CN113308493A

CN113308493A - Novel coronavirus Ad26 adenovirus vector vaccine and preparation method and application thereof

Info

Publication number: CN113308493A
Application number: CN202110290489.0A
Authority: CN
Inventors: 陈凌; 杨臣臣; 关素华; 汪乾
Original assignee: Guangzhou Enbao Biomedical Technology Co ltd
Current assignee: Guangzhou Enbao Biomedical Technology Co ltd
Priority date: 2021-03-18
Filing date: 2021-03-18
Publication date: 2021-08-27
Also published as: WO2022193552A1

Abstract

The invention discloses a novel coronavirus Ad26 adenovirus vector vaccine, a preparation method and application thereof, wherein the vector contains a sequence shown in SEQ ID NO. 1. The invention is based on the replication-defective Ad26 vector, can avoid the neutralization of the vector by pre-stored antibodies in human bodies, and has higher immune effect than the conventional Ad5 vector vaccine; moreover, Ad26 has higher replication capacity than Ad5, so that more vectors can be obtained in the same time, and the vaccine preparation cost is lower. And the immunogenicity of the vaccine prepared based on the SEQ ID NO.1 can be greatly improved. The preparation method of the carrier has simple and easy operation steps and extremely high application value.

Description

Novel coronavirus Ad26 adenovirus vector vaccine and preparation method and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to a novel coronavirus Ad26 adenovirus vector vaccine as well as a preparation method and application thereof.

Background

Coronaviruses (Coronavirus) belong to members of the order nidovirales (order Nidovirals), the family coronaviridae (family famearly) and the genus coronaviruses (genus Coronavirus) in virological classification, have single-stranded and positive-stranded RNA genomes, have the total genome length of 26-32 kb, and are RNA viruses with the largest genome known at present. There are six human coronaviruses currently known, namely 229E (HCoV-229E) and HCoV-OC43, which were discovered in the 60 s of the twentieth century, SARS-CoV which appeared in 2003, HCoV-NL63 isolated in the Netherlands in 2004, HCoV-HKU1 identified in hong Kong in China in 2005, and the novel Middle East Respiratory Syndrome (MERS) coronaviruses MERS-CoV which appeared in the Middle East of 2012. Coronaviruses can infect the respiratory tract, digestive tract, liver, kidney and nervous system of the body, causing pathological injuries of various degrees, and even death in severe cases.

In the structure of the virus particle of SARS-CoV-2 coronavirus, the S protein (spike protein, S protein) is a very important target. The S protein of SARS-CoV-2 coronavirus has pre-fusion conformation and post-fusion conformation, and can recognize receptor protein ACE2(angiotensin converting enzyme 2) on cell membrane, and is cut by furin protease of host cell to divide the protein into S1 and S2, so as to mediate and promote the fusion of virus envelope and cell membrane, and most of the antibody produced after fusion is combined with antibody without neutralization, so that the immunogenicity of vaccine is greatly reduced.

In the related art, the spike protein S gene (sequence No. NC-045512.2) of the novel coronavirus was used as a target sequence, but the expression level of the gene in HEK293 of human kidney cells was low, and the vaccine prepared therefrom may be ineffective or have a low titer, which is insufficient against viral infection.

Therefore, the development of an effective and efficient novel coronavirus vaccine is of great significance for the prevention and control of the novel coronavirus.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a novel coronavirus Ad26 adenovirus vector vaccine, which adopts a human Ad26 type adenovirus vector, solves the problem of high Ad5 pre-stored antibody level in a human body, improves the immune effect of the vaccine, and expands the applicable population.

In a first aspect of the invention, a novel coronavirus Ad26 adenovirus vector is provided, wherein the Ad26 adenovirus vector is loaded with a novel coronavirus spike optimization sequence.

The process by which mRNA precursors transcribed by eukaryotic cells can produce different mRNA splice isoforms by different splicing patterns (different splice site combinations are selected) ultimately results in different proteins produced from the same gene sequence, which is highly detrimental to protein expression. The inventor carries out codon optimization on a wild natural nucleic acid sequence (the new coronavirus spike protein) and simultaneously removes potential variable shearing sites based on the self-owned technology, thereby ensuring the uniqueness of the expression of the new coronavirus spike protein and reducing the difficulty of subsequent purification of the protein.

According to the invention, after the codon is optimized, the furin enzyme cutting site of the S gene is mutated (RRAR is mutated into GSAS), and KV from 986aa to 987aa of the S gene is mutated into PP, so that the S protein maintains stable pre-fusion conformation, and the immunogenicity of the vaccine is greatly improved. The S gene after mutation is integrated to a replication-defective Ad26 vector, cells are infected through adenovirus, new coronavirus antigen is presented, and after immunization, an organism generates specific immune response, so that the infection of the new coronavirus is blocked.

According to a first aspect of the invention, in some embodiments of the invention, the novel coronavirus spike optimized sequence is shown in SEQ ID No. 1.

According to a first aspect of the invention, in some embodiments of the invention, the Ad26 adenovirus vector is a replication-defective Ad26 adenovirus vector.

