CN109652449A

CN109652449A - A kind of EP153R and EP402R gene co-expressing recombinant adenoviral vector constructs and adenovirus packing method

Info

Publication number: CN109652449A
Application number: CN201811495616.5A
Authority: CN
Inventors: 张泉; 朱立麒; 谢灵志; 郭晓宇; 朱鸿飞
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2018-12-07
Filing date: 2018-12-07
Publication date: 2019-04-19

Abstract

The present invention provides a kind of EP153R and EP402R gene co-expressing recombinant adenoviral vector constructs and adenovirus packing method, belongs to gene engineering technology field.A kind of EP153R gene and EP402R gene overexpression adenovirus vector pAD-Shuttle-CMV-CTLA4-EP153R-EP402R introduce CTLA4, EP153R, EP402R gene based on pShuttle-CMV carrier for expression of eukaryon at multiple cloning sites.The present invention also provides the recombined adhenovirus of coexpression EP153R, EP402R gene, adenovirus packaging process is realized using the pAD-Shuttle-CMV-CTLA4-EP153R-EP402R carrier that building obtains, obtain the adenovirus for capableing of direct infection animal or eukaryocyte, to realize the purpose that EP153R and EP402R gene co-express in eukaryocyte, realize that the adenovirus vaccine of EP153R and EP402R gene co-expressing is laid a good foundation for research.

Description

A kind of EP153R and EP402R gene co-expressing recombinant adenoviral vector constructs and adenopathy Malicious packing method

Technical field

The invention belongs to gene engineering technology fields, specifically relate to a kind of African swine fever virus EP153R and EP402R gene is total Express recombinant adenoviral vector, construction method and adenovirus packing method.

Background technique

African swine fever (african swine fever, ASF) is one kind of the pig as caused by African swine fever virus (ASFV) Acute, hot, high degree in contact communicable disease.It is characterized in that the course of disease is short, case fatality rate is high, clinical symptoms are similar with pathological change In acute swine fever, high fever, dermohemia, miscarriage, oedema and internal organs bleeding are showed.ASFV is positive two that a kind of diameter is 200nm Decahedron virus, virus contain 70~100nm of diameter DNA core, periphery be the icosahedral capsid of 172~191nm of diameter and Cyst membrane containing lipoid.ASFV genome is the unimolecule threadiness double-stranded DNA of terminal covalent closure, and 170~190kb of size is (with poison Strain it is different and variant), end interactive connection, have inverted terminal repeats.Genome can encode 150~200 hatching eggs White matter, many genes for encoding these protein have been cloned and have expressed.

Gene (NC_010457.5) is i.e. by CTLA4 (cytotoxic T-lymphocyte associated protein 4) Cytotoxic T cell related antigen -4: contactin, mainly in CD4+ the and CD8+T cell of activation and The B cell surface expression of activation.CTLA-4 can be with the B7 molecule in CD28 molecule competitive binding T cell, and its affinity is 10~50 times of CD28, therefore be the major surfaces binding molecule of immune response negative regulator, it can be used as the target of antigen presenting cell To molecule, strong humoral and cellular immune response is induced.

EP153R gene (NC_001659.2) overall length 474bp, coding generate the transmembrane protein of 158 base compositions, with There is significant homology in the N-terminal region of CD44 molecule, comprising N- glycosylation site, phosphorylation site, acylation site, Central transmembrane region, c type animal agglutinate structure domain, cell attachment sequence column.EP153R gene mainly early stage virus infection with evening Phase, it was reported that EP153R gene can induce or keep the combination of virus CD2 homologue and its corresponding receptor；The C of EP153R gene Type animal agglutinate structure domain is inhibited to MHC-I class antigen presentation；The presence of EP153R gene makes virus infection or star The transcriptional activity that shape spore rhzomorph handles P53 albumen in Vero cell reduces, this is the c type that first description has anti-apoptotic characteristic Zoo-agglutinin.The recombinant adenoviral vector of building expression EP153R gene can preferably study gene function, non-to research and develop Continent swine fever candidate vaccine provides technical support.

