CN112592937A

CN112592937A - D117L, F317L and EP364R co-expression recombinant adenovirus vector, recombinant adenovirus and construction and application

Info

Publication number: CN112592937A
Application number: CN202011589615.4A
Authority: CN
Inventors: 张泉; 朱立麒; 殷俊
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2020-12-29
Filing date: 2020-12-29
Publication date: 2021-04-02

Abstract

The invention provides a D117L, F317L and EP364R co-expression recombinant adenovirus vector, a recombinant adenovirus and construction and application thereof, and belongs to the technical field of genetic engineering, wherein the gene is inserted into a pShuttle-CMV eukaryotic expression vector and can be used for constructing the recombinant adenovirus for expressing African swine fever virus D117L, F317L and EP364R proteins, and the recombinant adenovirus can directly infect eukaryotic cells, so that the aim of co-expression of D117L, F317L and EP364R genes in the eukaryotic cells is fulfilled, and a foundation is laid for further research of a recombinant adenovirus vector vaccine based on co-expression of D117L, F317L and EP364R genes.

Description

D117L, F317L and EP364R co-expression recombinant adenovirus vector, recombinant adenovirus and construction and application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a D117L, F317L and EP364R co-expression recombinant adenovirus vector, a recombinant adenovirus and construction and application thereof.

Background

African Swine Fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African Swine Fever Virus (ASFV), characterized by short course of disease, high mortality, clinical symptoms and pathological changes similar to acute Swine fever, high fever, cutaneous congestion, abortion, edema and organ hemorrhage. p17 is a late membrane protein expressed by ASFV, encoded by ORF D117L gene, and is a transmembrane protein located in the inner membrane of the virus. p17 is an essential intermediate in the formation of icosahedron from the virus precursor membrane and is critical for virus viability. The protein encoded by the two genes F317L and EP364R has high content in ASFV, and belongs to the medium upper part. However, there are no recombinant adenovirus vaccines against D117L, F317L and EP364R and no recombinant adenovirus vectors for preparing the recombinant adenovirus vaccines.

Disclosure of Invention

The invention aims to provide a D117L, F317L and EP364R co-expression recombinant adenovirus vector, a recombinant adenovirus, and construction and application thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a gene co-expressed by D117L, F317L and EP364R, wherein the gene is obtained by sequentially connecting an EGFP gene, a first connecting gene, a D117L gene, a second connecting gene, an F317L gene, a second connecting gene and an EP364R gene in series; the nucleotide sequence of the D117L gene is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the F317L gene is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the EP364R gene is shown as SEQ ID NO: 3 is shown in the specification; the nucleotide sequence of the first connecting gene is shown as SEQ ID NO: 11 is shown in the figure; the nucleotide sequence of the second connecting gene is shown as SEQ ID NO: shown at 12.

The invention also provides a recombinant vector containing the gene in the scheme, wherein the recombinant vector takes a pShuttle-CMV vector as an original vector; the insertion site of the gene is between KpnI and HindIII.

The invention also provides a recombinant adenovirus vector, which is inserted into the recombinant vector of the scheme, and the insertion site is between the first site and the second site of the PmeI enzyme cutting site sequence; the nucleotide sequence of the first site is shown as SEQ ID NO: 13 is shown in the figure; the nucleotide sequence of the second site is shown as SEQ ID NO: as shown at 14.

The invention also provides a construction method of the recombinant adenovirus vector in the scheme, which comprises the following steps:

and (3) carrying out enzyme digestion on the recombinant vector in the scheme by using a restriction enzyme PmeI to obtain a linearized plasmid, transforming the linearized plasmid into escherichia coli containing a pAdEasy-1 plasmid, and recombining to obtain the recombinant adenovirus vector.

The invention also provides a recombinant adenovirus containing the recombinant adenovirus vector in the scheme or the recombinant adenovirus vector obtained by the construction method.

