggcgctac ggcgcaggag tgactcgtac tcaaactggt aaacctgctt 14220

gagtcgctgg tcagaaaagc caaagggctc aaagaggtag catgtttttg agtgcgggtt 14280

ccaggcaaag gccatccagt gtacgccccc agtctcgcga ccggccgtat tgactatggc 14340

gcaggcgagc ttgtgtggag aaacaaagcc tggaaagcgc ttgtcatagg tgcccaaaaa 14400

atatggccca caaccaagat ctttgacaat ggctttcagt tcctgctcac tggagcccat 14460

ggcggcagct gttgttgatg ttgcttgctt ctttatgttg tggcgttgcc ggccgagaag 14520

ggcgtgcgca ggtacacggt ttcgatgacg ccgcggtgcg gctggtgcac acggaccacg 14580

tcaaagactt caaacaaaac ataaagaagg gtgggctcgt ccatgggatc cacctcaaaa 14640

gtcatgtcta gcgcgtgggc ggagttggcg tagagaaggt tttggcccag gtctgtgagt 14700

gcgcccatgg acataaagtt actggagaat gggatgcgcc aaagggtgcg atcgcaaaga 14760

aactttttct gggtaatgct gtcaactgcg gtcttgccta taagcggata ggggaagtta 14820

gcagggtagg cctgtccttc gcgcatggtg ggggcaaggt agccaacaaa tccagagttg 14880

ttgtgttggt gtaggatgcc cacctgttgg tagtccttgt atttagtatc atccaccacc 14940

tgacggctca tgggctggaa gtttctaaag aaggagtaca tgcggtcctt gtagctctct 15000

gggatataga agccctggta gccaatgtta tagttagcta gcatttgtac caggaaccag 15060

tctttggtca tgttacactg ggcaacgttg taaccctccc cgtcaactga gcgcttaatt 15120

tcaaactcgt tgggggtaag caggcggtca ttgccaggcc agctgacaga agagtcaaag 15180

gtaatggcca ccttcttaaa ggtgtggttg aggtaaaagg ttccatctag gtagggtata 15240

gagccagagt aggtgtaata agggtcgtag cccgagccca gtgatggggt ttccttagtc 15300

ttaaggcgcg tgaaggccca gccgcggaaa gccgcccagt tgcgggaggg gatggatatg 15360

ggcacgttgg tagcgttggc gggtataggg tagagcatgt tggcggcgga gagatagtcg 15420

ttaaaggact ggtcgttggt gtcgtttcta agcatggcct caagcgtgga ggcggtgttg 15480

tgggccatgg ggaagaaggt ggcgtaaagg caaatgctat caaacttaat gctggctccg 15540

tcaaccctta ggtcatttcc tagggagctc tgcagaacca tgttaacatc cttcctgaag 15600

ttccactcgt aggtgtatga gcccggcagg agaaggaggt ttttaatggc aaagaacttc 15660

tgaggcacct ggatgtggaa gggcacatag cgaccattgc ccagcaacat tgagcggtag 15720

cgcaggccag cattgcggtg gtggttaaat gggttgacgt tgtccatata gtcaagggac 15780

cagcgtgctc caaggttaat gtagcagtcc actagcccgg gagccaccac tcgcttgttc 15840

atgtagtcgt aggtgtttgg gttatcagaa atttttacgt tggaaggact gtactttagc 15900

ttgtcgggca aatacagcgc tatgttggag tacaggaaat ttctccacag gttggcattt 15960

agattgattt ccatggcaaa attatttcca actcttattt catttttatc tgaaaattct 16020

gtagcatctt tttcccatcc attttcctga cctgttttag gttttacctt ggtaagagtc 16080

tctgtattaa tcacacctcc cagtggaaag cagtaatttg gaagttcatc ttcagttcca 16140

tgattttcaa taattctaac atctggatca tagctgtcaa cagcctgatt ccacatagaa 16200

aagtacctgg ttctatcacc aatggaatca agcaaaagct ggtatgaaag ctctgtgttt 16260

ctgtcttgca aatctacaac agcattcaac tgcgatgctt ggcccgccag aacacccata 16320

ttacccgtgc tgttgtaata cattagacca ataaaattgt ccctaaaagc aatgtaatta 16380

ggcctgttgg gcatagattg ttggcccatt agttctcgtg agttaccttc cttaatagtg 16440

ggcatgtaag aaatatgagt gtctggggtt tctatatcta catcttcact gtacaatacc 16500

actttaggag tcaagttatc accattgcct gcggctgcct cagtagttga gaaaaattgc 16560

atttccactt gactttctag ctttccattt tgttgcttta caagaatgcc ttgccctcca 16620

ttttcatttg tgggttttgc atatgaaccg taacatggtt tcattggggt agtctttttt 16680

aggactctcc cagctgcatg attaatttct gtttcgtacc actgagattc tcctatttga 16740

ggttcaggtt gaaatgtttt atcggcatat ttaggtgttt gaccttcgac acctatttga 16800

ataccctcct ttgtaatatt tataccagaa taaggcgcct gcccaaatac gtgagttttt 16860

tgctgctcag cttgctcgtc tacttcgtct tcgttgtcat cgtcctcttc ttctaggttt 16920

atttcaagag cagtagcagc ttcatcccat tcgcaaggat ttggggcacc cttgggagcc 16980

agggcgttgt aggcagtgcc agagtagggc ttaaaagtag ggcccctgtc cagcacgccg 17040

cggatgtcaa agtacgtgga agccatgtcc agcacacggt tatcacccac agctagggtg 17100

aaccgcgcct tgtacgagta cgcagtatcc tcacggtcca cagggatgaa ccgcagcgtc 17160

aaacgctggg accggtctgt ggtcacgtcg tgcgtaggcg ccaccgtggg gtttctaaac 17220

ttgttattca ggctgaagta cgtctcggtg gcgcgggcaa actgcaccag cccggggctc 17280

aggtactccg aggcgtcctg gcccgagatg tgcatgtaag accactgcgg catcatcgaa 17340

ggggtagcca tcttggaaag cgggcgcgcg gcggctcagc agctcctctg gcggcgacat 17400

ggacgcatac atgacacaca tacgacacgt tagctatcag aagcatcgtc ggcgcttcag 17460

ggattgcacc cccagaccca cgatgctgtt cagtgtgctt tgccagttgc cactggctac 17520

gggccgcaac gatcgcggac cgctggcggc gcggcgcagg gacgcgcggc taggacgggt 17580

tacaacaacg gcggtcgggc ctggcagcac aggtttctgc tgggtgtcgg cggggggagg 17640

caggtccagc gttacgggtg tgtgctggcc cagcactccg gtagccatgg gcgcgatggg 17700

acgggtggtg ggcaggcctt gctttagtgc ctcctcgtac gagggaggct cgtctatttg 17760

cgtcaccaga gtttcttccc tgtcggggcg cggacgcttt tcgccacgcc cctctggaga 17820

cactgtctcc acggccggtg gaggctcctc tacgggaggg cggggatcaa gcttactgtt 17880

aatcttattt tgcactgcct ggttggccag gtccaccacc ccgctaatgc cagaggccag 17940

gccatctacc accttttgtt ggaaattttg ctctttcaac ttatccctca gcatctggcc 18000

tgtgctgctg ttccaggcct tgctgccata gttcttaacg gtggaaccga aatttttaat 18060

gccgctccac agcgagcccc agctgaaggc gccaccgctc atattgctgg tgccgatatc 18120

ttgccagttt cccatgaacg ggcgcgagcc gtgtcgcggg gccagagacg caaagttgat 18180

gtcttccatt ctacaaaata gttacaggac caagcgagcg tgagagtcca gactttttat 18240

tttgattttt ccacatgcaa cttgttttta atcagtgtct ctgcgcctgc aaggccacgg 18300

atgcaattcc gggcacggcg ccaatcgccg cggcgatcag tggaataagg aggggcagga 18360