EP402R gene (NC_001659.2) encodes CD2v, which has signal peptide sequence and a transmembrane region, extracellular The CD2 of area's immunoglobulin like domain containing there are two, amino acid sequence and host cell is closely similar, but the ammonia of intracellular region Base acid sequence and CD2 do not have similitude, so referred to as CD2v.CD2 is the table of T cell and NK cell, B cell and macrophage Face molecule.Its ligand is the CD58 molecule expressed in multiple types cell surface, and T cell and antigen are offered carefully in the combination of the two Combination between born of the same parents has stabilization, therefore participates in the activation of T cell.CD2v can in conjunction with the adaptor protein of host cell, The endocytosis and Protein transport for interfering host cell, lead to infected macrophage, and the secretion and distribution of albumen change, And then the transmitting of jammer signal, inhibit the function of lymphocyte.Since erythrocyte surface has the ligand of CD2, so ASFV feels Characteristic garland can be formed, it is so-called to occur by the erythrocyte binding in the CD2v molecule and pig blood on its surface by contaminating cell Hemadsorption phenomenon.CD2v is also present in the outer layer of viral clever grain, so virion can also adsorb the red blood cell of pig, in fact In the blood of hemadsorption venereal disease virus strain infection pig, 90% virus is in hemadsorption state, and this hemadsorption phenomenon may It is one of the important mechanisms of virus diffusive transport in pig body.

And currently, in the prior art without the recombinant adenoviral vector of EP153R and EP402R gene co-expressing.

Summary of the invention

In order to overcome drawbacks described above, the purpose of the present invention is to provide a kind of African swine fever virus EP153R and EP402R base Because of the recombined adhenovirus of coexpression, construction method and adenovirus packing method, technology is established for research African swine fever candidate vaccine Basis.

In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:

The present invention provides a kind of African swine fever virus EP153R and EP402R gene co-expressing recombinant adenoviral vector PAD-Shuttle-CMV-CTLA4-EP153R-EP402R, based on pShuttle-CMV carrier for expression of eukaryon, polyclonal CTLA4, EP153R, EP402R gene are introduced at site；The CTLA4 gene has as shown in Seq ID No.1 in sequence table Nucleotide sequence, the EP153R gene have the nucleotide sequence as shown in Seq ID No.2 in sequence table, it is described EP402R gene has the nucleotide sequence as shown in Seq ID No.3 in sequence table.The multiple cloning sites be KpnI, The restriction enzyme site of HindIII.

The present invention also provides a kind of African swine fever virus EP153R and EP402R gene co-expressing recombinant adenoviral vector Construction method, comprising the following steps:

1) it is directed to EP153R gene, EP402R gene, by artificial synthesized, after obtaining optimization genetic fragment, and respectively Corresponding restriction enzyme site and homologous region are added at EP153R gene, EP402R gene order both ends；CTLA4 gene order both ends add Add corresponding restriction enzyme site and homologous region；

2) double digestion is carried out to pShuttle-CMV carrier with restriction enzyme KpnI and HindIII, is linearized PShuttle-CMV carrier；

3) the linearisation pShuttle-CMV carrier for obtaining the step 2) and CTLA4-EP153R, EP402R are carried out same Source recombination, obtains pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid, is carried out using CMV-F and SV40-R Sequencing；

4) the pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid for obtaining the step 3) carries out Transient expression, label protein verify protein expression；

5) the pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid for obtaining the step 3) carries out PmeI digestion is transformed into BJ5183 Escherichia coli and is recombinated, and obtains coexpression adenovirus vector pAD-Shuttle-CMV- CTLA4-EP153R-EP402R。

The present invention also provides a kind of recombined adhenovirus packing methods, by pAD-Shuttle-CMV-CTLA4-EP153R- EP402R co-expresses adenovirus vector and carries out single endonuclease digestion with PacI, and the plasmid after linearisation is for transfecting；293A cell is transfected, it is real Existing recombined adhenovirus packaging.Specifically it is prepared by the following steps to obtain:

1) pAD-Shuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid is subjected to single endonuclease digestion with PacI, Plasmid after linearisation is for transfecting；293A cell is transfected using Lip3000 transfection reagent；

2) more to cell detachment after transfecting, cell and supernatant are collected, as P1 is for adenovirus；

3) P1 observes cell state for adenovirus infection 293A cell.