The invention also provides a construction method of the recombinant adenovirus in the scheme, which comprises the following steps: and carrying out enzyme digestion linearization on the recombinant adenovirus vector through PacI to obtain a linearized plasmid, and transfecting HEK293A cells with the linearized plasmid to culture to obtain the recombinant adenovirus.

The invention also provides application of the recombinant adenovirus obtained by the scheme or the construction method in preparation of African swine fever vaccines.

The invention also provides an African swine fever vaccine which comprises an immunologic adjuvant and an immunogen and is characterized in that the immunogen is the recombinant adenovirus obtained by the scheme or the construction method.

The invention provides a gene coexpressed by D117L, F317L and EP364R, wherein the gene is inserted into a pShuttle-CMV eukaryotic expression vector and can be used for constructing recombinant adenovirus for expressing proteins of African swine fever virus D117L, F317L and EP364R, the recombinant adenovirus can directly infect eukaryotic cells, so that the aim of coexpression of the genes of D117L, F317L and EP364R in the eukaryotic cells is fulfilled, and a foundation is laid for further researching a recombinant adenovirus vector vaccine based on the genes of coexpression D117L, F317L and EP 364R.

Drawings

FIG. 1 is a map of a recombinant plasmid of the present invention;

FIG. 2 is a map of a recombinant adenovirus vector of the present invention;

FIG. 3 is a PacI single-enzyme digestion linearization diagram and a BamHI single-enzyme digestion linearization diagram of a recombinant adenovirus vector pAD-Shuttle-CMV-EGFP-P2A-D117L-F317L-EP364R-HA, 1% agarose gel electrophoresis detection is performed, and the PacI single-enzyme digestion linearization diagram electrophoresis shows two bands, one band is 4.5kb and the other band is about 34 kb; the BamHI enzyme digestion linearized map electrophoresis shows two bands, one is 27kb and the other is about 11.7 kb;

FIG. 4 is a graph showing the WB validation of HA tag protein 48h after ADV infection of 293A cells;

FIG. 5 is a graph of CPE of 72h cells of ADV infected 293A cells;

FIG. 6 is a 48h fluorescence expression profile of ADV infected 293A cells.