taccgccgcg catgcgacgg tgcgacgcgc gccgccgccg gtggtgcgca cgacgcatgc 18420

cgcccgtcag gccgtggccg gccatgcccc tcctacggtg cattcttcct cggaatcccg 18480

gcaccgggaa acggaggcgg caggtgaggg ccatatctgc aagaaccaca aagaccggct 18540

tttaaacgat gctggggtgg tagcgcgctg ttggcagcac cagggtcctg cctccttcgc 18600

gagccaccct gcgcacggaa atcggggcca gcacgggctg gcgacggcga cggcggcggc 18660

gggttccagt ggtggttcgg cgtcgggtag ttgctcgtct tctggggcgg taggtgtagc 18720

cacgatagcc gggggtaggc gcaatggaag gatgtagggc atattcgggc agtagcgcgc 18780

tggcggcgcc gtacttcctc gaacggcgcg ggcgccgggg ggctgaaacg cgaaacatcc 18840

acgggtccgt ttgcacctcc gtagaggtct tggacgcggc cgcagcgacc gcctgcaccg 18900

cggcatccgc caccgctgag gcaaccgggg acgtttgtgt ctccatgccc tctgtggcgg 18960

tggcaatact ggtgctactg gtagtgggta tctgaacgtc cacggtctgc acgcccagtc 19020

ccggcgccac ctgcttgatt ggccgcacgc ggacctcggg ctccagccca ggttccacgg 19080

tcattttttc caagacatct tccagtcgct ggcgcttggg taccatcagc tgcacggtgg 19140

gtgccaagtc accagactcg cgctttaggc cgcgcttttc ttcggacggt gcaagcgcgg 19200

gcagcacctg ctgcagtgtt acgggcttta ggctaggtgt tgggttgccc tcgtccagcg 19260

gcaacgccag catgtcctta tgccgctttc cgtaggcaaa ctccccgagg cgctcgttgg 19320

cctgctcaag caggtcctcg tcgccgtaca cctcatcata cacgcgcttg taggtgcggg 19380

tggagcgctc accgggcgta aagactacgg tggtgccggg tcgcaaaaca cgttttacgc 19440

gtcgaccttt ccactgtacc cgtcgcctgg gcgcggtagc gtgcagcagt tccacctcgt 19500

cgtcaagttc atcatcatca tctttctttt tctttttgac ccgctttagc tttcggggct 19560

tgtaatcctg ctcttccttc ttcggggggc catagatctc cggcgcgatg acctggagca 19620

tctcttcttt gattttgcgc ttggacatag cttcgttgcg cgccgccgcc gctggataca 19680

tacaacagta cgagtctaag tagttttttc ttgcaatcta gttgcgcggg gggcgggtgc 19740

gcacgggcac gcgcaggccg ctaaccgagt cgcgcaccca atacacgttg cccctgcgac 19800

cctgagtcat agcactaatg gccgcggctg ctgcggcggc cgctcgtcgc ctggacctgg 19860

ggggcacagt gacaataccc gcggccagcc ttcgagcggc ccgcatggcc gcccgtcggc 19920

cggtgcgacg tgcgcggtta agcagggccg ccgccgcgcg ttgggcggca gtgccgggtc 19980

ggcggcggtg gcgacgtgct acgcgcctcc gccgtctctt cattttagca tagcgccggg 20040

ctccgcgcac cacggtctga atggccgcgt ccactgtgga cactggtggc ggcgtgggcg 20100

tgtagttgcg cgcctcctcc accaccgcgt cgatggcgtc atcgacggtg gtgcgcccag 20160

tgcggccgcg tttgtgcgcg ccccagggcg cgcggtagtg cccgcgcacg cgcactgggt 20220

gttggtcgga gcgcttcttg gccccgccaa acatcttgct tgggaagcgc aggccccagc 20280

ctgtgttatt gctgggcgat ataaggatgg acatgcttgc tcaaaaagtg cggctcgata 20340

ggacgcgcgg cgagactatg cccagggcct tgtaaacgta ggggcaggtg cggcgtctgg 20400

cgtcagtaat ggtcactcgc tggactcctc cgatgctgtt gcgcagcggt agcgtcccgt 20460

gatctgtgag agcaggaacg ttttcactga cggtggtgat ggtgggggct ggcgggcgcg 20520

ccaaaatctg gttctcggga aagcgattga acacgtgggt cagagaggta aactggcgga 20580

tgagttggga gtagacggcc tggtcgttgt agaagctctt ggagtgcacg ggcaacagct 20640

cggcgcccac caccggaaag ttgctgatct ggcgcgtgga gcggaaggtc acggggtctt 20700

gcatcatgtc tggcaacgac cagtagacct gctccgagcc gcaggttacg tcaggagtgc 20760

aaagcagggt ccatgagcgg attccggtct gagggtcgcc gtagttgtat gcaaggtacc 20820

agctgcggta ctgggtgaag gtgctgtcat tgcttattag gttgtaactg cgtttcttgc 20880

tgtcctctgt caggggtttg atcaccggtt tcttctgagg cttctcgacc tcgggttgcg 20940

cagcgggggc ggcagcttcg gccgctgctt cggcctcagc gcgcttctcc tcagcccgtg 21000

tggcaaaggt gtcgccgcga atggcatgat cgttcatgtc ctccaccggc tgcattgccg 21060

cggctgccgc gttggagttc tcttccgcgc cgctgccact gctgttgctg ccgcctgcgc 21120

cacccccgcc ctgttcggtg tcatctttca agctcgcctg gtaggcgtcc acatccaaca 21180

gtgcgggaat gttaccaccc tccagatcat cgtaggtgat cctaaagccc tcctggaagg 21240

gttgccgctt gcggatgccc aacaagttgc tcaggcggct gtgggtgaag tccaccccgc 21300

atcctggcag caaaatgatg tctggatgga aggcttcgtt tgtatatacc ccaggcatga 21360

caagaccagt gacggggtca aaccccagtc tgaagttgcg ggtgtcaaac tttaccccga 21420

tgtcgctttc cagaaccccg ttctgtctgc ccactttcaa gtagtgctcc acgatcgcgt 21480

tgttcataag gtctatggtc atggtctcgg agtagttgcc ctcgggcagc gtgaactcca 21540

cccactcgta tttcagctcc acctgattgt ccttagtagg caagcgcgac accatcaccc 21600

gcgccttaaa cttattggta aacatgaact cgttcacatt tggcatgttg gtatgcagga 21660

tggttttcag gtcgccgccc cagtgcgacc ggtcgtcaag attgatggtc tgtgtgcttg 21720

cctcccccgg gctgtagtca ttgttttgaa tgaccgtggt cagaaagttg ctgtggtcgt 21780

tctggtagtt cagggatgcc acatccgttg acttgttgtc caccaggtac acacgggtgg 21840

tgtcgaatag gggtgccaac tcagagtaac ggatgctgtt tctccccccg gtaggccgca 21900

ggtaccgcgg aggcacaaac ggcgggtcca ggggagcatc gaagggagaa cccagcgccg 21960

ccgccactgg cgccgcgctc accacactct cgtaggaggg aggaggacct tcctcataca 22020

tcgccgcgcg ccgcatacta aggggaatac aagaaaacca acgctcggtg ccatggcctt 22080

ggtgagtttt ttattttgca tcatgctttt ttttttttta aaacattctc cccagcctgg 22140

ggcgaaggtg cgcaaacggg ttgccactcc ctcccaaatc caggacgctg ctgtcgtctg 22200

ccgagtcatc gtcctcccac accagacccc gctgacggtc gtgcctttga cgacgggtgg 22260

gcgggcgcgg gcctggcacg tccctgtgct cctgcgcgta cgtcttccat ctactcatct 22320

tgtccactag gctctctatc ccgttgttgg gaaatgccgg aggcaggttt ttttcgcgct 22380

gcggctgcag cagcgagttg tttaggtact cctcctcgcc cagcaggcgc gggcgggtgg 22440

tgcgagtgct ggtaagagac cctatcaagc ttggaaatgg gctactagca tctgaccgcg 22500

gggccgcagc gcctagatcg gacaagctgc ttggcctgcg gaagctttcc tttcgcagcg 22560