The invention further relates to the recombined adhenovirus that recombined adhenovirus packing method above-mentioned is prepared, and comprising aforementioned Recombined adhenovirus vaccine.

The present invention provides a kind of EP153R gene overexpression adenovirus vector pAD-Shuttle-CMV-CTLA4- EP153R-EP402R, based on pShuttle-CMV carrier for expression of eukaryon, at multiple cloning sites introduce CTLA4, EP153R, EP402R gene.The carrier carries CMV strong promoter, the gene of its carrying can be overexpressed in eukaryocyte, simultaneously CTLA4 can enhance immune response, be screened, and the adenovirus for capableing of direct infection eukaryocyte be finally obtained, to realize The purpose that EP153R, EP402R gene co-express in eukaryocyte is further research based on coexpression EP153R, EP402R Gene recombinant adenovirus vector vaccine is laid a solid foundation.

Detailed description of the invention

Fig. 1 is pShuttle-CMV-CTLA4-EP153R-EP402R plasmid double digestion proof diagram in embodiment 3；No. 1:1 Plasmid KpnI+HindIII；2:2 plasmid KpnI+HindIII；3:1 plasmid XhoI+HindIII；4:2 plasmid XhoI+ HindIII；M1:1KB DNA Marker；M2:DL2000DNA Marker；

Fig. 2 is to turn HA label protein for 24 hours in pShuttle-CMV-CTLA4-EP153R-EP402R plasmid wink in embodiment 4 WB proof diagram, wherein 1: positive plasmid；2:293T blank control；M: albumen Marker；

Fig. 3 is pAD-Shuttle-CMV-CTLA4-EP153R-EP402R PacI digestion verification figure in embodiment 5；Wherein 1:1 plasmid；2:2 plasmid；M1: λ-HindIII；

Fig. 4 is ADV infection cell 48h HA label protein WB proof diagram in embodiment 7；

M: albumen Marker；1: positive plasmid transfects 293T；2:ADV infects 293A；3:293A；4:ADV infects ST cell； 5:ST cell；

Fig. 5 is pShuttle-CTLA4-EP153R-EP402R plasmid construct figure；

Fig. 6 is pADShuttle-CMV-CTLA4-EP153R-EP402R plasmid construct figure.

Specific embodiment

Below by specific embodiments of the present invention will be described in detail.In order to avoid excessive unnecessary details, It will not be described in detail in following embodiment to belonging to well known structure or function.

In addition to being defined, technical and scientific term used in following embodiment has and fields technology people of the present invention The identical meanings that member is commonly understood by.

In the following example, test method without specific conditions, usually routinely condition, such as " fine works molecular biosciences Learn experiment guide " (F.M. Ao Sibai, R.E. James Kingston, the chief editor such as J.G. Sai Deman, Ma Xuejun, Su Yuelong's translates Beijing: section Learn publishing house, 2004) described in method carry out.

The present invention provides the construction method of a kind of EP153R and EP402R gene co-expressing adenovirus vector, including it is following Step:

1) EP153R gene (NC_001659.2) the EP402R gene (NC_001659.2) that the inquiry website NCBI is included, leads to Artificial synthesized genetic fragment after obtaining optimization is crossed, CTLA4 template is pig cell system, and phase is added at the both ends of 3 segments respectively The restriction enzyme site and homologous sequence answered (restriction enzyme site and homologous sequence are embodied in SEQ ID No.4-11).

2) the step 1) genetic fragment and pShuttle-CMV carrier through KpnI, HindIII double digestion and are recycled, is passed through It crosses homologous recombination to convert to obtain recombinant plasmid pShuttle-CMV-CTLA4-EP153R-EP402R, uses CMV-F and SV40-R It is sequenced.

3) the pShuttle-CMV-CTLA4-EP153R-EP402R plasmid for obtaining the step 2) and use are restricted Restriction endonuclease PmeI digestion；Linearization plasmid is transformed into BJ5183 Escherichia coli, obtains pAD-Shuttle- by recombination CMV-CTLA4-EP153R-EP402R recombinant plasmid.

