WO2021139147A1 - Bivalent adenovirus vaccine - Google Patents

Abstract

Disclosed is a bivalent adenovirus vaccine comprising a replication-deficient human type 4 adenovirus and a replication-deficient human type 7 adenovirus. The E1 and E3 genes of the replication-deficient human type 4 adenovirus and the replication-deficient human type 7 adenovirus are deleted. A portion of the coding cassette of the E4 gene is replaced with the corresponding coding cassette of the E4 gene of human type 5 adenovirus. The bivalent adenovirus vaccine can effectively stimulate the body to produce a humoral immune response and a cellular immune response to produce high-titer, specific neutralizing antibodies for preventing pathogen infection.

Description

A bivalent adenovirus vaccine Technical field

The invention belongs to the technical field of virus immunology, and specifically relates to an adenovirus bivalent vaccine.

Background technique

Adenovirus (Ad) is a double-stranded DNA virus with a genome length of about 35-40 kb. It is known that human adenoviruses are divided into 7 subgroups (A～G), including more than 50 serotypes (more than 90 genotypes). After infection, patients mainly cause acute respiratory diseases (adenovirus B and C subgroups) and conjunctivitis (Adenovirus B and D subgroups) and gastroenteritis (Adenovirus F subgroups 41 and 42, G subgroup 52). Respiratory tract infections caused by adenovirus are mostly caused by adenovirus types 3, 4 and 7. Ad4 and Ad7 broke out mainly in places where young people and teenagers gather such as troops and schools, and even led to the death of patients. However, there is no specific medicine for the treatment of adenovirus infection, and only supportive treatment can be taken clinically.

Currently, vaccines to prevent adenovirus infection are only available in the U.S. military. The vaccine is an oral live virus vaccine in the form of enteric-coated capsules, which are passed on human embryonic kidney diploid fibroblasts and are produced by freeze-dehydration and mixing with cellulose lactose. The use of the vaccine effectively controlled the outbreak of adenovirus infections in the US military. However, the Ad4 and Ad7 vaccines used by the U.S. military are extremely risky. The vaccine is mainly low-dose wild-type adenovirus. There is a risk that the residual live virus will be discharged from the intestine to pollute the living environment, and it is very easy to cause secondary pollution of the virus. The safety is poor, so it cannot be widely used in the general population. Therefore, it is very necessary to develop a replication-deficient adenovirus vaccine that is highly safe and can prevent the strong strains of Ad4 and Ad7.

Replication-deficient adenovirus vectors have been widely used in vaccine development, gene therapy and other fields. They are not only safe, but also have a strong immune response in the organism. Studies have shown that the E1 gene of adenovirus is an essential gene for its replication and proliferation, and the E3 gene plays a key role in resisting the host's immune system. After knocking out the E1 and E3 genes, the adenovirus loses the ability to replicate in normal humans and has an attenuated phenotype in this respect. At the same time, the main surface antigens Hexon and Fiber of Ad4 and Ad7 are not affected and will not affect the immunogenicity of the vaccine. Therefore, the use of replication-defective adenovirus as a vaccine can effectively increase the completeness and scope of the vaccine. Replication-deficient adenovirus can be produced in complementary cell lines, such as 293 cells and PerC6 cells expressing the Ad5E1 gene. However, studies have found that many adenoviruses, especially non-C subgroup adenoviruses, have lower yields in these production cell lines after knocking out the E1 and E3 genes. The main reason is that Ad5E1B 55K cannot interact with the B subtype adenovirus E4Orf6 protein. It cannot effectively inhibit the nucleation of host cell mRNA, and cannot increase the expression of late viral proteins. These adenoviruses require 293 cell lines or other cell lines expressing the corresponding E1 gene to be produced. Therefore, replication-defective Ad3, Ad4 and Ad7, which only knock out the E1 and E3 genes, are difficult to produce in the vaccine production cell line 293 or PerC6. Improving its production capacity in these cell lines is currently a bottleneck technical problem that needs to be resolved.

Summary of the invention

The purpose of the present invention is to overcome the defects of the prior art and provide a preparation method and application of replication-defective recombinant Ad4 and Ad7 that can be amplified on a large scale in vaccine production cell strains, and the replication-defective recombinant Ad4 and Ad7 can be used to a certain extent. Ad4 and Ad7 bivalent vaccines are prepared by mixing Ad4 and Ad7 in a ratio of 5%. The immune body can effectively stimulate the body to produce humoral immunity and cellular immune response, and produce specific Ad4 and Ad7 neutralizing antibodies, which are used to prevent the infection of Ad4 and Ad7 pathogens.