Detailed Description

The invention provides a gene co-expressed by D117L, F317L and EP364R, wherein the gene is obtained by sequentially connecting an EGFP gene, a first connecting gene, a D117L gene, a second connecting gene, an F317L gene, a second connecting gene and an EP364R gene in series; the nucleotide sequence of the D117L gene is shown as SEQ ID NO: 1, specifically: atggacactgaaacgtctccactgctttctcataacctgtcaacccgcgagggaattaaacaaagcacccaaggccttttagcccatacaatcgccaaatatcccggaacaactgcgattctcctgggcattttgattttgctcattattattcttatcatcgttgccatcgtttactataaccggactattgactgcaagtcgagcatacctaaacctcctcctagctactatgtacaacaacctgagcctcaccaccatttcccggtattctttagaaaaaggaaaaactccacctccctgcagtcccacattccaagcgacgaacaattagctgaacttgcgcattcataa, respectively; the nucleotide sequence of the F317L gene is shown as SEQ ID NO: 2, specifically: atggttgagacacaaatggacaaacttggttttctgctaaatcacataggtaaacaggttaccactaaggtgcttagcaatgcccatataactcaaacgatgaaggagattattttggaaaatcatagtgtagatggtggagccgcaaaaaatgtttcaaaagggaagtcttccccaaaagaaaaaaaacattggactgagttcgaatcctgggaacagctcagcaagtctaaaagaagttttaaggaatactgggcggagcgtaatgagattgtgaatactctgttgcttaactgggacaatgttcggggtgccatcaaaaaatttttggacgatgaccgtgaatggtgcggccgcattaatatgataaacggtgtacccgagatagtggaaatcattccaagcccctatagggcaggagagaacatttattttggcagcgaggctatgatgcctgctgatatttatagcagggtggccaacaagcctgctatgtttgtgtttcacacgcatcctaatttgggttcatgttgtggaggaatgccttccatatgtgacatttctacaacgctgcgttatctactcatggggtggactgctgggcatctaatcatttcttcgaatcaagtaggaatgctcacggttgataagagaattattgttgatttgtgggccaatgagaatccgcgctggcttatggcgcaaaaaatattagatatttttatgatgctcacttcgcgtagaagcctggtaaatccctggaccctgagagacctaaaaaaaatattacaagactatggtattgagtatatcatttttccttcgaatgacttttttatttatgaagacgaacgtcttttaatgttttcaaaaaaatggaccaacttttttacgttacatgagttattggatgacctcgaaactattgagacaaaggcatcgtccacaacatag, respectively; the nucleotide sequence of the EP364R gene is shown as SEQ ID NO: 3, specifically: atgtattttctagtagcagatcatcgagaacatcatgtgattccttttcttaaaaccgatttccatcacatgcatcaaaatcctatacaaaaaaatcaagctctcctagaaatcaaacagctttttactggagattatctcatctgcaaaagcccttctaccattctggcctgtattgaacgaaaaacctacaaagactttgcggcttctttgaaagatggacgttataaaaatcgccaaaaaatgctgtcgctgcgagaacaaaccaactgtcaactttatttttttgtagaaggcccggcatttcctaaccctcaaaaaaaaattaatcacgttgcctatgcaagcattattactgctatgacgcatcttatggttagagatcatatttttgtcattcaaacgaaaaatgaggcccacagttcccaaaagcttgtgcagcttttttatgccttttctaaggaaatggtgtgcgtcgttcccacctccctcacccccacggatgaagagctatgcatcaagctatggtcttctctttctggtatttcaggcgtgataggtaaaatcttggcaaacacttgttccgtagctcatttggttcatggaaagctttcatcgcagaatattgatcagttaaaaactccctccaaccgaccattccccaaaaaagtaaaacgtatgcttataagcattagcaaaggaaataaggagttagaaataaaattgctctcgggggttcccaatatcgggaaaaaattagctgccgaaattttaaaagatcatgcgcttcttttttttctaaatcagcccgtagaatgcttggcaaatatacaaatcgttcaaaaaacccgtacgattaagttgggaatgaagcgagccgaagcgattcattattttttaaactggtgtggctctgcccatgtaaccgatgatagccaaaatatcacagaggcgtcgcggtccacaatgcaggtcgcgacgcagtccgccgcaatacagcccgctgcaacgcagccattgcacgaagtatcagatgatgcatcatcagatgcttcatcacccgtagggtatcaaacattatctaaagaaatgttattgaacacagcctga, respectively; the nucleotide sequence of the first connecting gene is shown as SEQ ID NO: shown at 11, specifically AGTACTGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGGTCGAC; the nucleotide sequence of the second connecting gene is shown as SEQ ID NO: 12, specifically: GGCGCCCCC are provided.

In the present invention, the D117L gene, the F317L gene and the EP364R gene are obtained by artificial synthesis, and the method of artificial synthesis is not particularly limited in the present invention, and a method conventional in the art may be used.

The invention also provides a recombinant vector containing the gene in the scheme, wherein the recombinant vector takes a pShuttle-CMV vector as an original vector; the insertion site of the gene is between KpnI and HindIII. FIG. 1 is a map of a recombinant plasmid of the present invention.

In the present invention, the method for constructing the recombinant vector preferably comprises the steps of:

artificially synthesizing the gene, and carrying out homologous recombination on the gene and a linearized plasmid of the pShuttle-CMV vector to obtain a recombinant vector. The method of homologous recombination in the present invention is not particularly limited, and may be performed by a method conventional in the art.

The invention also provides a recombinant adenovirus vector, which is inserted into the recombinant vector of the scheme, and the insertion site is between the first site and the second site of the PmeI enzyme cutting site sequence; the nucleotide sequence of the first site is shown as SEQ ID NO: 13, specifically: GGTTT; the nucleotide sequence of the second site is shown as SEQ ID NO: 14, specifically: AAACC. FIG. 2 is a map of a recombinant adenovirus vector of the present invention.

carrying out enzyme digestion on the recombinant vector in the scheme by using restriction enzyme PmeI to obtain a linearized plasmid, transforming the linearized plasmid into escherichia coli containing a pAdEasy-1 plasmid, and recombining to obtain a recombinant adenovirus vector; the Escherichia coli includes BJ5183 Escherichia coli.