ccgcctctgc ctgctcgcgc tgttgcaact ctagcagggt ctgcggttgc ggggaaaaca 22620

cgctgtcgtc tatgtcgtcc cagaggaatc catcgttacc ctcgggcacc tcgaatcccc 22680

cggtgtagaa accagggggc ggtagccagt gcgggttcaa gatggcattg gtgaaatact 22740

cggggttcac ggcggccgcg cgatgcaagt agtccattag gcggttgata aacggccggt 22800

ttgaggcata catgcccggt tccatgttgc gcgcggtcat gtccagcgcc acgctgggcg 22860

ttaccccgtc gcgcatcagg ttaaggctca cgctctgctg cacgtagcgc aaaatgcgct 22920

cctcctcgct gtttaaactg tgcaacgagg ggatcttctg ccgccggttg gtcagcaggt 22980

agtttagggt tgcctccagg ctgcccgtgt cctcctgccc cagcgcgcgg ctgacacttg 23040

taatctcctg gaaagtatgc tcgtccacat gcgcctgacc tatggcctcg cggtacagtg 23100

tcagcaagtg acctaggtat gtgtcccggg acacgctgcc actgtccgtg aagggcgcta 23160

ttagcagcag caacaggcgc gagttgggcg tcagcaagct agacacggtc gcgcggtcgc 23220

ctgtgggagc ccgcaccccc cacagcccct gcaagttttt gaaagcctgg ctcaggttta 23280

cggtctgcag gccttgtcta ctggtctgga aaaaatagtc tggcccagac tggtacacct 23340

cactttgcgg tgtctcagtc accattagcc gcagtgcgct cacaaagttg gtgtagtcct 23400

cctgtccccg cggcacgttg gcgggctgtg tactcaggaa ggcgtttagt gcaaccatgg 23460

agcccaggtt gccctgctgc tgcgcgcgct cacgctgcgc cacggcctcg cgcacatccc 23520

ccaccagccg gtccaggttg gtctgcacgt tgccgctgtt gtaacgagcc acgcgctgaa 23580

gcagcgcgtc gtagaccagg ccggcctcgt cgggccggat ggccctgttt tcggccagcg 23640

cgtttacgat cgccagcacc ttctcgtgcg tggggtttgc gcgcgccggg accaccgctt 23700

ccagaattgc ggagagccgg ttggcctgcg gctgctgccg gaacgcgtca ggattgcgcg 23760

cagtcagcga catgatgcgg tccatgacct ggcgccagtc gtccgtggag ttaaggccgg 23820

acggctggct ctgcagcgcc gcccgcaccg ccgggtccgt tgcgtcttgc atcatctgat 23880

cagaaacatc accgcttagt actcgccgtc ctctggctcg tactcatcgt cctcgtcata 23940

ttcctccacg ccgccgacgt tgccagcgcg cgcgggtgcc accgccagcc caggtccggc 24000

cccagctgcc tccagggcgc gtcggcttgg ggcccagcgc aggtcagcgc ccgcgtcaaa 24060

gtaggactcg gcctctctat cgccgctgcc cgtgccagcc agggcccttt gcaggctgtg 24120

catcagctcg cggtcgctga gctcgcgccg ccggctcacg ctcacggcct tgtggatgcg 24180

ctcgttgcga taaacgccca ggtcgtcgct caaggtaagc accttcagcg ccatgcgcat 24240

gtagaacccc tcgatcttta cctccttgtc tatgggaacg taaggggtat ggtatatctt 24300

gcgggcgtaa aacttgccca ggctaagcat ggaatagttg atggcggcca ccttgtcagc 24360

caggctcaag ctgcgctcct gcaccactat gctctgcagg atgtttatca aatcgagcag 24420

ccagcggccc tcgggctcta ctatgtttag cagcgcatcc ctgaatgcct cgttgtccct 24480

gctgtgctgc actataagga acagctgcgc catgagcggc ttgctatttg ggttttgctc 24540

cagcgcgctt acaaagtccc acagatgcat cagtcctata gccacctcct cgcgcgccac 24600

aagcgtacgc acgtggttgt taaagctttt ttgaaagtta atctcctggt tcaccgtctg 24660

ctcgtatgcg gttaccaggt cggcggccgc cacgtgtgcg cgcgcgggac taatcccggt 24720

tcgcgcgtcg ggctcaaagt cctcctcgcg cagcaaccgc tcgcgattca ggccatgccg 24780

cagctcgcgc cctgcgtgga actttcgatc ccgcatctcc tcgggctcct ctccctcgcg 24840

gtcgcgaaac aggttctgcc gcggcacgta cgcctcacgc gtatcacgct tcagctgcac 24900

ccttgggtgc cgctcaggag agggcgctcc tagccgcgcc aggccctcgc cctcctccaa 24960

gtccaggtag tgccgggccc ggcgccgcgg gggttcgtaa tcaccatctg ctgccgcgtc 25020

aaccgcggat gtcgcccctc ctgacgcggt aggaggaggg gagggtgccc tgcatgtctg 25080

ccgctgctct tgctcttgcc gctgctgagg aggggggcgc atctgccgca gcaccggatg 25140

catctgggaa aagcaaaaaa ggggctcgtc cctgtttccg gaggaatttg caagcggggt 25200

cttgcatgac ggggaggcaa acccccgttc gccgcagtcc ggccggtccg agactcgaac 25260

cgggggtccc gcgactcaac ccttggaaaa taaccctccg gctacaggga gcgagccact 25320

taatgctttc gctttccagc ctaaccgctt acgctgcgcg cggccagtgg ccaaaaaagc 25380

tagcgcagca gccgccgcgc ctggaaggaa gccaaaagga gcactccccc gttgtctgac 25440

gtcgcacacc tgggttcgac acgcgggcgg taaccgcatg gatcacggcg gacggccgga 25500

tacggggctc gaaccccggt cgtccgccat gatacccttg cgaatttatc caccagacca 25560

cggaagagtg cccgcttaca ggctctcctt ttgcacgcta gagcgtcaac gattgcgcgc 25620

gcctgaccgg ccagagcgtc ccgaccatgg agcacttttt gccgctgcgc aacatctgga 25680

accgcgtccg cgactttccg cgcgcctcca ccaccgccgc cggcatcacc tggatgtcca 25740

ggtacatcta cggatatcat cgccttatgt tggaagatct cgcccccgga gccccggcca 25800

ccctacgctg gcccctctac cgccagccgc cgccgcactt tttggtggga taccagtacc 25860

tggtgcggac ttgcaacgac tacgtatttg actcgagggc ttactcgcgt ctcaggtaca 25920

ccgagctctc gcagccgggt caccagaccg ttaactggtc cgttatggcc aactgcactt 25980

acaccatcaa cacgggcgca taccaccgct ttgtggacat ggatgacttc cagtctaccc 26040

tcacgcaggt gcagcaggcc atattagccg agcgcgttgt cgccgaccta gccctgcttc 26100

agccgatgag gggcttcggg gtcacacgca tgggaggaag agggcgccac ctacggccaa 26160

actccgccgc cgccgcagcg atagatgcaa gagatgcagg acaagaggaa ggagaagaag 26220

aagtgccggt agaaaggctc atgcaagact actacaaaga cctgcgccga tgtcaaaacg 26280

aagcctgggg catggccgac cgcctgcgca ttcagcaggc cggacccaag gacatggtgc 26340

ttctgtcgac catccgccgt ctcaagaccg cctactttaa ttacatcatc agcagcacct 26400

ccgccagaaa caaccccgac cgccgcccgc tgccgcccgc cacggtgctc agcctacctt 26460

gcgactgtga ctggttagac gcctttctcg agaggttttc cgatccggtc gatgcggact 26520

cgctcaggtc cctcggcggc ggagtaccta cacaacaatt gttgagatgc atcgttagcg 26580

ccgtatccct gccgcatggc agccccccgc caacccataa ccgggacatg acgggcggcg 26640

tcttccaact gcgcccccgc gagaacggcc gcgccgtcac cgagaccatg cgccgtcgcc 26700