4) pAD-Shuttle-CMV-CTLA4-EP153R-EP402R recombinant plasmid is transfected by PacI linearization for enzyme restriction 293A cell obtains recombined adhenovirus.

I. the optimum synthesis of 1 gene of embodiment

EP153R gene chemical synthesis: EP153R gene (NC_001659.2), the EP402R gene that the inquiry website NCBI is included (NC_001659.2) and derived from the CTLA4 gene (NC_010457.5) of pig cell system optimization is obtained by artificial synthesized Gene after (refer to and optimized to nucleotide sequence), sequence such as SEQ ID No.1-3.

CTLA4 sequence Seq ID No.1

GCTAGAGATCTGGTACCGCCACCATGCACGTGGCCCAACCTGCAGTAGTGCTGGCCAACAGCCGGGGTG TTGCCAGCTTTGTGTGTGAGTATGGGTCTGCAGGCAAAGCTGCCGAGGTCCGGGTGACAGTGCTGCGGCGGGCCGGC AGCCAGATGACTGAAGTCTGTGCCGCGACATATACTGTGGAGGATGAGTTGACCTTCCTTGATGACTCTACATGCAC TGGCACCTCCACCGAAAACAAAGTGAACCTCACCATCCAAGGGCTGAGAGCCGTGGACACTGGGCTCTACATCTGCA AGGTGGAGCTCCTGTACCCACCACCCTACTATGTGGGTATGGGCAACGGGACCCAGATTTATGTCATTGATCCAGAA CCATGCCCAGATTCTGATAGTACTGATTACAAAGACGATGACGATAAG

EP153R sequence Seq ID No.2

AAAGACGATGACGATAAGACCGGTTTCAGCAACAAGAAGTACATCGGCCTGATCAACAAGAAGGAGGGC CTGAAGAAGAAGATCGATGACTACAGCATCCTGATCATCGGCATCCTGATCGGCACCAACATCCTGAGCCTGATCAT CAACATCATCGGCGAGATCAATAAGCCTATCTGCTACCAGAATGATGACAAGATCTTCTACTGCCCCAAGGACTGGG TGGGCTACAACAACGTGTGTTACTACTTCGGCAACGAGGAGAAGAACTACAACAATGCCAGCAACTACTGCAAGCAG TTGAACAGCACACTGACAAACAATAACACCATCCTGGTGAACCTGACGAAGACCCTGAACCTGACCAAGACCTACAA CCACGAGAGCAACTACTGGGTGAACTACAGCCTGATCAAGAACGAGAGCGTGCTGCTGCGCGACAGCGGCTACTACA AGAAGCAGAAGCACGTGAGCCTGCTGTACATCTGCAGCAAGGCTAGCGAGCAGAAACTCATCTCTGAA

EP402R sequence Seq ID No.3

AGAAACTCATCTCTGAAGAGGATCTGGTCGACATGATCATCCTGATCTTCCTGATCTTCAGCAACATCG TGCTGTCCATCGACTACTGGGTGAGCTTCAACAAGACCATCATCCTGGACAGCAACATCACCAACGACAACAACGAC ATCAACGGCGTGAGCTGGAACTTCTTCAACAACAGCTTCAACACCCTGGCCACCTGCGGCAAGGCCGGCAACTTCTG CGAGTGCAGCAACTACAGCACCAGCATCTACAACATCACCAACAACTGCAGCCTGACCATCTTCCCCCACAACGACG TGTTCGACACCACCTACCAGGTGGTGTGGAACCAGATCATCAACTACACCATCAAACTGCTGACCCCCGCCACCCCC CCCAACATCACCTACAACTGTACAAACTTCCTGATCACCTGCAAGAAGAACAACGGCACCAACACCAACATCTACCT GAACATCAACGACACCTTCGTGAAGTACACCAACGAGAGCATCCTGGAGTACAACTGGAACAACAGCAACATCAACA ACTTCACCGCCACCTGCATCATCAACAACACCATCTCCACCAGCAACGAGACCACCCTGATCAACTGCACCTACCTG ACCCTGTCCAGCAACTACTTCTACACCTTCTTCAAGCTGTACTACATCCCTCTGTCCATCATCATCGGCATCACCAT CAGCATCCTGCTGATCTCCATCATCACCTTCCTGAGCCTCAGAAAGCGCAAGAAGCACGTGGAGGAGATCGAGTCCC CCCCTCCCGAGAGCAACGAGGAGGAGCAGTGCCAGCACGACGACACAACCTCTATCCACGAGCCCTCCCCTAGGGAG CCTCTGCTGCCTAAGCCCTATAGCAGATATCAGTACAACACCCCCATCTACTACATGAGGCCCAGCACCCAGCCCCT GAACCCTTTCCCTCTGCCCAAGCCCTGCCCACCCCCTAAGCCCTGCCCCCCCCCCAAGCCCTGCCCCCCCCCTAAGC CCTGCCCTTCCGCCGAGAGCTACAGCCCCCCCAAGCCCCTGCCCAGCATCCCCCTGCTGCCCAACATCCCCCCCCTG AGCACCCAGAACATCAGCCTGATCCACGTGGACAGAATCATCCTCGAGTACCCCTACGACGTGCCCGACTACGCCTA AAAGCTTCTAGATAAGATA