The invention also provides application of the recombinant adenovirus in the scheme in preparation of an African swine fever vaccine.

The invention also provides an African swine fever vaccine which comprises the recombinant adenovirus in the scheme.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the following examples, the experimental procedures without specifying the specific conditions were generally carried out by the methods described in "molecular biology laboratory Manual of Fine text" (edited by F.M. Osber, R.E. Kingston, J.G. Sedman, et al, Mashimi, Shujiong, Beijing: scientific Press, 2004).

Example 1

1) The optimized and connected gene fragment is obtained by artificially synthesizing a D117L gene (GI:41902877), an F317L gene (GI:41902813) and an EP364R gene (G:41902829) which are recorded in an NCBI website.

1. Modification and amplification of fragments

1) Primer design

2) PCR of EGFP, EGFP-P2A-D117L-F317L-EP316R-HA fragment

EGFP：EGFP-F(KpnI)+EGFP-R(+P2A)

D117L-F317L-EP 316R: 117-317-364-F +117-317-364-R (the template is PUC57-117-317-364)

EGFP-P2A-D117L-F317L-EP316R-HA：EGFP-F(KpnI)+HA-R(HindIII)

The PCR reaction system is as follows:

the PCR reaction conditions were as follows:

after the PCR reaction is finished, detecting the size of a band of a target enzyme digestion by using 1% agarose gel electrophoresis, and recovering a product by using a gel recovery kit.

Restriction enzyme digestion and homologous recombination of pShuttle-CMV vector

1) The pShuttle-CMV vector was digested in the following manner

Components of reaction solution	Volume of
		Plasmid (350 ng/. mu.L)	20μL
10×Buffer	5μL
		KpnI	2μL
HindIII	2μL
		ddH₂O	31μL
Total of	50μL

Adding the sample, uniformly mixing, placing at 37 ℃ for enzyme digestion for 6h, detecting the size of a band of the enzyme digestion target by using 1% agarose gel electrophoresis after the reaction is finished, and recovering the linearized plasmid by using a gel recovery kit.

2) Homologous recombination of vector and fragment:

reacting at 37 ℃ for 35min, transforming DH5 alpha escherichia coli competent cells, screening kanamycin-resistant LB plates, selecting monoclonal PCR identification, amplifying and extracting plasmid enzyme digestion identification by positive colony amplification, and sequencing and identifying positive plasmids;

the sequencing primer is SEQ ID NO. 9: CMV-F CGCAAATGGGCGGTAGGCGTG;

SEQ ID NO.10：SV40-R GAAATTTGTGATGCTATTGC。

the plasmid with the correct sequencing is pShuttle-CMV-EGFP-P2A-D117L-F317L-EP316R-HA, and can be used for subsequent experiments.

3.293T cell transient expression and validation thereof

1) Transfection of 293T cells

Cell preparation: will be 1 × 10⁶293T cells are uniformly paved in each hole of a 6-hole plate, and used for cell transfection after the cells adhere to the wall on the next day;

plasmid preparation: respectively mixing 2.5 μ g plasmid and 7.5 μ L Lipofectamine 3000 liposome with 500 μ L serum-free DMEM medium, standing for 4min, mixing the plasmid mixed solution and Lipofectamine 3000 mixed solution, and standing for 10 min;

the mixture was added dropwise to the medium, shaken gently and cultured at 37 ℃.

Cells were harvested after 24 h.