gcggggagat gatcgagcgc tttgtcgacc gcctcccggt gcgccgtcgt cgccgccgtg 26760

tcccccctcc cccaccgccg ccagaagaag aagaagggga ggcccttatg gaagaggaga 26820

ttgaagaaga agaagaggcc cctgtagcct ttgagcgcga ggtgcgcgac actgtcgccg 26880

agctcatccg tcttctggag gaggagttaa ccgtgtcggc gcgcaactcc cagtttttca 26940

acttcgccgt ggacttctac gaggccatgg agcgccttga ggccttgggg gatatcaacg 27000

aatccacgtt gcgacgctgg gttatgtact tcttcgtggc agaacacacc gccaccaccc 27060

tcaactacct ctttcagcgc ctgcgaaact acgccgtctt cgcccggcac gtggagctca 27120

atctcgcgca ggtggtcatg cgcgcccgcg atgccgaagg gggcgtggtc tacagccgcg 27180

tctggaacga gggaggcctc aacgccttct cgcagctcat ggcccgcatt tccaacgacc 27240

tcgccgccac cgtggagcga gccggacgcg gagatctcca ggaggaagag atcgagcagt 27300

tcatggccga gatcgcctat caagacaact caggagacgt gcaggagatt ttgcgccagg 27360

ccgccgtcaa cgacaccgaa attgattctg tcgaactctc tttcaggttc aagctcaccg 27420

ggcccgtcgt cttcacgcag aggcgccaga ttcaggagat caaccgccgc gtcgtcgcgt 27480

tcgccagcaa cctacgcgcg cagcaccagc tcctgcccgc gcgcggcgcc gacgtgcccc 27540

tgccccctct cccggcgggt ccggagcccc ccctacctcc gggggctcgc ccgcgtcacc 27600

gcttttagat gcatcatcca aggacacccc cgcggcccac cgcccgccgc gcggtaccgt 27660

agtcgcgccg cggggatgcg gcctcttgca agccatcgac gccgccacca accagcccct 27720

ggaaattagg tatcacctgg atctagcccg cgccctgacc cgtctatgcg aggtaaacct 27780

gcaggagctc ccgcctgacc tgacgccgcg ggagctccag accatggaca gctcccatct 27840

gcgcgatgtt gtcatcaagc tccgaccgcc gcgcgcggac atctggactt tgggctcgcg 27900

cggcgtggtg gtccgatcca ccgtaactcc cctcgagcag ccagacggtc aaggacaagc 27960

agccgaagta gaagaccacc agccaaaccc gccaggcgag gggctcaaat tcccactctg 28020

cttccttgtg cgcggtcgtc aggtcaacct cgtgcaggat gtacagcccg tgcaccgctg 28080

ccagtactgc gcacgttttt acaaaagcca gcacgagtgt tcggcccgtc gcagggactt 28140

ctactttcac cacatcaata gccactcctc caattggtgg cgggagatcc agttcttccc 28200

gatcggctcg catcctcgca ccgagcgtct ctttgtcacc tacgatgtag agacctatac 28260

ttggatgggg gcctttggga agcagctcgt gcccttcatg ctggtcatga agttcggcgg 28320

agatgagcct ctagtgactg ccgcgcgaga cctagccgcg aaccttggat gggaccgctg 28380

ggaacaagac ccgcttacct tctactgcat caccccagaa aaaatggcca taggtcgcca 28440

gtttaggacc tttcgcgacc acctgcaaat gctaatggcc cgtgacctgt ggagctcatt 28500

cgtcgcttcc aaccctcatc ttgcagactg ggccctttca gagcacgggc tcagctcccc 28560

tgaagagctc acctacgagg aacttaaaaa attgccttcc atcaagggca tcccgcgctt 28620

cttggaactt tacattgtgg gccacaacat caacggcttt gacgagatcg tgctcgccgc 28680

ccaggtaatt aacaaccgtt ccgaggtgcc gggacccttc cgcatcacac gcaactttat 28740

gcctcgcgcg ggaaagatac tcttcaacga tgtcaccttc gccctgccaa atccgcgttc 28800

caaaaagcgc acggactttt tgctctggga gcagggcgga tgcgacgaca ctgacttcaa 28860

ataccagtac ctcaaagtca tggtcaggga cacctttgcg ctcacccaca cctcgctccg 28920

gaaggccgcg caggcatacg cgctacccgt agaaaaggga tgctgcgcct accaggccgt 28980

caaccagttc tacatgctag gctcttaccg ttcggaggcc gacgggtttc cgatccaaga 29040

gtactggaaa gaccgcgaag agtttgtcct caaccgcgag ctgtggaaaa aaaagggaca 29100

ggataagtat gacatcatca aggaaaccct ggactactgc gccctagacg tgcaggtcac 29160

cgccgagctg gtcaacaagc tgcgcgactc ctacgcctcc ttcgtgcgtg acgcggtagg 29220

tctcacagac gccagcttca acgtcttcca gcgtccaacc atatcatcca actcacatgc 29280

catcttcagg cagatagtct tccgagcaga gcagcccgcc cgtagcaacc tcggtcccga 29340

cctcctcgct ccctcgcacg aactatacga ttacgtgcgc gccagcatcc gcggtggaag 29400

atgctaccct acatatcttg gaatactcag agagcccctc tacgtttacg acatttgcgg 29460

catgtacgcc tccgcgctca cccaccccat gccatggggt cccccactca acccatacga 29520

gcgcgcgctt gccgcccgcg catggcagca ggcgctagac ttgcaaggat gcaagataga 29580

ctacttcgac gcgcgcctgc tgcccggggt ctttaccgtg gacgcagacc ccccggacga 29640

gacgcagcta gaccccctac cgccattctg ctcgcgcaag ggcggccgcc tctgctggac 29700

caacgagcgc ctacgcggag aggtagccac cagcgttgac cttgtcaccc tgcacaaccg 29760

cggttggcgc gtgcacctgg tgcccgacga gcgcaccacc gtctttcccg aatggcggtg 29820

cgttgcgcgc gaatacgtgc agctaaacat cgcggccaag gagcgcgccg atcgcgacaa 29880

aaaccaaacc ctgcgctcca tcgccaagtt gctgtccaac gccctctacg ggtcgtttgc 29940

caccaagctt gacaacaaaa agattgtctt ttctgaccag atggatgcgg ccaccctcaa 30000

aggcatcacc gcgggccagg tgaatatcaa atcctcctcg tttttggaaa ctgacaatct 30060

tagcgcagaa gtcatgcccg cttttcagag ggagtactca ccccaacagc tggccctcgc 30120

agacagcgat gcggaagaga gtgaggacga acgcgccccc accccctttt atagcccccc 30180

ttcaggaaca cccggtcacg tggcctacac ctacaaacca atcaccttcc ttgatgccga 30240

agagggcgac atgtgtcttc acaccctgga gcgagtggac cccctagtgg acaacgaccg 30300

ctacccctcc cacttagcct ccttcgtgct ggcctggacg cgagcctttg tctcagagtg 30360

gtccgagttt ctatacgagg aggaccgcgg aacaccgctc gaggacaggc ctctcaagtc 30420

tgtatacggg gacacggaca gccttttcgt caccgagcgt ggacaccggc tcatggaaac 30480

cagaggtaag aaacgcatca aaaagcatgg gggaaacctg gtttttgacc ccgaacggcc 30540

agagctcacc tggctcgtgg aatgcgagac cgtctgcggg gcctgcggcg cggatgccta 30600

ctccccggaa tcggtatttc tcgcgcccaa gctctacgcc ctcaaaagtc tgcactgccc 30660

ctcgtgcggc gcctcctcca agggcaagct gcgcgccaag ggccacgccg cggaggggct 30720

ggactatgac accatggtca aatgctacct ggccgacgcg cagggcgaag accggcagcg 30780

cttcagcacc agcaggacca gcctcaagcg caccctggcc agcgcgcagc ccggagcgca 30840

ccccttcacc gtgacccaga ctacgctgac gaggaccctg cgcccgtgga aagacatgac 30900