Ii. the modification and amplification of 2 segment of embodiment

1) design of primers

2) CTLA4, EP153R, EP402R segment PCR

CTLA4:CTLA4-KpnI-F+CTLA4-R+CTLA4-Flag-R

EP153R:EP153R-Flag-F+EP153R-Myc-R

EP402R:EP402R-Myc-F+EP402R-HA-R+HA-R

CTLA4-EP153R:CTLA4-KpnI-F+EP153R-Myc-R (template CTLA4+EP153R)

That is, amplification CTLA4 gene (PCR product 1) Shi Caiyong CTLA4-KpnI-F+CTLA4-R+CTLA4-Flag-R's draws Object combination, DNA profiling are Seq IDNo.1；Expand EP153R gene (PCR product 4) Shi Caiyong EP153R-Flag-F+ The primer of EP153R-Myc-R combines, and DNA profiling is Seq IDNo.2；Expand EP402R (PCR product 2) Shi Caiyong EP402R- The primer of Myc-F+EP402R-HA-R+HA-R combines, and DNA profiling is Seq IDNo.3.Expand CTLA4-EP153R gene (PCR Product 3) when, it is combined using the primer of CTLA4-KpnI-F+EP153R-Myc-R, and DNA profiling is CTLA4 gene magnification at this time The mixture of product and EP153R gene amplification product.

PCR reaction system such as table 1:

1 PCR reaction system of table

PCR reaction condition such as table 2:

2 PCR reaction condition of table

PCR uses 1% agarose gel electrophoresis to detect digestion purpose band size, blend compounds QIAquick Gel Extraction Kit after reaction Recovery product.

Iii. 3 pShuttle-CMV carrier digestion of embodiment and homologous recombination

1) pShuttle-CMV carrier is subjected to digestion, digestion system such as table 3.

3 digestion system of table

Reaction solution ingredient	Volume
		Plasmid (350ng/ μ L)	20μL
10×Buffer	5μL
		KpnI	2μL
HindIII	2μL
		ddH2O	31μL
It amounts to	50μL

Sample-adding mixes and is placed on 37 DEG C of digestion 6h, detects digestion purpose item with 1% agarose gel electrophoresis after reaction Band size, blend compounds QIAquick Gel Extraction Kit recycle linearization plasmid.

2) carrier and segment homologous recombination:

The reaction system of table 4 carrier and segment homologous recombination

Reaction solution ingredient	Volume
		pShuttle-CMV(90ng/μL)	2μL
CTLA4-EP153(50ng/μL)	1.5μL
		EP402R(65ng/μL)	1μL
5×CE II Buffer	4μL
		Exnase II	2μL
ddH₂O	9.5μL
		It amounts to	20μL

Wherein CTLA4-EP153 is PCR product 3 above-mentioned, and EP402R is PCR product 2 above-mentioned.