In some more preferred embodiments of the invention, the replication-defective Ad26 adenovirus vector is a replication-defective Ad26 adenovirus vector deleted of the genes of the E1 and E3 regions

According to the first aspect of the invention, in some embodiments of the invention, the exogenous gene promoter is selected from at least one of the human cytomegalovirus CMV promoter, the murine cytomegalovirus CMV promoter, EF1a or PGK 1.

In some preferred embodiments of the invention, the exogenous gene promoter is selected from the group consisting of the human cytomegalovirus CMV promoter or the murine cytomegalovirus CMV promoter.

According to a first aspect of the invention, in some embodiments of the invention, the Ad26 adenoviral vector may modulate the expression of SEQ ID NO: 1.

In a second aspect of the present invention, there is provided a method for preparing a novel coronavirus Ad26 adenovirus vector, comprising the following steps:

(1) amplifying a sequence shown as SEQ ID NO.1, and recombining to construct a shuttle plasmid 1;

(2) amplifying the genome of the shuttle plasmid 1, and recombining and constructing a shuttle plasmid 2;

(3) amplifying the genome of the shuttle plasmid 2, and recombining and constructing a shuttle plasmid 3;

(4) amplifying the genome of the shuttle plasmid 3 to obtain a target fragment CMV-SPd-BGH, and co-transfecting the target fragment CMV-SPd-BGH and the pAd26 plasmid without the genes of E1 and E3 into cells to obtain the novel coronavirus Ad26 adenovirus vector.

In a third aspect of the present invention, there is provided a novel coronavirus Ad26 adenovirus vaccine comprising the vector of the first aspect of the present invention or the vector prepared by the preparation method of the second aspect of the present invention.

The new crown vaccine based on the replication-defective Ad26 vector is a new crown vaccine, and the proportion of antibodies pre-stored in the population by the Ad26 vector is lower than A d5, so that the new crown vaccine based on the replication-defective Ad26 vector can prevent the vector from being neutralized by the pre-stored antibodies in the human body, and the immune effect is higher than that of the Ad5 vector vaccine. Moreover, Ad26 replication capacity is higher than Ad 5. Therefore, the cost of the Ad26 vector vaccine is expected to be lower than that of the Ad5 vector vaccine in the aspect of vaccine production.

According to a third aspect of the present invention, in some embodiments of the present invention, the novel coronavirus Ad26 adenovirus vector can express a protein in a human cell or a human.

In some preferred embodiments of the invention, the protein may be in a human:

inducing an immune response; or

Producing a biological reporter molecule; or

A tracking molecule for detection; or

Modulating gene function; or

As a therapeutic molecule.

In some preferred embodiments of the invention, the vaccine is a DNA plasmid or an RNA expression plasmid.

Groups or genes such as EGFP, SEAP, shRNA and the like can be added into the novel coronavirus Ad26 adenovirus vector so as to induce immune response; or producing a biological reporter; or a tracking molecule for detection; or modulating gene function; or as a therapeutic molecule.

According to a third aspect of the present invention, in some embodiments of the present invention, the novel coronavirus Ad26 adenovirus vector vaccine further comprises a pharmaceutically acceptable immunomodulator, carrier, diluent, excipient or at least one drug having a therapeutic effect on COV ID-19.

The invention has the beneficial effects that:

1. the invention is based on the replication-defective Ad26 vector, because the proportion of the pre-stored antibodies of Ad26 in the population is lower than that of Ad5, the vector can be prevented from being neutralized by the pre-stored antibodies in the human body, and the immune effect is higher than that of the conventional Ad5 vector vaccine; moreover, Ad26 has higher replication capacity than Ad5, so that more vectors can be obtained in the same time, and the vaccine preparation cost is lower.

2. The vaccine is prepared based on the S gene after codon optimization, and due to the mutation of the furin enzyme cutting site of the S gene after codon optimization and the mutation of KV from 986aa to 987aa into PP, the S protein maintains stable conformation before fusion, thereby greatly improving the immunogenicity of the vaccine.

3. The preparation method of the vector has simple and easy operation steps, and can obtain the novel coronavirus Ad26 adenovirus vector only through PCR amplification, thereby effectively saving the labor cost.

Drawings

FIG. 1 is a schematic diagram of a specific technique for constructing a novel coronavirus Ad26 adenovirus vector in the embodiment of the invention.

FIG. 2 is a diagram of virus purification in the example of the present invention, wherein 1 is HEK293, 2 is Ad26 empty vector (Ad26-empty), 3 is Ad26-SPd, and 4 is S (. DELTA.TM).

FIG. 3 is a gel electrophoresis diagram of the expression of the S protein after the A549 cells are infected by the novel coronavirus Ad26 adenovirus in the embodiment of the invention.

FIG. 4 shows the results of antibody detection in the serum of mice in the examples of the present invention.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Optimization of novel coronavirus Spike gene

The process by which mRNA precursors transcribed by eukaryotic cells can produce different mRNA splice isoforms by different splicing patterns (different splice site combinations are selected), ultimately resulting in different proteins produced from the same gene sequence. This is very disadvantageous for the expression of the protein.