cctggcccgt ctggacgagc accgactact gccgtacagc gaaagccgcc ccaacccgcg 30960

aaacgaggag atatgctgga tcgagatgcc gtagagcagg tgaccgagct gtgggaccgc 31020

ctggaactgc ttggtcaaac gctcaaaagc atgcctacgg cggacggtct caaaccgttg 31080

aaaaactttg cttccttgca agaactgcta tcgctgggcg gcgagcgcct tctggcggat 31140

ttggtcaggg aaaacatgcg agtcagggac atgcttaacg aagtggcccc cctgctcagg 31200

gatgacggca gctgcagctc tcttaactac cagttgcagc cggtaatagg tgtgatttac 31260

gggcccaccg gctgcggtaa gtcgcagctg ctcaggaacc tgctttcttc ccagctgatc 31320

tcccctaccc cggaaaccgt tttcttcatc gccccgcagg tagacatgat ccccccatct 31380

gaactcaaag cgtgggaaat gcaaatctgt gagggtaact acgcccctgg gccggatgga 31440

accattatac cgcagtctgg caccctccgc ccgcgctttg taaaaatggc ctatgacgat 31500

ctcatcctgg aacacaacta tgacgttagt gatcccagaa atatcttcgc ccaggccgcc 31560

gcccgtgggc ccattgccat cattatggac gaatgcatgg aaaatcttgg aggtcacaag 31620

ggcgtctcca agttcttcca cgcatttcct tctaagctac atgacaaatt tcccaagtgc 31680

accggataca ctgtgctggt ggttctgcac aacatgaatc cccggaggga tatggctggg 31740

aacatagcca acctaaaaat acagtccaag atgcatctca tatccccacg tatgcaccca 31800

tcccagctta accgctttgt aaacacttac accaagggcc tgcccctggc aatcagcttg 31860

ctactgaaag acatttttag gcaccacgcc cagcgctcct gctacgactg gatcatctac 31920

aacaccaccc cgcagcatga agctctgcag tggtgctacc tccaccccag agacgggctt 31980

atgcccatgt atctgaacat ccagagtcac ctttaccacg tcctggaaaa aatacacagg 32040

accctcaacg accgagaccg ctggtcccgg gcctaccgcg cgcgcaaaac ccctaaataa 32100

agacagcaag acacttgctt gatccaaatc caaacagagt ctggtttttt atttatgttt 32160

taaaccgcat tgggagggga ggaagccttc agggcagaaa cctgctggcg cagatccaac 32220

agctgctgag aaacgacatt aagttcccgg gtcaaagaat ccaattgtgc caaaagagcc 32280

gtcaacttgt catcgcgggc ggatgaacgg gaagctgcac tgcttgcaag cgggctcagg 32340

aaagcaaagt cagtcacaat cccgcgggcg gtggctgcag cggctgaagc ggcggcggag 32400

gctgcagtct ccaacggcgt tccagacacg gtctcgtagg tcaaggtagt agagtttgcg 32460

ggcaggacgg ggcgaccatc aatgctggag cccatcacat tctgacgcac cccggcccat 32520

gggggcatgc gcgttgtcaa atatgagctc acaatgcttc catcaaacga gttggtgctc 32580

atggcggcgg cggctgctgc aaaacagata caaaactaca taagaccccc accttatata 32640

ttctttccca cccttgtatc tgctccctgc ttgtgtgttg gaggtcgctg agtagtgcgc 32700

gagcaaaatt taagctacaa caaggcaagg cttgaccgac aattgcatga agaatctgct 32760

tagggttagg cgttttgcgc tgcttcgcga tgtacgggcc agatatacgc gttgacattg 32820

attattgact agttattaat agtaatcaat tacggggtca ttagttcata gcccatatat 32880

ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc 32940

ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca 33000

ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta 33060

tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta 33120

tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat 33180

cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat agcggtttga 33240

ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt tttggcacca 33300

aaatcaacgg gactttccaa aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg 33360

taggcgtgta cggtgggagg tctatataag cagagctctc tggctaacta gagaacccac 33420

tgcttactgg cttatcgaaa ttaatacgac tcactatagg gagacccaag ctggctagcg 33480

tttaaactta agcttggtac cgagctcgga tccgccacca tggtggagac ccagatggac 33540

aagctggggt tcctgctgaa ccacatcggc aagcaggtga ccaccaaggt gctgagcaac 33600

gcccacatca cccagaccat gaaggaaatc atcctggaga atcacagcgt ggacggcggc 33660

gccgccaaga acgtgagcaa gggcaagagc agccccaaag aaaaaaagca ctggaccgag 33720

ttcgagagct gggagcagct gagcaagagc aagcgcagct tcaaggagta ctgggccgag 33780

cgcaacgaga tcgtgaacac cctgctgctg aactgggaca acgtgcgcgg cgccatcaag 33840

aagttcctgg acgacgaccg cgagtggtgc ggccggatca acatgatcaa cggcgtgccc 33900

gagatcgtgg agatcatccc cagcccctac cgcgccggcg agaacatcta cttcggcagc 33960

gaggccatga tgcccgccga catctacagc cgcgtggcca acaagcccgc catgttcgtg 34020

ttccacaccc accccaacct gggcagctgc tgcggcggca tgcccagcat ctgcgacatc 34080

agcaccaccc tgcgctacct gctgatgggc tggaccgccg gccacctgat catcagcagc 34140

aaccaggtgg gcatgctgac cgtggacaag cgcatcatcg tggacctgtg ggccaacgag 34200

aacccccgct ggctgatggc ccagaagatc ctggacatct tcatgatgct gaccagccgc 34260

cgcagcctgg tgaacccctg gaccctgcgc gacctgaaga agatcctgca ggactacggc 34320

atcgagtaca tcatcttccc cagcaacgac ttcttcatct acgaggacga gcgcctgctg 34380

atgttcagca agaagtggac caacttcttc accctgcacg agctgctgga cgacctggag 34440

accatcgaga ccaaggccag cagcaccacc tacccctacg acgtgcccga ctacgcctga 34500

gatatcggac tataaggatg atgacgacaa ataatagcaa ttcctcgacg actgcatagg 34560

gttacccccc tctccctccc ccccccctaa cgttactggc cgaagccgct tggaataagg 34620

ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg gcaatgtgag 34680

ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt cccctctcgc 34740

caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg aagcttcttg 34800

aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac ctggcgacag 34860

gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg cacaacccca 34920

gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct caagcgtatt 34980

caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg atctggggcc 35040

tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aacgtctagg ccccccgaac 35100