The technical scheme adopted by the present invention is:

A composition comprising replication-deficient human type 4 adenovirus and type 7 adenovirus.

Preferably, the E1 and E3 genes of the replication-deficient type 4 adenovirus are deleted, and part of the coding frame of the E4 gene is replaced with the corresponding coding frame of the human type 5 adenovirus E4 gene.

Preferably, the coding frame of the E4 gene includes Orf2, Orf3, Orf4 and Orf6 coding frame.

Preferably, the E1 and E3 genes of the replication-deficient human adenovirus type 7 are deleted, and part of the coding frame of the E4 gene is replaced with the corresponding coding frame of the human type 5 adenovirus E4 gene.

Preferably, the coding frame of the E4 gene includes Orf2, Orf3, Orf4 and Orf6 coding frame.

Further preferably, at least one of the E1 gene regions of the replication-deficient adenovirus integrates the foreign gene expression cassette.

Preferably, the exogenous gene expression cassette contains a nucleotide sequence that can induce an immune response in the human body or generate a biological reporter molecule or a tracking molecule for detection, or a nucleotide sequence that can regulate gene function or a therapeutic molecule.

Further preferably, in the composition described above, the mixing ratio of the number of replication-defective human adenovirus type 4 and replication-defective human adenovirus type 7 virus particles is between 1:10 and 10:1.

Application of the above-mentioned composition in preparing vaccines, detecting reagents, regulating gene function or medicines.

Preferably, any of the above-mentioned compositions further includes a pharmaceutically acceptable adjuvant, carrier, diluent or excipient.

The beneficial effects of the present invention are:

(1) On the basis of knocking out the E1 and E3 genes, the present invention replaces the Orf2, Orf3, Orf4, and Orf6 coding frames of the E4 gene of Ad4 and Ad7 with the corresponding coding frames of the Ad5 E4 gene, which greatly improves the replication-defective Ad4 and The safety of Ad7 and its ability to replicate in production cell lines.

(2) The Ad4 and Ad7 bivalent vaccine prepared by the present invention can effectively induce Ad4 and Ad7 specific humoral immunity and cellular immunity in experimental animals after primary immunization and booster immunization, and produce specific Ad4 and Ad7 neutralizing antibodies , Used to prevent the infection of Ad4 and Ad7 pathogens. Compared with the commercially available Ad4 and Ad7 bivalent live vaccines (U.S.), the bivalent vaccine of the present invention greatly improves the safety and scope of use of the vaccine while retaining its immunogenicity.

Description of the drawings

Figure 1 is a flow chart of the construction of pAd4 plasmid.

Figure 2 is a flow chart of the construction of pAd4ΔE3 plasmid.

Figure 3 is a flow chart of the construction of pAd4ΔE1ΔE3 plasmid.

Figure 4 is a flow chart of the construction of pAd4ΔE1ΔE3 (Orf2-6) plasmid.

Figure 5 is a flow chart of the construction of pAd4ΔE1ΔE3(Orf2-6)-EGFP plasmid.

Figure 6 shows the enzyme digestion and identification results of pAd4 plasmid, pAd4ΔE3 plasmid, pAd4ΔE1ΔE3 plasmid, pAd4ΔE1ΔE3 (Orf2-6) and pAd4ΔE1ΔE3 (Orf2-6)-EGFP plasmid.

Figure 7 shows the results of the production and purification of the replication-defective Ad4 vector.

Figure 8 shows the results of the plaque formation experiment of the replication-deficient Ad4 vector in HEK293 and A549 cells.

Figure 9 shows the construction flow chart (A) of pAd7 plasmid and the result of restriction digestion (B).

Figure 10 is the construction flow chart (A) and restriction diagram (B) of pAd7ΔE3 plasmid.

Figure 11 is the construction flow chart (A) and restriction diagram (B) of pAd7ΔE1ΔE3 plasmid.

Figure 12 is the construction flow chart (A) and restriction diagram (B) of pAd7ΔE1ΔE3 (Orf2-6) plasmid.

Figure 13 is the construction flow chart (A) and restriction diagram (B) of pAd7ΔE1ΔE3(Orf2-6)-EGFP plasmid.