Therefore, the inventor carries out codon optimization based on the natural nucleic acid sequence (the amino acid sequence is numbered as YP _009724390.1) of the spike protein of the wild-type SARS-CoV-2, and simultaneously removes potential variable shearing sites based on the self-contained technology so as to ensure the uniqueness of protein expression and reduce the difficulty of subsequent protein purification.

The optimized nucleic acid sequence is as follows:

5’-ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGAGCTCCCAGTGCGTGAACCTGA CCACAAGGACCCAGCTGCCACCTGCCTATACCAATAGCTTCACACGGGGCGTGTACTAT CCCGACAAGGTGTTTAGATCTAGCGTGCTGCACTCCACCCAGGATCTGTTTCTGCCTTTC TTTTCTAACGTGACATGGTTCCACGCCATCCACGTGTCCGGCACCAATGGCACAAAGCG GTTCGACAATCCAGTGCTGCCCTTTAACGATGGCGTGTACTTCGCCTCCACCGAGAAGT CTAACATCATCAGAGGCTGGATCTTTGGCACCACACTGGACAGCAAGACCCAGTCCCTG CTGATCGTGAACAATGCCACAAACGTGGTCATCAAGGTGTGCGAGTTCCAGTTTTGTAA TGATCCCTTCCTGGGCGTGTACTATCACAAGAACAATAAGTCTTGGATGGAGAGCGAGT TTAGGGTGTATTCCTCTGCCAACAATTGCACCTTTGAGTACGTGAGCCAGCCTTTCCTGA TGGACCTGGAGGGCAAGCAGGGCAATTTCAAGAACCTGAGGGAGTTCGTGTTTAAGAA TATCGATGGCTACTTCAAGATCTACTCCAAGCACACACCAATCAACCTGGTGCGCGACCT GCCACAGGGCTTCTCTGCCCTGGAGCCACTGGTGGATCTGCCCATCGGCATCAACATCA CCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACCCCAGGCGACAGCTC CTCTGGATGGACAGCAGGAGCTGCCGCCTACTATGTGGGCTATCTGCAGCCCCGCACCT TCCTGCTGAAGTACAACGAGAATGGCACCATCACAGACGCAGTGGATTGCGCCCTGGAC CCCCTGTCTGAGACCAAGTGTACACTGAAGAGCTTTACAGTGGAGAAGGGCATCTACCA GACCAGCAACTTCAGGGTGCAGCCAACAGAGTCCATCGTGCGCTTTCCCAATATCACCA ACCTGTGCCCTTTTGGCGAGGTGTTCAATGCCACACGCTTCGCCAGCGTGTACGCCTGG AATAGGAAGCGCATCTCCAACTGCGTGGCCGACTATTCTGTGCTGTACAACAGCGCCTC CTTCTCTACCTTTAAGTGTTATGGCGTGAGCCCCACCAAGCTGAATGATCTGTGCTTTAC AAACGTGTACGCCGATTCCTTCGTGATCAGGGGCGACGAGGTGCGCCAGATCGCACCAG GACAGACCGGCAAGATCGCAGACTACAATTATAAGCTGCCTGACGATTTCACAGGCTGC GTGATCGCCTGGAACTCTAACAATCTGGATAGCAAAGTGGGCGGCAACTACAATTATCT GTACCGGCTGTTTAGAAAGTCTAATCTGAAGCCATTCGAGCGGGACATCTCCACCGAGA TCTACCAGGCCGGCTCTACACCCTGCAATGGCGTGGAGGGCTTTAACTGTTATTTCCCTC TGCAGTCCTACGGCTTCCAGCCAACCAACGGCGTGGGCTATCAGCCCTACAGAGTGGTG GTGCTGTCTTTTGAGCTGCTGCACGCACCTGCAACCGTGTGCGGCCCAAAGAAGAGCA CAAATCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGACTGACCGGCACAGG CGTGCTGACCGAGAGCAACAAGAAGTTCCTGCCATTTCAGCAGTTCGGCAGGGACATC GCAGATACCACAGACGCCGTGCGCGACCCTCAGACCCTGGAGATCCTGGACATCACACC ATGTTCCTTCGGCGGCGTGTCTGTGATCACCCCAGGCACCAATACATCCAACCAGGTGG CCGTGCTGTATCAGGACGTGAATTGCACAGAGGTGCCCGTGGCAATCCACGCAGATCAG CTGACCCCTACATGGCGGGTGTACTCTACCGGCAGCAACGTGTTCCAGACAAGAGCCGG ATGCCTGATCGGAGCAGAGCACGTGAACAATAGCTATGAGTGCGACATCCCTATCGGCG CCGGCATCTGTGCCTCCTACCAGACCCAGACAAACTCCCCAAGGAGAGCCCGGTCTGTG GCCAGCCAGTCCATCATCGCCTATACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTA CTCCAACAATTCTATCGCCATCCCTACCAACTTCACAATCAGCGTGACCACAGAGATCCT GCCAGTGAGCATGACCAAGACATCCGTGGACTGCACCATGTATATCTGTGGCGATTCCAC AGAGTGTTCTAACCTGCTGCTGCAGTACGGCTCCTTTTGCACCCAGCTGAATAGAGCCC TGACAGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGA AGCAGATCTACAAGACACCACCCATCAAGGACTTTGGCGGCTTCAACTTCAGCCAGATC CTGCCCGATCCTAGCAAGCCATCCAAGCGGTCTTTTATCGAGGACCTGCTGTTCAACAA GGTGACCCTGGCCGATGCCGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGACATCG CCGCCAGAGACCTGATCTGCGCCCAGAAGTTTAATGGCCTGACCGTGCTGCCTCCACTG CTGACAGATGAGATGATCGCACAGTACACCTCTGCCCTGCTGGCCGGCACCATCACAAG CGGATGGACATTCGGCGCAGGAGCCGCCCTGCAGATCCCCTTTGCCATGCAGATGGCCT ATCGGTTCAACGGCATCGGCGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATC GCCAATCAGTTTAACAGCGCCATCGGCAAGATCCAGGACTCTCTGAGCTCCACCGCCAG CGCCCTGGGCAAGCTGCAGGATGTGGTGAATCAGAACGCCCAGGCCCTGAATACACTG GTGAAGCAGCTGTCTAGCAACTTCGGCGCCATCTCCTCTGTGCTGAATGACATCCTGAG CCGGCTGGACAAGGTGGAGGCAGAGGTGCAGATCGACCGGCTGATCACCGGCAGACTG CAGTCCCTGCAGACCTACGTGACACAGCAGCTGATCAGGGCAGCAGAGATCAGGGCCT CTGCCAATCTGGCCGCCACAAAGATGAGCGAGTGCGTGCTGGGACAGTCCAAGAGGGT GGACTTTTGCGGCAAGGGCTATCACCTGATGAGCTTCCCACAGTCCGCCCCTCACGGAG TGGTGTTTCTGCACGTGACCTACGTGCCAGCCCAGGAGAAGAACTTCACCACAGCCCCC GCCATCTGTCACGATGGCAAGGCCCACTTTCCTAGGGAGGGCGTGTTCGTGAGCAACGG CACCCACTGGTTTGTGACACAGCGCAATTTCTACGAGCCACAGATCATCACCACAGACA ATACCTTCGTGTCCGGCAACTGCGACGTGGTCATCGGCATCGTGAACAATACAGTGTATG ATCCTCTGCAGCCAGAGCTGGACTCTTTTAAGGAGGAGCTGGATAAGTACTTCAAGAAT CACACCAGCCCCGACGTGGATCTGGGCGACATCTCTGGCATCAATGCCAGCGTGGTGAA CATCCAGAAGGAGATCGACAGACTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTG ATCGATCTGCAGGAGCTGGGCAAGTATGAGCAGTACATCAAGTGGCCCTGGTATATCTGG CTGGGCTTCATCGCCGGCCTGATCGCCATCGTGATGGTGACCATCATGCTGTGCTGTATG ACAAGCTGCTGTTCCTGCCTGAAGGGCTGCTGTTCTTGTGGCAGCTGCTGTAAGTTTGA TGAGGACGATTCCGAGCCTGTGCTGAAGGGCGTGAAGCTGCACTACACCTAA-3’(SEQ I D NO.1)。