cacggggacg tggttttcct ttgaaaaaca cgatgataat ggccacaacc gcggccgcat 35160

gaacaagaag atcatcgtga tgatggccct gctgcacaag gagaagctga tcgagtgcat 35220

ctaccacgag ctggaaaacg gcggaaccat cctgctgctg accaagaaca tcgtggtctc 35280

cgagatcagc tacattggca acacctacaa atacttcacc ttcaacgaca accacgacct 35340

catcagcaaa gaagacctga agggcgccac ctccaaaaac atcgccaaaa tgatctacaa 35400

ctggatcatc aaaaaccccc agaacaacaa gatctggtcc ggcgaacccc gcacccagat 35460

ctacttcgag aacgacctgt accacaccaa ctacaaccac aaatgcatca aggacttctg 35520

gaacgtgagc acctccgtgg gcccccacat ctttaacgac cgctccatct ggtgcaccaa 35580

gtgcaccagc ttttacccct tcaccaacat catgtccccc aacatcttcc agcaccatca 35640

ccaccaccac tgactcgagt ctagagggcc cgtttaaacc cgctgatcac ttcgcccacc 35700

ccaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca 35760

caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat 35820

cttatcatgt ctggatcggt gatcaccgat cccggaaaaa cacctgggcg agtctccacg 35880

taaacggtca aagtccccgc gggccctaga caaatattac gcgctatgag taacacaaaa 35940

ttattcagat ttcacttcct cttattcagt tttcccgcga aaatggccaa atcttactcg 36000

gttacgccca aatttactac aacatccgcc taaaaccgcg cgaaaattgt cacttcctgt 36060

gtacaccggc gcacaccaaa aacgtcactt ttgccacatc cgtcgcttac atgtgttccg 36120

ccacacttgc aacatcacac ttccgccaca ctactacgtc acccgccccg ttcccacgcc 36180

ccgcgccacg tcacaaactc caccccctca ttatcatatt ggcttcaatc caaaataagg 36240

tatattattg atgatgataa gctatcaaac atgagaattc ggcgcgccat tatcatttgc 36300

gggtcctttc cggcgatccg ccttgttacg gggcggcgac ctcgcgggtt ttcgctattt 36360

atgaaaattt tccggtttaa ggcgtttccg ttcttcttcg tcataactta atgtttttat 36420

ttaaaatacc ctctgaaaag aaaggaaacg acaggtgctg aaagcgagct ttttggcctc 36480

tgtcgtttcc tttctctgtt tttgtccgtg gaatgaacaa cgcgcctcac tgcccgcttt 36540

ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg 36600

cggtttgcgt attgggcgcc agggtggttt ttcttttcac cagtgagacg ggcaacagct 36660

gattgccctt caccgcctgg ccctgagaga gttgcagcaa gcggtccacg ctggtttgcc 36720

ccagcaggcg aaaatcctgt ttgatggtgg ttgacggcgg gatataacat gagctgtctt 36780

cggtatcgtc gtatcccact accgagatat ccgcaccaac gcgcagcccg gactcggtaa 36840

tggcgcgcat tgcgcccagc gccatctgat cgttggcaac cagcatcgca gtgggaacga 36900

tgccctcatt cagcatttgc atggtttgtt gaaaaccgga catggcactc cagtcgcctt 36960

cccgttccgc tatcggctga atttgattgc gagtgagata tttatgccag ccagccagac 37020

gcagacgcgc cgagacagaa cttaatgggc ccgctaacag cgcgatttgc tggtgaccca 37080

atgcgaccag atgctccacg cccagtcgcg taccgtcttc atgggagaaa ataatactgt 37140

tgatgggtgt ctggtcagag acatcaagaa ataacgccgg aacattagtg caggcagctt 37200

ccacagcaat ggcatcctgg tcatccagcg gatagttaat gatcagccca ctgacgcgtt 37260

gcgcgagaag attgtgcacc gccgctttac aggcttcgac gccgcttcgt tctaccatcg 37320

acaccaccac gctggcaccc agttgatcgg cgcgagattt aatcgccgcg acaatttgcg 37380

acggcgcgtg cagggccaga ctggaggtgg caacgccaat cagcaacgac tgtttgcccg 37440

ccagttgttg tgccacgcgg ttgggaatgt aattcagctc cgccatcgcc gcttccactt 37500

tttcccgcgt tttcgcagaa acgtggctgg cctggttcac cacgcgggaa acggtctgat 37560

aagagacacc ggcatactct gcgacatcgt ataacgttac tggtttcaca ttcaccaccc 37620

tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg caccattcac 37680

ctgcacaccg cgccttaatt aagaattccg tgtattctat agtgtcacct aaatcgtatg 37740

tgtatgatac ataaggttat gtattaattg tagccgcgtt ctaacgacaa tatgtacaag 37800

cctaattgtg tagcatctgg cttactgaag cagaccctat catctctctc gtaaactgcc 37860

gtcagagtcg gtttggttgg acgaaccttc tgagtttctg gtaacgccgt tccgcacccc 37920

ggaaatggtc agcgaaccaa tcagcagggt catcgctagc cagatcctct acgccggacg 37980

catcgtggcc aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc 38040

ttaacgtgag ttttcgttcc actgagcgtc agacccctta ataagatgat cttcttgaga 38100

tcgttttggt ctgcgcgtaa tctcttgctc tgaaaacgaa aaaaccgcct tgcagggcgg 38160

tttttcgaag gttctctgag ctaccaactc tttgaaccga ggtaactggc ttggaggagc 38220

gcagtcacca aaacttgtcc tttcagttta gccttaaccg gcgcatgact tcaagactaa 38280

ctcctctaaa tcaattacca gtggctgctg ccagtggtgc ttttgcatgt ctttccgggt 38340

tggactcaag acgatagtta ccggataagg cgcagcggtc ggactgaacg gggggttcgt 38400

gcatacagtc cagcttggag cgaactgcct acccggaact gagtgtcagg cgtggaatga 38460

gacaaacgcg gccataacag cggaatgaca ccggtaaacc gaaaggcagg aacaggagag 38520

cgcacgaggg agccgccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 38580

caccactgat ttgagcgtca gatttcgtga tgcttgtcag gggggcggag cctatggaaa 38640

aacggctttg ccgcggccct ctcacttccc tgttaagtat cttcctggca tcttccagga 38700

aatctccgcc ccgttcgtaa gccatttccg ctcgccgcag tcgaacgacc gagcgtagcg 38760

agtcagtgag cgaggaagcg gaatatatcc tgtatcacat attctgctga cgcaccggtg 38820

cagccttttt tctcctgcca catgaagcac ttcactgaca ccctcatcag tgccaacata 38880

gtaagccagt atacactccg ctagcgctga ggtctgcctc gtgaagaagg tgttgctgac 38940

tcataccagg cctgaatcgc cccatcatcc agccagaaag tgagggagcc acggttgatg 39000

agagctttgt tgtaggtgga ccagttggtg attttgaact tttgctttgc cacggaacgg 39060

tctgcgttgt cgggaagatg cgtgatctga tccttcaact cagcaaaagt tcgatttatt 39120

caacaaagcc acgttgtgtc tcaaaatctc tgatgttaca ttgcacaaga taaaaatata 39180

tcatcatgaa caataaaact gtctgcttac ataaacagta atacaagggg tgttatgagc 39240

catattcaac gggaaacgtc ttgctcgagg ccgcgattaa attccaacat ggatgctgat 39300

ttatatgggt ataaatgggc tcgcgataat gtcgggcaat caggtgcgac aatctatcga 39360

ttgtatggga agcccgatgc gccagagttg tttctgaaac atggcaaagg tagcgttgcc 39420

aatgatgtta cagatgagat ggtcagacta aactggctga cggaatttat gcctcttccg 39480

accatcaagc attttatccg tactcctgat gatgcatggt tactcaccac tgcgatcccc 39540

gggaaaacag cattccaggt attagaagaa tatcctgatt caggtgaaaa tattgctgat 39600

gcgctggcag tgttcctgcg ccggttgcat tcgattcctg tttgtaattg tccttttaac 39660

agcgatcgcg tatttcgtct cgctcaggcg caatcacgaa tgaataacgg tttggttgat 39720

gcgagtgatt ttgatgacga gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg 39780