37 DEG C of reaction 35min convert DH5 α competent escherichia coli cell, kalamycin resistance LB plate screening, picking Plasmid enzyme restriction identification, positive plasmid sequencing identification (Fig. 1) are extracted in monoclonal PCR identification, positive bacterium colony amplification；

Sequencing primer is 5 ' CGCAAATGGGCGGTAGGCGTG3 ' of Seq ID No.12:CMV-F

5 ' GAAATTTGTGATGCTATTGC3 ' of Seq ID No.13:SV40-R

It is pShuttle-CMV-CTLA4-EP153R-EP402R that correct plasmid, which is sequenced, can be used for subsequent experimental.

Iv. 4 293T cell transient expression of embodiment and its verifying

1) 293T cell transfecting

Cell prepares: by 1 × 10⁶A 293T cell is uniformly layered in every hole of 6 orifice plates, is used after cell is adherent within second day In cell transfecting；

Plasmid prepares: by 2.5 μ g pShuttle-CMV-CTLA4-EP153R-EP402R plasmids and 7.5 μ LLip3000 rouge Plastid is mixed with 500 μ L plasma-free DMEM mediums respectively, stands 4min, and plasmid mixed liquor and Lip3000 mixed liquor are mixed, Stand 10min；

Mixed liquor is added dropwise in culture medium, is gently shaken up, 37 DEG C of cultures.

Collect cell afterwards for 24 hours.

2) WB detects protein expression

Protein extraction: PBS is cleaned 2 times, and 250 μ l cell pyrolysis liquids are added and (press down containing protease inhibitors and phosphoprotein phosphatase Preparation), cell is blown off in digestion, and concussion mixes, and ice bath 25min, 12000rpm are centrifuged 15min, is drawn 200 μ l supernatants and is added 40 μ l 6 × SDS Buffer, boils 5min；

Albumen PAGE gel electrophoresis: 30 μ l protein samples, electrophoresis, transferring film, closing is added in every hole；

The detection of FLAG tag antibody: 4 DEG C of FLAG primary antibody overnight incubations, TBST cleaning, source of mouse secondary antibody are incubated at room temperature 1h, TBST Cleaning, developer solution colour developing；Testing result in 293T cell as shown in Fig. 2, can realize that EP153R and EP402R gene are total to table It reaches.

V. 5 pAD-Shuttle-CMV-CTLA4-EP153R-EP402R adenovirus vector of embodiment recombinates

1) pShuttle-CMV-CTLA4-EP153R-EP402R plasmid PmeI linearization for enzyme restriction (Fig. 3), gel recycling；

2) linearized vector is transformed into BJ5183 Escherichia coli, blocks the screening of that resistant panel, bacterium colony PCR identification, positive bacteria Amplification is fallen, plasmid is extracted.

3) PacI digestion verification, and endonuclease bamhi is recycled using ethanol precipitation, for transfecting cell packaging adenovirus.

Vi. 6 adenovirus of embodiment is packed

1) 293A plating cells: by 2 × 10⁵A 293T cell is uniformly spread with 12 orifice plates, and convergence degree reaches 30% and is used for Transfection；

2) plasmid prepare: by 1.5 μ g linearization plasmids and 4 μ L Lip3000 liposomes respectively with 250 μ L serum-free DMEM Culture medium mixes, and stands 4min, and plasmid mixed liquor and Lip3000 mixed liquor are mixed, and stands 10min；Mixed liquor is added dropwise Enter into culture medium, gently shakes up, 37 DEG C of cultures.

3) 48h observes luciferase expression, and cell has more death after 5d, pays attention to fluid infusion, collects cell and supernatant, -80 DEG C of jellies Melt 2 times, concussion release adenovirus, centrifugation goes to precipitate；

4) adenovirus supernatant and 10% culture medium 1:1 are mixed, is inoculated in 6cm dish disk, observe cell state, to Poison is received after the most of death of cell；

5) superinfection is inoculated in T75 culture bottle, is inoculated in T175 culture bottle, receives poison；

6) adenovirus is concentrated and purified.