the sequence shown in SEQ ID NO.1 is used for constructing a template plasmid, or PGA1-S plasmid (preserved by Guangzhou Enbao biomedical science and technology Limited and carrying the sequence shown in SEQ ID NO. 1) is used as the template plasmid.

Construction of novel coronavirus Ad26 adenovirus vector

The Ad26 adenovirus vector constructed in this example is a pAd26-SPd vector carrying the S gene with proline substitution (the KV mutation from 986aa to 987aa of S protein is PP, and the PP mutation is briefly described in the following examples) and a furin site mutation (the RAAR mutation from the furin site is GSAS).

1. Constructing shuttle plasmid pGA1-SP carrying the S antigen gene of the PP mutation:

(1) the desired fragment SP-L was obtained by PCR using PGA1-S plasmid as a template and S-F and SP-R as primers and Primer Star Mix (TaKaRa).

Wherein, the nucleotide sequence of S-F is: 5'-GCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCC GCCACCATGTTCGTGTTTCTGGT-3' (SEQ ID NO. 2);

the nucleotide sequence of SP-R is: 5'-TCTGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCATTC AGC-3' (SEQ ID NO. 3).

The PCR amplification reaction conditions are as follows: preheating at 98 deg.C for 3 min; denaturation at 98 ℃ for 10 s; annealing at 60 ℃ for 5 s; extension at 72 ℃ for 30 s; 28 cycles, final extension at 72 ℃ for 5 min. The resulting amplification product SP-R can be stored at 4 ℃.

(2) The PGA1-S plasmid described in the above example was used as a template, and SP-F and S-R were used as primers, and PCR was performed using Primer Star Mix (TaKaRa) to obtain the desired fragment SP-R.