cata 39784

<210> 7

<211> 1023

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atcgtttgtg ttatgtttca acgtgtttat ttttcaattg cagaaaattt caagtcattt 60

ttcattcagt agtatagccc caccaccaca tagcttatac agatcaccgt accttaatca 120

aactcacaga accctagtct acatgggggt agagtcataa tcgtgcatca ggatagggcg 180

gtggtgctgc agcagcgcgc gaataaactg ctgccgccgc cgctccgtcc tgcaggaata 240

caacatggca gtggtctcct cagcgatgat tcgcaccgcc cgcagcataa ggcgccttgt 300

cctccgggca cagcagcgca ccctgatctc acttaaatca gcacagtaac tgcagcacag 360

caccacaata ttgttcaaaa tcccacagtg caaggcgctg tatccaaagc tcatggcggg 420

gaccacagaa cccacgtggc catcatacca caagcgcagg tagattaagt ggcgacccct 480

cataaacacg ctggacataa acattacctc ttttggcatg ttgtaattca ccacctcccg 540

gtaccatata aacctctgat taaacatggc gccatccacc accatcctaa accagctggc 600

caaaacctgc ccgccggcta tacactgcag ggaaccggga ctggaacaat gacagtggag 660

agcccaggac tcgtaaccat ggatcatcat gctcgtcatg atatcaatgt tggcacaaca 720

caggcacacg tgcatacact tcctcaggat tacaagctcc tcccgcgtta gaaccatatc 780

ccagggaaca acccattcct gaatcagcgt aaatcccaca ctgcagggaa gacctcgcac 840

gtaactcacg ttgtgcattg tcaaagtgtt acattcgggc agcagcggat gatcctccag 900

tatggtagcg cgggtttctg tctcaaaagg aggtagacga tccctactgt acggagtgcg 960

ccgagacaac cgagatcgtg ttggtcgtag tgtcatgcca aatggaacgc cggacgtagt 1020

cat 1023

<210> 8

<211> 644

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ggactataag gatgatgacg acaaataata gcaattcctc gacgactgca tagggttacc 60

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 120

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 180

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 240

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 300

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 360

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 420

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 480

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 540

cacatgcttt acatgtgttt agtcgaggtt aaaaaacgtc taggcccccc gaaccacggg 600

gacgtggttt tcctttgaaa aacacgatga taatggccac aacc 644

<210> 9

<211> 66

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60

ggacct 66

<210> 10

<211> 2796

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gaattccgtg tattctatag tgtcacctaa atcgtatgtg tatgatacat aaggttatgt 60

attaattgta gccgcgttct aacgacaata tgtacaagcc taattgtgta gcatctggct 120

tactgaagca gaccctatca tctctctcgt aaactgccgt cagagtcggt ttggttggac 180

gaaccttctg agtttctggt aacgccgttc cgcaccccgg aaatggtcag cgaaccaatc 240

agcagggtca tcgctagcca gatcctctac gccggacgca tcgtggccgg catcaccggc 300

gccacaggtg cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct 360

cgccacttcg ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc 420

gggggactgt tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac 480

ggcctcaacc tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga 540

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 600

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 660

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcattcacc gtcatcaccg 720

aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 780

ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 840

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 900

atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 960

attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 1020

gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 1080

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 1140

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 1200

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 1260

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 1320

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 1380

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 1440

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 1500

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 1560

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 1620

aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 1680

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 1740

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 1800

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 1860

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 1920

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 1980

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 2040

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 2100

ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 2160

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 2220

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 2280

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 2340

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 2400

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 2460

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 2520

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 2580

ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 2640

accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 2700

gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 2760

gttggccgat tcattaatgc agctggctta tcgaaa 2796

<210> 11

<211> 1722

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaattca aaattttatc 120

gtactagtgg atctgcgatc gctccggtgc ccgtcagtgg gcagagcgca catcgcccac 180

agtccccgag aagttggggg gaggggtcgg caattgaacg ggtgcctaga gaaggtggcg 240

cggggtaaac tgggaaagtg atgtcgtgta ctggctccgc ctttttcccg agggtggggg 300

agaaccgtat ataagtgcag tagctcccta tcagtgatag agatctccct atcagtgata 360

gagattcgcc gtgaacgttc tttttcgcaa cgggtttgcc gccagaacac agctgaagct 420

tcgaggggct cgcatctctc cttcacgcgc ccgccgccct acctgaggcc gccatccacg 480

ccggttgagt cgcgttctgc cgcctcccgc ctgtggtgcc tcctgaactg cgtccgccgt 540

ctaggtaagt ttaaagctca ggtcgagacc gggcctttgt ccggcgctcc cttggagcct 600

acctagactc agccggctct ccacgctttg cctgaccctg cttgctcaac tctacgtctt 660

tgtttcgttt tctgttctgc gccgttacag atccaagctg tgaccggcgc ctacggatcc 720

gccaccatgg tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag 780

ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc 840

acctacggca agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg 900

cccaccctcg tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac 960

atgaagcagc acgacttctt caagtccgcc atgcccgaag gctacgtcca ggagcgcacc 1020

atcttcttca aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac 1080

accctggtga accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg 1140

gggcacaagc tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag 1200

aagaacggca tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag 1260

ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac 1320

aaccactacc tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac 1380

atggtcctgc tggagttcgt gaccgccgcc gggatcactc tcggcatgga cgagctgtac 1440

aagtaactcg agtctagagg gcccgtttaa acccgctgat cagcctcgat aatcatctct 1500

tgtacatgtc ccactgttca agcctccaag ctgtgccttg ggtggctttg gggcatggac 1560

attgaccctt ataaagaatt tggagctact gtggagttac tctcgttttt gccttctgac 1620

ttctttcctt ccgtcagaga tctcctagac accgcctcag ctctgtatcg agaagcctta 1680

gagtctcctc ttctgaggcg gaaagaacca gctggggctc ta 1722

<210> 12

<211> 957

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gtatctgctc cctgcttgtg tgttggaggt cgctgagtag tgcgcgagca aaatttaagc 60

tacaacaagg caaggcttga ccgacaattg catgaagaat ctgcttaggg ttaggcgttt 120

tgcgctgctt cgcgatgtac gggccagata tacgcgttga cattgattat tgactagtta 180

ttaatagtaa tcaattacgg ggtcattagt tcatagccca tatatggagt tccgcgttac 240

ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc cattgacgtc 300

aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac gtcaatgggt 360

ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac 420

gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac 480

cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggt 540

gatgcggttt tggcagtaca tcaatgggcg tggatagcgg tttgactcac ggggatttcc 600

aagtctccac cccattgacg tcaatgggag tttgttttgg caccaaaatc aacgggactt 660

tccaaaatgt cgtaacaact ccgccccatt gacgcaaatg ggcggtaggc gtgtacggtg 720

ggaggtctat ataagcagag ctctctggct aactagagaa cccactgctt actggcttat 780

cgaaattaat acgactcact atagggagac ccaagctggc tagcgtttaa acttaagctt 840

ggtaccgagc tcggatccac tagtccagtg tggtggaatt ctgcagatat ccagcacagt 900

ggcggccgct cgagtctaga gggcccgttt aaacccgctg atcacttcgc ccacccc 957

<210> 13

<211> 147

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

tatcatgtct gtataccgtc gacctct 147

Claims

1. The African swine fever virus vaccine is characterized in that the vaccine is obtained by constructing a recombinant adenovirus vector for coexpression of four antigen genes of African swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells;