2) WB detection of protein expression

Protein extraction: washing with PBS for 2 times, adding 250 μ l cell lysate (containing protease inhibitor and protein phosphatase inhibitor), digesting and blowing off cells, shaking and mixing, ice-cooling for 25min, centrifuging at 12000rpm for 15min, sucking 60 μ l supernatant, adding 20 μ l 4 xSDS Buffer, and boiling for 5 min;

protein PAGE gel electrophoresis: adding 10 mul of protein sample into each hole, performing electrophoresis, transferring a membrane, and sealing;

detection of HA-tagged antibody: incubating HA primary antibody at 4 ℃ overnight, washing with TBST, incubating rabbit source secondary antibody at room temperature for 1h, washing with TBST, and developing with a developing solution.

pAD-Shuttle-CMV-EGFP-P2A-D117L-F317L-EP316R-HA adenovirus vector recombination

1) Carrying out enzyme digestion linearization on plasmid PmeI of pShuttle-CMV-EGFP-P2A-D117L-F317L-EP316R-HA, and recovering gel;

2) the linearized vector is transformed into BJ5183 escherichia coli containing pAdEasy-1 plasmid, screening on a kana resistance plate, identifying colony PCR, amplifying positive colonies, and extracting plasmid.

3) PacI enzyme digestion verification is carried out, and an enzyme digestion fragment is recovered by using ethanol precipitation and is used for transfecting cells to package adenovirus. The results of the identification are shown in FIG. 3. As can be seen from FIG. 3, the 1kb DNA ladder with TaKaRa as M, and the electrophoresis results of the products cleaved with PacI and BamHI in

lanes

1 and 2, respectively. As can be seen in FIG. 3, the PacI cleavage yielded about 4.5kb and a larger band, presumably about 34 kb; digestion with BamHI gave two bands which were relatively close, 1 of which was approximately 11.7kb above 10kb, and the other band was slightly larger, presumably 27kb in size. Thus, the recombinant adenovirus plasmid is correctly constructed.

5. Adenovirus packaging

1) Plating 293A cells: 2 x 10 to⁵Uniformly spreading 293A cells in a 12-well plate, and using the cell with the confluence degree reaching 30% for transfection;

2) plasmid preparation: respectively mixing 1.5 μ g linearized plasmid and 4 μ L Lipofectamine 3000 liposome with 250 μ L serum-free DMEM medium, standing for 4min, mixing the plasmid mixed solution and Lipofectamine 3000 mixed solution, and standing for 10 min; the mixture was added dropwise to the medium, shaken gently and cultured at 37 ℃.

3) Observing the cell state for 48h, after 5d, leading the cells to die, paying attention to fluid infusion, collecting the cells and the supernatant, freezing and thawing for 2 times at minus 80 ℃, shaking to release adenovirus, and centrifuging to remove precipitate;

4) mixing the adenovirus supernatant with 10% culture medium 1:1, inoculating in 6cm dish, observing cell state, and collecting virus after most of cells die;

5) repeatedly infecting, inoculating in T75 flask, inoculating in T175 flask, and collecting toxin;

6) concentrating and purifying the adenovirus.

6. Verification of adenovirus expression

1) Cell preparation: will be 5X 10⁵HEK293A were spread evenly in 12-well plates with 80% confluency for transfection;

2) HEK293A cells were infected with 100. mu.L of unpurified virus supernatant, and Cytopathic (CPE) status was observed at 72h and expression status of green fluorescent protein was observed at 48h, as shown in FIGS. 5 and 6. The HEK293A cells inoculated with the unpurified adenovirus supernatant were visibly rounded and shed (FIG. 5) by observation with a common light microscope; while a clear green fluorescence expression was visible by fluorescence microscopy (fig. 6).