Wherein, the nucleotide sequence of SP-F is: 5'-GGACCCTCCCGAGGCAGAGGTGCAGATCGACCGG CTGATC-3' (SEQ ID NO. 4);

the nucleotide sequence of S-R is: 5'-AGAATAGGGCCCTCTAGACTAGTTTATCAGGTGTAGTGCAG CTTC-3' (SEQ ID NO. 5).

The PCR amplification reaction conditions and the storage conditions were the same as those of SP-L.

(3) Recombining the target fragment SP-L, SP-R obtained in the steps (1) and (2) with a vector skeleton pGA1 by using homologous recombination enzyme (Vazyme) to obtain a shuttle plasmid pGA 1-SP.

2. Constructing shuttle plasmid pGA1-SPd carrying PP and the S antigen gene with the deletion of the furin restriction enzyme cutting sites:

(1) the shuttle plasmid pGA1-SP prepared in the above example was used as a template, and S-F and Pd-R were used as primers, and PCR was performed using Primer Star Mix (TaKaRa) to obtain the target fragment SPd-L.

Wherein, the nucleotide sequence of S-F is shown in SEQ ID NO. 2.

The nucleotide sequence of Pd-R is as follows: 5'-TGGGGAGTTTGTCTGGGTCTGGTAGGAGGCAC-3' (SEQ ID NO. 6).

(2) The shuttle plasmid pGA1-SP prepared in the above example was used as a template, and S-R and Pd-F were used as primers, and PCR was performed using Primer Star Mix (TaKaRa) to obtain the target fragment SPd-R.

Wherein, the nucleotide sequence of S-R is shown as SEQ ID NO. 5.

The nucleotide sequence of Pd-F is as follows: 5'-ACCCAGACAAACTCCCCAGGCAGCGCTAGCTCTGTGGCC AGCCAGTCCATCATCGCCT-3' (SEQ ID NO. 7).

(3) Recombining the target fragment SPd-L, SPd-R obtained in the steps (1) and (2) with the vector skeleton pGA1 by using a homologous recombinase (Vazyme) to obtain a shuttle plasmid pGA 1-SPd.

3. Constructing an S antigen gene shuttle plasmid pGA261-SPd carrying PP and the deletion of the furin restriction enzyme cutting site:

(1) the shuttle plasmid pGA1-SPd prepared in the above example is used as a template, S-F (SEQ ID NO.2) and S-R (SEQ ID NO.5) are used as primers, and a Primer Star Mix (TaKaRa) is used for PCR amplification to obtain the target fragment SPd.

(2) pGA261-EGFP plasmid (stored by Guangzhou Enbao biomedical science and technology company) is used as a template, PGA-R and PGA-F are used as primers, and Primer Star Mix (TaKaRa) is adopted for PCR amplification to obtain a vector framework pGA 261.

Wherein the nucleotide sequence of the PGA-R is as follows: 5'-GGATCCGAGCTCGGTACCAAGCTTAAGTTTAAAC GCTAGAGTCCGG-3' (SEQ ID NO. 8);

the nucleotide sequence of PGA-F is: 5'-TCTAGAGGGCCCTATTCTATAGTGTC-3' (SEQ ID NO. 9).

(3) The target fragment SPd obtained in steps (1) and (2) is recombined with the vector backbone pGA261 using a homologous recombinase (Vazyme) to obtain a shuttle plasmid pGA 261-SPd.

4. Constructing pAd26-SPd plasmid carrying PP and the S antigen gene with the deletion of the furin restriction enzyme cutting site:

(1) the shuttle plasmid pGA261-SPd prepared in the above example is used as a template, Ad26-SB-F and Ad26-SB-R are used as primers, a CMV-SPd-BGH target fragment carrying a homologous recombination arm is obtained by PCR amplification, and the target fragment is recovered.

Wherein the nucleotide sequence of Ad26-SB-F is: 5'-CCTCTCAAGTCTGTATACCATCATCAATAATAT ACCCCACAAAGTAAACAAA-3' (SEQ ID NO. 10);

the nucleotide sequence of Ad26-SB-R is: 5'-TTTGGTGTGCGCCGGTGGCCCCTGCTATGACTGGAT CATCTACAACACG-3' (SEQ ID NO. 11).

The target fragment was recovered using a gel recovery kit (available from Guangzhou Meiji Biotech Co., Ltd.).

(2) pAd26(pAd 26. DELTA.E 1. DELTA.E 3) from which E1 and E3 genes were removed was subjected to PmeI linearization, and then recovered by ethanol precipitation.

(3) Co-transforming the target fragment CMV-SPd-BGH obtained in the step (1) and pAd26 delta E1 delta E3(5E4) obtained in the step (2) into BJ5183 competent cells, and carrying out homologous recombination to obtain pAd26-SPd plasmids.

The specific technical principle of the construction of the novel coronavirus Ad26 adenovirus vector is shown in figure 1.