Figure 14 shows the results of the production and purification of the replication-defective Ad7 vector.

Figure 15 shows the results of the plaque formation experiment of the replication-deficient Ad7 vector in HEK293 and A549 cells.

Figure 16 shows the results of determination of the levels of Ad4 and Ad7 neutralizing antibodies in the serum of rhesus monkeys.

Figure 17 shows the results of determining the levels of Ad3, Ad11 and Ad14 cross-neutralizing antibodies in the serum of rhesus monkeys.

Figure 18 shows the results of the PMBC ELISPOT experiment in rhesus monkeys.

Detailed ways

The present invention will be further described below in conjunction with the embodiments, but it is not limited thereto.

The term "human type 4 adenovirus, human type 7 adenovirus" in the present invention refers to the type 4 adenovirus and type 7 adenovirus known to those of ordinary skill in the art. The adenovirus genome used in the examples is also derived from these known adenoviruses. Human adenovirus. The replication-deficient human type 4 adenovirus vector and human type 7 adenovirus vector of the present invention are not limited to the specific clinical isolates used in the examples.

In order to understand the technical content of the present invention more clearly, the following embodiments are described in detail in conjunction with the accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples usually follow conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to manufacturing The conditions suggested by the manufacturer. Various common chemical reagents used in the examples are all commercially available products.

Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments, and are not used to limit the present invention.

Example 1 Preparation of replication-deficient Ad4 vaccine

1. Construction of Ad4 genome circularization shuttle vector

1. Construction of Ad4 genome circularization shuttle vector.

Using Ad4 genome as a template for PCR amplification, recombinant arms Ad4-L and Ad4-R were obtained.

Ad4-L primer sequence:

Ad4-L Fw, ATAGAATTCGGGGTGGAGTGTTTTTGCAAG (SEQ ID NO.1);

Ad4-L Rw, TTTACTAGTGTTTAAACGTAATCGAAACCTCCACGTAATGG (SEQ ID NO. 2).

PCR program: 95°C, 30 seconds; 62°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

Ad4-R primer sequence:

Ad4-R Fw, ACTAGTAGCTGGATCCAAGCCTCGAGGCACTACAATG (SEQ ID NO.3);

Ad4-R Rw, CCTGCCGTTCGACGATGCGATCGCCATCATCAATAATATACCTTATAGATGG (SEQ ID NO. 4).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 80 seconds; 25 cycles.

Homologous recombinase was used to connect to pSIMPLE 19 (EcoRV) vector (TaKaRa) to obtain Ad4 genome circularized shuttle plasmid pT-Ad4 (L+R).

2. Construction of pAd4 plasmid.

After pT-Ad4(L+R) was linearized with SpeI and BamHI, it was co-transformed with Ad4 genome into BJ5183 competent cells; after screening for ampicillin resistance, the plasmid was manually extracted and further transformed into XL-Blue competent cells (Beijing Sibai Hui Biotechnology Co., Ltd.); manually extract the plasmid to obtain pAd4, the technical process is shown in Figure 1, and the restriction diagram is shown in Figure 6.

2. Knockout of E3 gene and construction of pAd55ΔE3 plasmid

1. The construction of E3 gene knockout shuttle plasmid pVax-delE3(L+R).

Using Ad4 genome as a template for PCR amplification, recombination arms L-delE3 and R-delE3 were obtained.

L-delE3 (or called delE3-4L) primer sequence:

L-delE3 F, GACATTGATTATTGACTAGTTTCAACACCTGGACCACTGCC (SEQ ID NO.5);

L-delE3 R, ATTTAAATTGGAATTCAAGGTCAGAGACTGGTTGAAGGATG (SEQ ID NO. 6).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

R-delE3 (delE3-4R) primer sequence:

R-delE3 F, GAATTCCAATTTAAATAGCAGTCTGGCGATACCAAGG (SEQ ID NO. 7);

R-delE3 R, GTTTAAACGGGCCCTCTAGACATTCTTGGTGGTGACAGGGTC (SEQ ID NO. 8).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

The shuttle plasmid pVax-delE3(L+R) which knocked out the E3 gene was obtained by ligating the homologous recombinase to pVax vector.