Vii. 7 gland virus expression of embodiment is verified

1) cell prepares: by 5 × 10⁵A 293A and ST (porcine kidney cell) is uniformly layered in 12 orifice plates, and convergence degree reaches 80% for transfecting；

2) taking the unpurified viral supernatants infection of 100 μ L, infection cell, 48h observe fluorescence respectively；

3) WB label protein detects, and testing result is as shown in Figure 4, it is known that being packaged into adenovirus postoperative infection cell can realize EP153R and EP402R gene co-expressing.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Yangzhou University

<120>a kind of EP153R and the building of EP402R gene co-expressing recombinant adenoviral vector and adenovirus packing method

<130> xhx2018120704

<141> 2018-12-07

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 425

<212> DNA

<213> African swine fever virus

<400> 1

gctagagatc tggtaccgcc accatgcacg tggcccaacc tgcagtagtg ctggccaaca 60

gccggggtgt tgccagcttt gtgtgtgagt atgggtctgc aggcaaagct gccgaggtcc 120

gggtgacagt gctgcggcgg gccggcagcc agatgactga agtctgtgcc gcgacatata 180

ctgtggagga tgagttgacc ttccttgatg actctacatg cactggcacc tccaccgaaa 240

acaaagtgaa cctcaccatc caagggctga gagccgtgga cactgggctc tacatctgca 300

aggtggagct cctgtaccca ccaccctact atgtgggtat gggcaacggg acccagattt 360

atgtcattga tccagaacca tgcccagatt ctgatagtac tgattacaaa gacgatgacg 420

ataag 425

<210> 2

<211> 522

<212> DNA

<213> African swine fever virus

<400> 2

aaagacgatg acgataagac cggtttcagc aacaagaagt acatcggcct gatcaacaag 60

aaggagggcc tgaagaagaa gatcgatgac tacagcatcc tgatcatcgg catcctgatc 120

ggcaccaaca tcctgagcct gatcatcaac atcatcggcg agatcaataa gcctatctgc 180

taccagaatg atgacaagat cttctactgc cccaaggact gggtgggcta caacaacgtg 240

tgttactact tcggcaacga ggagaagaac tacaacaatg ccagcaacta ctgcaagcag 300

ttgaacagca cactgacaaa caataacacc atcctggtga acctgacgaa gaccctgaac 360

ctgaccaaga cctacaacca cgagagcaac tactgggtga actacagcct gatcaagaac 420

gagagcgtgc tgctgcgcga cagcggctac tacaagaagc agaagcacgt gagcctgctg 480

tacatctgca gcaaggctag cgagcagaaa ctcatctctg aa 522

<210> 3

<211> 1166

<212> DNA

<213> African swine fever virus

<400> 3

agaaactcat ctctgaagag gatctggtcg acatgatcat cctgatcttc ctgatcttca 60

gcaacatcgt gctgtccatc gactactggg tgagcttcaa caagaccatc atcctggaca 120

gcaacatcac caacgacaac aacgacatca acggcgtgag ctggaacttc ttcaacaaca 180

gcttcaacac cctggccacc tgcggcaagg ccggcaactt ctgcgagtgc agcaactaca 240

gcaccagcat ctacaacatc accaacaact gcagcctgac catcttcccc cacaacgacg 300

tgttcgacac cacctaccag gtggtgtgga accagatcat caactacacc atcaaactgc 360

tgacccccgc cacccccccc aacatcacct acaactgtac aaacttcctg atcacctgca 420

agaagaacaa cggcaccaac accaacatct acctgaacat caacgacacc ttcgtgaagt 480

acaccaacga gagcatcctg gagtacaact ggaacaacag caacatcaac aacttcaccg 540

ccacctgcat catcaacaac accatctcca ccagcaacga gaccaccctg atcaactgca 600

cctacctgac cctgtccagc aactacttct acaccttctt caagctgtac tacatccctc 660

tgtccatcat catcggcatc accatcagca tcctgctgat ctccatcatc accttcctga 720

gcctcagaaa gcgcaagaag cacgtggagg agatcgagtc cccccctccc gagagcaacg 780

aggaggagca gtgccagcac gacgacacaa cctctatcca cgagccctcc cctagggagc 840

ctctgctgcc taagccctat agcagatatc agtacaacac ccccatctac tacatgaggc 900

ccagcaccca gcccctgaac cctttccctc tgcccaagcc ctgcccaccc cctaagccct 960

gccccccccc caagccctgc ccccccccta agccctgccc ttccgccgag agctacagcc 1020

cccccaagcc cctgcccagc atccccctgc tgcccaacat cccccccctg agcacccaga 1080

acatcagcct gatccacgtg gacagaatca tcctcgagta cccctacgac gtgcccgact 1140

acgcctaaaa gcttctagat aagata 1166

<210> 4

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gctagagatc tggtaccgcc accatgcacg tggcccaacc t 41