3) And (3) detecting WB tag protein. HA antibody, GFP antibody and GAPDH antibody were mixed at an optimum ratio and used for Western-Blot detection, and the results are shown in FIG. 4. M is protein Marker (Thermo Fisher #26616), lane 1 is total adenovirus-infected cell protein, and lane 2 is total control cell protein. A band of about 29kD is seen in lane 1, which is a GFP-P2A tagged protein; the multiple bands of 100kD are EGFP-P2A-D117L-F317L-EP364R-HA, D117L-F317L-EP364R-HA fusion protein and possible post-translational modification bands; while no band at the above position was detected in lane 2, a band similar to that in lane 1 was detected only in the vicinity of 35kD, which is the GAPDH reference.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Yangzhou university

<120> D117L, F317L and EP364R co-expression recombinant adenovirus vector, recombinant adenovirus and construction and application

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 354

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggacactg aaacgtctcc actgctttct cataacctgt caacccgcga gggaattaaa 60

caaagcaccc aaggcctttt agcccataca atcgccaaat atcccggaac aactgcgatt 120

ctcctgggca ttttgatttt gctcattatt attcttatca tcgttgccat cgtttactat 180

aaccggacta ttgactgcaa gtcgagcata cctaaacctc ctcctagcta ctatgtacaa 240

caacctgagc ctcaccacca tttcccggta ttctttagaa aaaggaaaaa ctccacctcc 300

ctgcagtccc acattccaag cgacgaacaa ttagctgaac ttgcgcattc ataa 354

<210> 2

<211> 954

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggttgaga cacaaatgga caaacttggt tttctgctaa atcacatagg taaacaggtt 60

accactaagg tgcttagcaa tgcccatata actcaaacga tgaaggagat tattttggaa 120

aatcatagtg tagatggtgg agccgcaaaa aatgtttcaa aagggaagtc ttccccaaaa 180

gaaaaaaaac attggactga gttcgaatcc tgggaacagc tcagcaagtc taaaagaagt 240

tttaaggaat actgggcgga gcgtaatgag attgtgaata ctctgttgct taactgggac 300

aatgttcggg gtgccatcaa aaaatttttg gacgatgacc gtgaatggtg cggccgcatt 360

aatatgataa acggtgtacc cgagatagtg gaaatcattc caagccccta tagggcagga 420

gagaacattt attttggcag cgaggctatg atgcctgctg atatttatag cagggtggcc 480

aacaagcctg ctatgtttgt gtttcacacg catcctaatt tgggttcatg ttgtggagga 540

atgccttcca tatgtgacat ttctacaacg ctgcgttatc tactcatggg gtggactgct 600

gggcatctaa tcatttcttc gaatcaagta ggaatgctca cggttgataa gagaattatt 660

gttgatttgt gggccaatga gaatccgcgc tggcttatgg cgcaaaaaat attagatatt 720

tttatgatgc tcacttcgcg tagaagcctg gtaaatccct ggaccctgag agacctaaaa 780

aaaatattac aagactatgg tattgagtat atcatttttc cttcgaatga cttttttatt 840

tatgaagacg aacgtctttt aatgttttca aaaaaatgga ccaacttttt tacgttacat 900

gagttattgg atgacctcga aactattgag acaaaggcat cgtccacaac atag 954

<210> 3

<211> 1110

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtattttc tagtagcaga tcatcgagaa catcatgtga ttccttttct taaaaccgat 60