2. Construction of pAd4ΔE3 plasmid.

After pVax-delE3(L+R) was linearized with SpeI and XbaI, it was co-transformed with EcoRI partially digested and linearized pAd4 to transform BJ5183 competent cells (Stratagene); after screening for ampicillin resistance, the plasmid was manually extracted, Further transform XL-Blue competent cells (Beijing Sibaihui Biotechnology Co., Ltd.); manually extract the plasmid to obtain the pAd4ΔE3 plasmid. The technical process is shown in Figure 2 and the restriction map is shown in Figure 6. A SwaI restriction site was introduced into the pro-E3 region of the adenovirus genome in the resulting pAd4ΔE3 plasmid to facilitate subsequent cloning.

3. Knockout of E1 gene and construction of pAd4ΔE1ΔE3 plasmid

1. Construction of E1 gene knockout shuttle plasmid pVax-delE3 (L+R)

Using Ad4 genome as a template for PCR amplification, recombination arms L-delE1 and R-delE1 were obtained.

L-delE1 (or L-delK) primer sequence:

L-delE1 F, CCAGATATACGCGTGTATACCATCATCAATAATATACCTTATAGATGG (SEQ ID NO.9);

L-delE1 R, GATATCAAGTTAATTAAAATCGAAACCTCCACGTAAAC (SEQ ID NO. 10).

PCR program: 95°C, 30 seconds; 50°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

R-delE1 (or R-delK) primer sequence:

R-delE1 F, TTAATTAACTTGATATCGTGTGGATGTGACGGAGGAC (SEQ ID NO.11);

R-delE1 R, GCCCAGTAGAAGCGCCGGTGCGGGATTATTAGTGGAACTTGAG (SEQ ID NO. 12).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

Homologous recombinase was used to connect to the pVax vector (Invitrogen) to obtain the shuttle plasmid pVax-delE1(L+R) which knocked out the E1 gene.

2. Construction of pAd4ΔE1ΔE3 plasmid.

After pVax-delE1(L+R) was linearized with BstZ17I+SgrAI double enzyme digestion, it was co-transformed with pAd4ΔE3 linearized by PsiI to transform BJ5183 competent cells (Stratagene); after screening for ampicillin resistance, the plasmid was manually extracted, and further Transform XL-Blue competent cells (Beijing Sibaihui Biotechnology Co., Ltd.); manually extract the plasmid to obtain the pAd4ΔE1ΔE3 plasmid. The technical process is shown in Figure 3, and the restriction map is shown in Figure 6. A PacI restriction site was introduced into the pro-E1 region of the adenovirus genome in the resulting pAd4ΔE1ΔE3 plasmid to facilitate subsequent cloning.

4. Modification of Ad4 E4 gene and construction of pAd4ΔE1ΔE3 (Orf2-6) plasmid

1. Modification of Ad4 E4 gene. Construction of shuttle plasmid pGK143-(L+R).

Using Ad4 genome as a template for PCR amplification, recombination arms 4E4L and 4E4R were obtained.

4E4L primer sequence:

4E4R F, CATTGATTATTGACTAGAGTATACCATGCTGGCGCGGCTGACCTAGCT (SEQ ID NO.13);

4E4R R, CGGATCCGCTGTGATTCCAACCACCGAGGACAGCCCTC (SEQ ID NO.14).

PCR program: 95°C, 30 seconds; 60°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

4E4R primer sequence:

4E4R F, CGGATCCGTCCAGCATGGTTAGTGTTTTTGGTGATCTGTAGAAC (SEQ ID NO. 15);

4E4R R, TAGAAGCGCCGGTGGGTAAGCTATGGACGCTGAG (SEQ ID NO. 16).

PCR program: 95°C, 30 seconds; 60°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

Using homologous recombinase to connect to pVax vector (Invitrogen), the shuttle plasmid pGK143-(L+R) modified with Ad4 E4 gene was obtained.

2. Transformation of Ad4 E4 gene. Construction of shuttle plasmid pGK143-Orf2-6.

The Ad5 genome was used as a template for PCR amplification to obtain Orf2-6 of the Ad5 adenovirus E4 gene.

Orf2-6 primer sequence:

Orf2-6 F, TCCTCGGTGGTTGGAATCACAGCTACATGGGGGTAGAGTCATAATCG (SEQ ID NO.17);

Orf2-6 R, CCAAAAACACTAACCATGCTGGAATGCAGAAACCCGCAGACATGTTTGAG (SEQ ID NO.18).