the four antigen genes are F317L, A151R, P and pp62 respectively, wherein F317L and A151R are expressed in an E1 region, P34 and pp62 are expressed in an E4 region, and the four antigen genes are co-expressed in a recombinant adenovirus vector pAd5LCL 3; constructing four antigen gene coexpression recombinant adenovirus vectors;

wherein, the recombinant adenovirus vector is packaged by 293TD37 cells constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the cell strain preservation number of the 293TD37 cells is: CCTCC NO. C201996, preserved in China center for type culture Collection;

the nucleotide sequences of F317L, A151R, P, pp62 and pAd5LCL3 are shown as Seq ID No.1, seq ID No.2, seq ID No.3, seq ID No.4 and Seq ID No.5 in the sequence table.

2. A method for constructing a recombinant adenovirus vector co-expressed with four antigen genes of african swine fever virus according to claim 1, comprising the steps of:

1) The E1 gene of the adenovirus circular vector plasmid is knocked out by using CRISPR/cas9, a SwaI enzyme cutting site is introduced, the fused fragment and the vector are subjected to seamless cloning, the E3 gene is knocked out by using CRISPR/cas9, and then the adenovirus circular vector plasmid pAd5 with the E1 and E3 genes deleted is obtained by adopting a seamless cloning mode for connection;

2) Then, knocking out the E4 gene of the adenovirus circular vector plasmid pAd5 by using CRISPR/cas9, amplifying by using PCR, introducing an I-sceI enzyme cutting site, and obtaining adenovirus vector plasmid pAd5 delta E4 with deleted E1, E3 and E4 genes by using a seamless cloning method;

3) Knocking out the E2a gene of adenovirus circular vector plasmid pAd5 delta E4 by using CRISPR/cas9, placing an ORF6/7 expression cassette of an E4 region at the sequence position of the knocked-out E2a region, and obtaining adenovirus vector plasmid pAd5LCL3 with deleted E1, E3, E4 and E2a genes by using a seamless cloning method;

4) Constructing an adenovirus E1 region shuttle plasmid pS5E1, and respectively connecting the adenovirus E1 region shuttle plasmid pS5E1-F317L-IRES-A151R with F317L, IRES and A151R gene fragments through DNA ligase to construct an African swine fever adenovirus 5 type vector E1 region shuttle plasmid pS5E1-F317L-IRES-A151R;

5) Constructing an adenovirus E4 region shuttle plasmid pS5E4-EGFP, obtaining a P34-2A-pp62 gene fragment by fusion PCR technology through the genes P34 and 2A, pp, and deleting the EGFP by enzyme cutting the shuttle plasmid pS5E4-EGFP, and connecting the EGFP with the P34-2A-pp62 through DNA ligase to construct an African swine fever adenovirus 5 type vector E4 region shuttle plasmid pS5E4-P34-2A-pp62;

6) Homologous recombination is carried out on the shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3 to obtain adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R;

7) The shuttle plasmid pS5E4-P34-2A-pp62 and an adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R are subjected to homologous recombination to obtain a recombinant adenovirus vector co-expressed by four antigen genes, wherein the nucleotide sequence of the recombinant adenovirus vector co-expressed by the four antigen genes is shown as a sequence table of Seq ID No. 6.

3. The method according to claim 2, wherein the adenovirus circular vector plasmid of step 1) is derived from amplifying wild-type human adenovirus type 5 virus in a549 cells, collecting and concentrating the virus solution, extracting adenovirus type 5 genome by HirtVirual DNA Extract method, constructing linear adenovirus type 5 genome into circular adenovirus circular vector plasmid by cosmid method.

4. The method according to claim 2, wherein the nucleotide sequence of the ORF6/7 expression cassette gene of step 3) is shown as Seq ID No.7 in the sequence listing; the nucleotide sequence of the IRES in the step 4) is shown as a Seq ID No.8 in a sequence table; the nucleotide sequence of the 2A in the step 5) is shown as a Seq ID No.9 in a sequence table.

5. The method of claim 2, wherein the shuttle plasmid pS5E1 backbone of step 4) employs a puc origin, an amp base element, ad5 left arm ITR partial sequence, right arm PIX, PIVa2 partial sequence, and CMV-MCS SV40 early polyA; the skeleton of the E4 region shuttle plasmid pS5E4-EGFP adopts puc origin and amp basic elements, the Ad5E4 region left arm ITR sequence, the right arm partial fiber gene sequence and the EF1 alpha-EGFP-HBV polyA gene; the nucleotide sequences of the basic elements of the puc origin and the amp are shown as SEQ ID NO.10 in the sequence table, and the nucleotide sequence of the EF1 alpha-EGFP-HBV polyA gene is shown as SEQ ID NO.11 in the sequence table.

6. The method of claim 2, wherein step 6) the shuttle plasmid pS5E1-F317L-IRES-A151R is homologously recombined with the adenovirus vector plasmid pAd5LCL3 by enzyme digestion of the shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3 with PacI and SwaI, dephosphorylation of the enzyme digestion product, gel recovery of vector and fragment with OMEGA Ultra-Sep Gel Extraction Kit, plating of the transformed product, picking colonies, and XhoI enzyme digestion verification.

7. The method of claim 2, wherein step 7) the shuttle plasmid pS5E4-P34-2A-pp62 is subjected to homologous recombination with the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R by digestion of the shuttle plasmid pS5E4-P34-2A-pp62 and the adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R with PacI and I-sceI, dephosphorylation of the digested product, gel recovery of the vector and fragments with OMEGA Ultra-Sep Gel Extraction Kit, plating of the transformed product, picking colonies, and XhoI digestion verification.

8. A packaging method of a recombinant adenovirus vector, which is characterized in that the recombinant adenovirus vector co-expressed by four antigen genes of African swine fever virus according to claim 1 is cut by PacI, and a linearized plasmid is used for transfection; 293TD37 cells constructed from pcDNA3.1+ (hyg) -ORF6-IRES-DBP were transfected and cell suspensions were collected.

9. The method of claim 8, wherein the method comprises the steps of:

1) The four antigen gene co-expression recombinant adenovirus vectors are cut by PacI enzyme, and the linearized plasmid is used for transfection; transfecting 293TD37 cells with PEI transfection reagent;

3) TP0 adenovirus infection 293TD37 cells at 37 ℃,5% CO ₂ Culturing in an incubator for 72 hours, and collecting cell suspension, namely TP1 adenovirus;

5) The inoculation is continued until the cells are diseased.

Use of 10.293TD37 cells for packaging a recombinant adenovirus vector co-expressed by four antigen genes of african swine fever virus according to claim 1, wherein the four antigen genes are F317L, A151R, P and pp62, respectively, wherein F317L and a151R are expressed in the E1 region and P34 and pp62 are expressed in the E4 region, to form a recombinant adenovirus vector co-expressed by the four antigen genes;

wherein, the 293TD37 cell is constructed by pcDNA3.1+ (hyg) -ORF6-IRES-DBP, and the cell strain is deposited with the number: CCTCC NO. C201996, which is preserved in China center for type culture Collection.