Rescue and production of novel coronavirus Ad26 adenovirus vector

The plasmid pAd26-SPd prepared in the above example was linearized with AsiSI according to methods conventional in the art, and then recovered by ethanol precipitation. The recovered pAd26-SPd plasmid was transfected into 293 cells using cationic lipofection. 4 hours after transfection, 2mL of DMEM medium containing 5% fetal bovine serum was added, incubated for 7-10 days, and cytopathic effect was observed. After detoxification, cells and culture supernatant were collected, frozen and thawed repeatedly in water bath at 37 ℃ and liquid nitrogen for 3 times, centrifuged to remove cell debris, collected supernatant, infected into 10 cm dishes, and incubated for 2-3 days. Incubating for 2-3 days, collecting cells and culture supernatant, and repeatedly freezing and thawingCell debris was removed 3 times and centrifuged, and the supernatant was collected, infected to 3-5 15 cm dishes, and incubated for 2-3 days. This procedure was repeated to infect 30 15 cm dishes. This procedure was repeated further, and the supernatant was collected into a cesium chloride density gradient centrifuge tube, centrifuged at 40000 rpm at 4 ℃ for 4 hours. Sucking out virus band, desalting, packaging, and using OD₂₆₀The absorbance is measured to determine the virus particle titer, and the formula is calculated as follows:

the virus stock was frozen at-80 ℃.

The virus purification picture is shown in figure 2.

Effect detection of novel coronavirus Ad26 adenovirus vector

1, Spike gene expression effect detection:

a549 cells are infected by the novel coronavirus Ad26 adenovirus prepared in the above example, and the cells are collected after incubation for 24 h. Cell samples were processed according to the conventional WesternBlot method and protein detection was performed.

The results are shown in FIG. 3.

The gel electrophoresis picture shows that the expression of the S protein can be observed in the sample of the candidate vaccine strain Ad26-SPd, which indicates that the Ad26 candidate vaccine strain is constructed correctly and can successfully express the S antigen protein.

2. Evaluation of animal immunogenicity:

in this example, the animal immunogenicity of the novel coronavirus Ad26 adenovirus vector prepared in the above example was examined with respect to 6-8 week-old CD46 transgenic mice.

The specific operation is as follows:

the CD46 transgenic mice were divided into 2 groups of 5 mice each. On day 0, an immunization dose of Ad26-SPd (1X 10) was separately intramuscularly administered⁹vp/only). On day 14, experimental mice were bled from the eye socket and sera were isolated. Enzyme-linked immunosorbent assay (ELISA) is adopted, S protein of the new coronavirus is taken as antigen, and the antibody level in serum is detected.

The ELISA method for detecting the antibody level comprises the following steps: protein S was added to 96-well plates at 50 ng/well and incubated overnight at 4 ℃. The supernatant was aspirated off, washed 3 times with phosphate Tween buffer (PBST), 200. mu.L of 5% BSA was added to each well, and blocked at room temperature for 2 h. PBST was washed 3 times, and mouse sera (diluted with PBS) diluted 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600 and, 1:51200 were added to each well and incubated at 37 ℃ for 2 h. mu.L of diluted HRP-labeled IgG secondary antibody was added and incubated at 37 ℃ for 2 h. PBST was washed 6-8 times. Color was developed by adding 100. mu.L of TMB. The reaction was stopped by the addition of 50. mu.L of 1M sulfuric acid. OD was measured by absorbance at 450 nm.

The results are shown in FIG. 4. The OD value obtained by measurement is in the range of 0.1-4, which shows that the Ad26-SPd plasmid can induce mice to generate specific antibodies of the new coronavirus S protein.

In conclusion, the novel coronavirus Ad26 adenovirus vector prepared in the above embodiment carries a foreign antigen gene expression cassette, can express an antigen after infecting a human body, and can play a role of a vaccine. Moreover, the target gene inserted into the new coronavirus Ad26 adenovirus vector prepared in the above example is the optimized sequence of the new coronavirus spike, and replaces the new coronavirus spike which is not optimized, so that the stability is better. The novel coronavirus Ad26 adenovirus vector prepared in the embodiment solves the problem of high Ad5 pre-stored antibody level in a human body, improves the vaccine immune effect, enlarges the adaptive population and effectively reduces the production cost of the vaccine.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Guangzhou Enbao biomedical science and technology Co., Ltd

<120> novel coronavirus Ad26 adenovirus vector vaccine, and preparation method and application thereof