<210> 5

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atcagaatct gggcatggtt ctggatcaat gacataaatc tggg 44

<210> 6

<211> 48

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

cttatcgtca tcgtctttgt aatcagtact atcagaatct gggcatgg 48

<210> 7

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aaagacgatg acgataagac cggtttcagc aacaagaagt aca 43

<210> 8

<211> 45

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

ttcagagatg agtttctgct cgctagcctt gctgcagatg tacag 45

<210> 9

<211> 51

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

agaaactcat ctctgaagag gatctggtcg acatgatcat cctgatcttc c 51

<210> 10

<211> 38

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

acgtcgtagg ggtactcgag gatgattctg tccacgtg 38

<210> 11

<211> 51

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

tatcttatct agaagctttt aggcgtagtc gggcacgtcg taggggtact c 51

<210> 12

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

cgcaaatggg cggtaggcgt g 21

<210> 13

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gaaatttgtg atgctattgc 20

Claims

1. a kind of African swine fever virus EP153R and EP402R gene co-expressing recombinant adenoviral vector, which is characterized in that with Based on pShuttle-CMV carrier for expression of eukaryon, CTLA4, EP153R, EP402R gene are introduced at multiple cloning sites with structure Build recombinant adenoviral vector pAD-Shuttle-CMV-CTLA4-EP153R-EP402R；The CTLA4 gene, EP153R gene, EP402R gene is respectively provided with the nucleotide as shown in Seq ID No.1 in sequence table, Seq ID No.2, Seq ID No.3 Sequence.

2. African swine fever virus EP153R according to claim 1 and EP402R gene co-expressing recombinant adenoviral vector, It is characterized in that, the multiple cloning sites are the restriction enzyme site of KpnI and HindIII.

3. the construction method of a kind of African swine fever virus EP153R and EP402R gene co-expressing recombinant adenoviral vector, including with Lower step:

1) it is directed to EP153R gene, EP402R gene, by artificial synthesized, after obtaining optimization genetic fragment, and is existed respectively Corresponding restriction enzyme site and homologous region are added in EP153R gene, EP402R gene order both ends；The addition of CTLA4 gene order both ends Corresponding restriction enzyme site and homologous region；

3) the linearisation pShuttle-CMV carrier for obtaining the step 2 carries out homologous heavy with CTLA4-EP153R, EP402R Group is obtained pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid, is surveyed using CMV-F and SV40-R Sequence；

4) the pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid for obtaining the step 3) carries out instantaneous Expression, label protein verify protein expression；

5) the pShuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid for obtaining the step 3) carries out PmeI Digestion is transformed into BJ5183 Escherichia coli and is recombinated, and obtains coexpression adenovirus vector pAD-Shuttle-CMV-CTLA4- EP153R-EP402R。

4. a kind of recombined adhenovirus packing method, which is characterized in that by pAD-Shuttle-CMV- described in claim 1 CTLA4-EP153R-EP402R co-expresses adenovirus vector and carries out single endonuclease digestion with PacI, and the plasmid after linearisation is for transfecting；Turn 293A cell is contaminated, realizes recombined adhenovirus packaging.

5. a kind of recombined adhenovirus packing method according to claim 4, which is characterized in that be prepared by the following steps It arrives:

1) pAD-Shuttle-CMV-CTLA4-EP153R-EP402R eukaryon expression plasmid is subjected to single endonuclease digestion with PacI, linearly Plasmid after change is for transfecting；293A cell is transfected using Lip3000 transfection reagent；

3) P1 observes cell state for adenovirus infection 293A cell.

6. the recombined adhenovirus that recombined adhenovirus packing method described in claim 4 or 5 is prepared.

7. including the vaccine of recombined adhenovirus as claimed in claim 6.