PCR program: 95°C, 30 seconds; 65°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

Homologous recombinase was used to connect to the pGK143-(L+R) vector linearized by BamHI to obtain the shuttle plasmid pGK143-Orf2-6 modified by the Ad4 E4 gene.

3. The construction of pAd4ΔE1ΔE3 (Orf2-6) plasmid.

After pGK143-Orf2-6 was linearized with BstZ17I+SgrAI double enzyme digestion, it was co-transformed with SwaI linearized pAd4ΔE1ΔE3 to transform BJ5183 competent cells (Stratagene); after screening for ampicillin resistance, the plasmid was manually extracted and further transformed into XL- Blue Competent Cells (Beijing Sibaihui Biotechnology Co., Ltd.); the plasmid was manually extracted to obtain the pAd4ΔE1ΔE3 (Orf2-6) plasmid. The technical process is shown in Figure 4, and the restriction map is shown in Figure 6.

5. Construction of shuttle plasmid carrying foreign gene and pAd4ΔE1ΔE3(Orf2-6)-EGFP plasmid

1. Construction of the shuttle plasmid pGK3-EGFP carrying the expression cassette of foreign genes.

1.1 Using the Ad4 genome as a template PCR amplification obtains the homologous recombination arms 4SE1L and 4SE1R in the E1 region:

SE1L primer sequence:

4SE1L Fw, CCAGATATACGCGTGTATACCATCATCAATAATATACCTTATAGATGG (SEQ ID NO.19);

4SE1R Rw, GATATCAAGTTAATTAAAATCGAAACCTCCACGTAAAC (SEQ ID NO. 20).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 20 seconds; 25 cycles.

4SE1R primer sequence:

4SE1R Fw, TTAATTAACTTGATATCGTGTGGATGTGACGGAGGAC (SEQ ID NO.21);

4SE1R Rw, GCCCAGTAGAAGCGCCGGTGCGGGATTATTAGTGGAACTTGAG (SEQ ID NO. 22).

PCR program: 95°C, 30 seconds; 55°C, 30 seconds; 72°C, 1 minute, 30 seconds; 25 cycles.

1.2 Construction of the shuttle plasmid pGK41-(L+R) carrying the recombination arm.

The homologous recombination arms 4SE1L and 4SE1R of the E1 region were connected to the pVax vector by using the homologous recombinase (Vazyme) ligation to obtain the shuttle plasmid pGK41-(L+R) carrying the recombination arms.

1.3 Construction of the shuttle plasmid pGK41-EGFP carrying the foreign gene expression cassette.

Using pGA1-EGFP as a template, PCR with the following primers to obtain the CMV-EGFP-BGH expression box.

Primer sequence:

CMV, GTCACATCCACACGATACTAGTTATTAATAGTAATCAATTACGGG (SEQ ID NO.23);

BGH, TTTTAATTAACTTGATCCTGCTATTGTCTTCCCAATC (SEQ ID NO. 24).

PCR program: 95°C, 30 seconds; 66°C, 30 seconds; 72°C, 30s; 25 cycles.

Homologous recombinase (Vazyme) was used to connect the CMV-EGFP-BGH expression cassette to the pGK41-(L+R) vector to obtain the shuttle plasmid pGK41-EGFP carrying the recombination arm.

2. Construction of the genomic plasmid pAd4ΔE1ΔE3(Orf2-6)-EGFP.

pGK41-EGFP plasmid was cut with BstZ17I+SgrAI and recovered by ethanol precipitation; pAd4ΔE1ΔE3 (Orf2-6) was linearized with PacI and recovered by ethanol precipitation; co-transformed with BJ5183, homologous recombination yielded pAd4ΔE1ΔE3 (Orf2-6) carrying the foreign gene expression cassette -EGFP plasmid, the technical process is shown in Figure 5. Refer to Figure 6 for the results of double restriction digestion.