<130>

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 3822

<212> DNA

<213> Artificial sequence

<400> 1

atgttcgtgt ttctggtgct gctgcctctg gtgagctccc agtgcgtgaa cctgaccaca 60

aggacccagc tgccacctgc ctataccaat agcttcacac ggggcgtgta ctatcccgac 120

aaggtgttta gatctagcgt gctgcactcc acccaggatc tgtttctgcc tttcttttct 180

aacgtgacat ggttccacgc catccacgtg tccggcacca atggcacaaa gcggttcgac 240

aatccagtgc tgccctttaa cgatggcgtg tacttcgcct ccaccgagaa gtctaacatc 300

atcagaggct ggatctttgg caccacactg gacagcaaga cccagtccct gctgatcgtg 360

aacaatgcca caaacgtggt catcaaggtg tgcgagttcc agttttgtaa tgatcccttc 420

ctgggcgtgt actatcacaa gaacaataag tcttggatgg agagcgagtt tagggtgtat 480

tcctctgcca acaattgcac ctttgagtac gtgagccagc ctttcctgat ggacctggag 540

ggcaagcagg gcaatttcaa gaacctgagg gagttcgtgt ttaagaatat cgatggctac 600

ttcaagatct actccaagca cacaccaatc aacctggtgc gcgacctgcc acagggcttc 660

tctgccctgg agccactggt ggatctgccc atcggcatca acatcacccg gtttcagaca 720

ctgctggccc tgcacagaag ctacctgacc ccaggcgaca gctcctctgg atggacagca 780

ggagctgccg cctactatgt gggctatctg cagccccgca ccttcctgct gaagtacaac 840

gagaatggca ccatcacaga cgcagtggat tgcgccctgg accccctgtc tgagaccaag 900

tgtacactga agagctttac agtggagaag ggcatctacc agaccagcaa cttcagggtg 960

cagccaacag agtccatcgt gcgctttccc aatatcacca acctgtgccc ttttggcgag 1020

gtgttcaatg ccacacgctt cgccagcgtg tacgcctgga ataggaagcg catctccaac 1080

tgcgtggccg actattctgt gctgtacaac agcgcctcct tctctacctt taagtgttat 1140

ggcgtgagcc ccaccaagct gaatgatctg tgctttacaa acgtgtacgc cgattccttc 1200

gtgatcaggg gcgacgaggt gcgccagatc gcaccaggac agaccggcaa gatcgcagac 1260

tacaattata agctgcctga cgatttcaca ggctgcgtga tcgcctggaa ctctaacaat 1320

ctggatagca aagtgggcgg caactacaat tatctgtacc ggctgtttag aaagtctaat 1380

ctgaagccat tcgagcggga catctccacc gagatctacc aggccggctc tacaccctgc 1440

aatggcgtgg agggctttaa ctgttatttc cctctgcagt cctacggctt ccagccaacc 1500

aacggcgtgg gctatcagcc ctacagagtg gtggtgctgt cttttgagct gctgcacgca 1560

cctgcaaccg tgtgcggccc aaagaagagc acaaatctgg tgaagaacaa gtgcgtgaac 1620

ttcaacttca acggactgac cggcacaggc gtgctgaccg agagcaacaa gaagttcctg 1680

ccatttcagc agttcggcag ggacatcgca gataccacag acgccgtgcg cgaccctcag 1740

accctggaga tcctggacat cacaccatgt tccttcggcg gcgtgtctgt gatcacccca 1800

ggcaccaata catccaacca ggtggccgtg ctgtatcagg acgtgaattg cacagaggtg 1860

cccgtggcaa tccacgcaga tcagctgacc cctacatggc gggtgtactc taccggcagc 1920

aacgtgttcc agacaagagc cggatgcctg atcggagcag agcacgtgaa caatagctat 1980

gagtgcgaca tccctatcgg cgccggcatc tgtgcctcct accagaccca gacaaactcc 2040

ccaaggagag cccggtctgt ggccagccag tccatcatcg cctataccat gagcctgggc 2100

gccgagaaca gcgtggccta ctccaacaat tctatcgcca tccctaccaa cttcacaatc 2160

agcgtgacca cagagatcct gccagtgagc atgaccaaga catccgtgga ctgcaccatg 2220

tatatctgtg gcgattccac agagtgttct aacctgctgc tgcagtacgg ctccttttgc 2280

acccagctga atagagccct gacaggcatc gccgtggagc aggacaagaa cacccaggag 2340

gtgttcgccc aggtgaagca gatctacaag acaccaccca tcaaggactt tggcggcttc 2400

aacttcagcc agatcctgcc cgatcctagc aagccatcca agcggtcttt tatcgaggac 2460

ctgctgttca acaaggtgac cctggccgat gccggcttca tcaagcagta tggcgattgt 2520

ctgggcgaca tcgccgccag agacctgatc tgcgcccaga agtttaatgg cctgaccgtg 2580

ctgcctccac tgctgacaga tgagatgatc gcacagtaca cctctgccct gctggccggc 2640

accatcacaa gcggatggac attcggcgca ggagccgccc tgcagatccc ctttgccatg 2700

cagatggcct atcggttcaa cggcatcggc gtgacccaga atgtgctgta cgagaaccag 2760

aagctgatcg ccaatcagtt taacagcgcc atcggcaaga tccaggactc tctgagctcc 2820

accgccagcg ccctgggcaa gctgcaggat gtggtgaatc agaacgccca ggccctgaat 2880

acactggtga agcagctgtc tagcaacttc ggcgccatct cctctgtgct gaatgacatc 2940

ctgagccggc tggacaaggt ggaggcagag gtgcagatcg accggctgat caccggcaga 3000

ctgcagtccc tgcagaccta cgtgacacag cagctgatca gggcagcaga gatcagggcc 3060

tctgccaatc tggccgccac aaagatgagc gagtgcgtgc tgggacagtc caagagggtg 3120

gacttttgcg gcaagggcta tcacctgatg agcttcccac agtccgcccc tcacggagtg 3180

gtgtttctgc acgtgaccta cgtgccagcc caggagaaga acttcaccac agcccccgcc 3240

atctgtcacg atggcaaggc ccactttcct agggagggcg tgttcgtgag caacggcacc 3300