ttccatcaca tgcatcaaaa tcctatacaa aaaaatcaag ctctcctaga aatcaaacag 120

ctttttactg gagattatct catctgcaaa agcccttcta ccattctggc ctgtattgaa 180

cgaaaaacct acaaagactt tgcggcttct ttgaaagatg gacgttataa aaatcgccaa 240

aaaatgctgt cgctgcgaga acaaaccaac tgtcaacttt atttttttgt agaaggcccg 300

gcatttccta accctcaaaa aaaaattaat cacgttgcct atgcaagcat tattactgct 360

atgacgcatc ttatggttag agatcatatt tttgtcattc aaacgaaaaa tgaggcccac 420

agttcccaaa agcttgtgca gcttttttat gccttttcta aggaaatggt gtgcgtcgtt 480

cccacctccc tcacccccac ggatgaagag ctatgcatca agctatggtc ttctctttct 540

ggtatttcag gcgtgatagg taaaatcttg gcaaacactt gttccgtagc tcatttggtt 600

catggaaagc tttcatcgca gaatattgat cagttaaaaa ctccctccaa ccgaccattc 660

cccaaaaaag taaaacgtat gcttataagc attagcaaag gaaataagga gttagaaata 720

aaattgctct cgggggttcc caatatcggg aaaaaattag ctgccgaaat tttaaaagat 780

catgcgcttc ttttttttct aaatcagccc gtagaatgct tggcaaatat acaaatcgtt 840

caaaaaaccc gtacgattaa gttgggaatg aagcgagccg aagcgattca ttatttttta 900

aactggtgtg gctctgccca tgtaaccgat gatagccaaa atatcacaga ggcgtcgcgg 960

tccacaatgc aggtcgcgac gcagtccgcc gcaatacagc ccgctgcaac gcagccattg 1020

cacgaagtat cagatgatgc atcatcagat gcttcatcac ccgtagggta tcaaacatta 1080

tctaaagaaa tgttattgaa cacagcctga 1110

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctagagatc tggtaccgcc accatggtga gcaagggcg 39

<210> 5

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tatcttatct agaagctttt aggcgtagtc gggcacgtcg taggggtact c 51

<210> 6

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atcctggacc ggtcgacgac accgagacca gccccct 37

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcgtaggggt actcgagggc ggtgttcagc agcatct 37

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggacgagc tgtacaagag tactgcaaca aacttc 36

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgcaaatggg cggtaggcgt g 21

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaaatttgtg atgctattgc 20

<210> 11

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agtactgcaa caaacttctc tctgctgaaa caagccggag atgtcgaaga gaatcctgga 60

ccggtcgac 69

<210> 12

<211> 9

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggcgccccc 9

<210> 13

<211> 5

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggttt 5

<210> 14

<211> 5

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaacc 5

Claims

1. A gene coexpressed by D117L, F317L and EP364R, wherein the gene is obtained by connecting an EGFP gene, a first connecting gene, a D117L gene, a second connecting gene, an F317L gene, a second connecting gene and an EP364R gene in series in sequence; the nucleotide sequence of the D117L gene is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the F317L gene is shown as SEQ ID NO: 2 is shown in the specification; the nucleotide sequence of the EP364R gene is shown as SEQ ID NO: 3 is shown in the specification; the nucleotide sequence of the first connecting gene is shown as SEQ ID NO: 11 is shown in the figure; the nucleotide sequence of the second connecting gene is shown as SEQ ID NO: shown at 12.

2. A recombinant vector containing the gene of claim 1, wherein the recombinant vector uses a pShuttle-CMV vector as an original vector; the insertion site of the gene is between KpnI and HindIII.

3. A recombinant adenovirus vector inserted with the recombinant vector of claim 2 at a position between the first site and the second site of the PmeI cleavage site sequence; the nucleotide sequence of the first site is shown as SEQ ID NO: 13 is shown in the figure; the nucleotide sequence of the second site is shown as SEQ ID NO: as shown at 14.

4. The method for constructing a recombinant adenovirus vector according to claim 3, comprising the steps of:

the recombinant vector of claim 2 is subjected to enzyme digestion by using a restriction enzyme PmeI to obtain a linearized plasmid, and the linearized plasmid is transformed into Escherichia coli containing a pAdEasy-1 plasmid, and is recombined to obtain the recombinant adenovirus vector.

5. A recombinant adenovirus comprising the recombinant adenovirus vector according to claim 3 or the recombinant adenovirus vector obtained by the construction method according to claim 4.

6. The method for constructing a recombinant adenovirus according to claim 5, comprising the steps of: and carrying out enzyme digestion linearization on the recombinant adenovirus vector through PacI to obtain a linearized plasmid, and transfecting HEK293A cells with the linearized plasmid to culture to obtain the recombinant adenovirus.

7. Use of the recombinant adenovirus according to claim 5 or the recombinant adenovirus obtained by the construction method according to claim 6 in the preparation of African swine fever vaccine.

8. An African swine fever vaccine, comprising an immunological adjuvant and an immunogen, wherein the immunogen is the recombinant adenovirus of claim 5 or the recombinant adenovirus obtained by the construction method of claim 6.