cactggtttg tgacacagcg caatttctac gagccacaga tcatcaccac agacaatacc 3360

ttcgtgtccg gcaactgcga cgtggtcatc ggcatcgtga acaatacagt gtatgatcct 3420

ctgcagccag agctggactc ttttaaggag gagctggata agtacttcaa gaatcacacc 3480

agccccgacg tggatctggg cgacatctct ggcatcaatg ccagcgtggt gaacatccag 3540

aaggagatcg acagactgaa cgaggtggcc aagaatctga acgagagcct gatcgatctg 3600

caggagctgg gcaagtatga gcagtacatc aagtggccct ggtatatctg gctgggcttc 3660

atcgccggcc tgatcgccat cgtgatggtg accatcatgc tgtgctgtat gacaagctgc 3720

tgttcctgcc tgaagggctg ctgttcttgt ggcagctgct gtaagtttga tgaggacgat 3780

tccgagcctg tgctgaaggg cgtgaagctg cactacacct aa 3822

<210> 2

<211> 59

<212> DNA

<213> Artificial sequence

<400> 2

gcgtttaaac ttaagcttgg taccgagctc ggatccgcca ccatgttcgt gtttctggt 59

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence

<400> 3

tctgcctcgg gagggtccag ccggctcagg atgtcattca gc 42

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence

<400> 4

ggaccctccc gaggcagagg tgcagatcga ccggctgatc 40

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence

<400> 5

agaatagggc cctctagact agtttatcag gtgtagtgca gcttc 45

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence

<400> 6

tggggagttt gtctgggtct ggtaggaggc ac 32

<210> 7

<211> 58

<212> DNA

<213> Artificial sequence

<400> 7

acccagacaa actccccagg cagcgctagc tctgtggcca gccagtccat catcgcct 58

<210> 8

<211> 46

<212> DNA

<213> Artificial sequence

<400> 8

ggatccgagc tcggtaccaa gcttaagttt aaacgctaga gtccgg 46

<210> 9

<211> 26

<212> DNA

<213> Artificial sequence

<400> 9

tctagagggc cctattctat agtgtc 26

<210> 10

<211> 52

<212> DNA

<213> Artificial sequence

<400> 10

cctctcaagt ctgtatacca tcatcaataa tataccccac aaagtaaaca aa 52

<210> 11

<211> 49

<212> DNA

<213> Artificial sequence

<400> 11

tttggtgtgc gccggtggcc cctgctatga ctggatcatc tacaacacg 49

Claims

1. A novel coronavirus Ad26 adenovirus vector, wherein the Ad26 adenovirus vector is loaded with a novel coronavirus spike optimization sequence; the new coronavirus spike optimized sequence is preferably the sequence shown in SEQ ID NO. 1.

2. The novel coronavirus Ad26 adenovirus vector according to claim 1, wherein the Ad26 adenovirus vector is a replication-defective Ad26 adenovirus vector.

3. The adenoviral vector vaccine of claim 2, wherein: the replication-defective Ad26 adenovirus vector is a replication-defective Ad26 adenovirus vector with deletion of E1 and E3 region genes.

4. The novel coronavirus Ad26 adenovirus vector according to claim 1, wherein the exogenous gene promoter is at least one selected from the group consisting of human cytomegalovirus CMV promoter, murine cytomegalovirus CMV promoter, EF1a and PGK 1.

5. The novel coronavirus Ad26 adenovirus vector according to any one of claims 1-4, wherein the Ad26 adenovirus vector can regulate the expression of SEQ ID NO: 1.

6. A preparation method of a novel coronavirus Ad26 adenovirus vector comprises the following steps:

7. A novel coronavirus Ad26 adenovirus vector vaccine, which comprises the novel coronavirus Ad26 adenovirus vector of any one of claims 1-5 or the vector prepared by the preparation method of claim 6.

8. The novel coronavirus Ad26 adenovirus vector vaccine of claim 7, wherein the novel coronavirus Ad26 adenovirus vector can express proteins in human cells or in humans.

9. The novel coronavirus Ad26 adenoviral vector vaccine according to claim 7, characterized in that: the vaccine is DNA plasmid or RNA expression plasmid.

10. The novel coronavirus Ad26 adenoviral vector vaccine according to claim 8, wherein the protein is capable of:

inducing an immune response; or

Producing a biological reporter molecule; or

A tracking molecule for detection; or

Modulating gene function; or

As a therapeutic molecule.

11. The novel coronavirus Ad26 adenoviral vector vaccine of any one of claims 7-10, wherein the novel coronavirus Ad26 adenoviral vector vaccine further comprises a pharmaceutically acceptable immunomodulator, carrier, diluent, excipient or at least one drug having a therapeutic effect on covi-19.