6. Rescue and production of replication-defective Ad4 vector

According to the conventional method, pAd4ΔE1ΔE3(Orf2-6) and pAd4ΔE1ΔE3(Orf2-6)-EGFP were linearized with AsiSI, recovered by ethanol precipitation, and transfected with cationic liposome transfection method into 293 cells. 8 hours after transfection, 2 ml Incubate in DMEM medium with 5% fetal bovine serum for 7-10 days to observe the cytopathic changes; after the virus has emerged, collect the cells and culture supernatant, freeze and thaw them in a 37-degree water bath and liquid nitrogen three times and centrifuge to remove cell debris. The supernatant was infected with a 10 cm dish; after 2-3 days, the cells and the culture supernatant were collected, freeze-thaw three times and centrifuged to remove cell debris, and the supernatant was infected with 3-5 15 cm dishes; after 2-3 days, the cells were collected and repeated Freeze and thaw three times and centrifuge to remove cell debris; after the supernatant infects 30 15 cm dishes for 2-3 days, collect the cells, freeze and thaw three times and centrifuge to remove cell debris; add the supernatant to a cesium chloride density gradient centrifuge tube; 4 ℃, 40,000 revolutions, centrifugation for 4 hours; aspirate the virus bands, desalinate, and aliquot; determine the virus particle titer by OD260 absorbance, the calculation formula is: virus concentration = OD260 × dilution factor × 36/genome length (Kb); virus storage Freeze the solution at -80°C. The results of the production and purification of the replication-defective Ad4 vector are shown in FIG. 7.

7. Determination of replication ability of replication-deficient Ad4 virus in A549 and 293 cells

According to conventional experimental methods, plaque formation experiments were used to identify the growth ability of replication-deficient Ad4 virus in HEK293 helper cells and A549 non-helper cells. After the 293 or A549 cells in the six-well plate grow to 90% full, they are infected with Ad4ΔE1ΔE3(Orf2-6)-EGFP, and the infection titer is 1X10 ⁷ Vp/well. 4 hours after infection, the medium was aspirated, and a 1% agarose gel (containing 1% agarose, 1% BSA, 1×MEM medium) was spread. After being placed in a 37°C incubator for 9-12 days, observe the formation of virus clones under a fluorescence microscope, and take pictures and record. The result is shown in Figure 8. The replication-defective Ad4ΔE1ΔE3(Orf2-6)-EGFP can only form plaques in HEK293 cells, but not in A549 cells. This indicates that the replication-deficient Ad4 vector can effectively proliferate in HEK293 cells with E1 gene complementation, but it has no replication ability in non-helper cells such as A549 cells and has an attenuated phenotype. At the same time, the results also show that the replication-defective human type 4 adenovirus vector can carry the reporter gene into the target cell, so it can be used in the reporter tracer system.

Example 2 Preparation of replication-deficient Ad7 vaccine

1. Circularization of Ad7 genome

1. Construction of the shuttle plasmid pT-Ad7(L+R) that circularizes the Ad7 genome.

Using the Ad7 genome as a template, the left arm (L-Ad7) and the right arm (R-Ad7) of the Ad7 genome were obtained by PCR.

L-Ad7 primer:

L-Ad7-F: ACTGCGATCGCCTCTCTATTTAATATACCTTATAGATGG (SEQ ID NO.25);

L-Ad7-R: ACATGGATCCTCACTGAAGATAATCTCCTGTGG (SEQ ID NO. 26).

PCR conditions: 95°C, 3min; 95°C, 30s; 56°C for 30s; 72°C, 40s; cycles 30; 72°C, 5min; 12°C storage.

R-Ad7 primer:

R-Ad7-F: AGCTGGATCCGAACCACCAGTAATATCATCAAAG (SEQ ID NO.27);

R-Ad7-R: TGAGCGATCGCCTCTCTATATAATATACCTTATAGATGGAA (SEQ ID NO. 28).

PCR conditions: 95°C, 3min; 95°C, 30s; 56°C, 30s; 72°C, 1min; cycles 30; 72°C, 5min; 12°C storage.

The PCR product and the T vector were ligated with three fragments using Exnase recombinase to obtain pT-Ad7(L+R).

2. Construction of pAd7.

pT-Ad7(L+R) was digested and linearized with BamHI, and then co-transformed with Ad7 genome into BJ5183 competent cells for recombination, and the ampicillin resistance plate was used for resistance screening, and the selected single clones were amplified and extracted The plasmid was transformed into XL-Blue chemically competent cells, and the plasmid was extracted to obtain pAd7, which was identified by different enzyme digestion methods. pAd7 introduced two AsisI digestion sites on both sides of the genome to facilitate subsequent linearization of the modified Ad7 genome Rescue the virus. The specific construction process is shown in Figure 9.

2. Knockout of E3 gene and construction of pAd7ΔE3 plasmid

1. Construction of the shuttle plasmid pVax-ΔE3(L+R) for knockout of E3 gene.

Construction of E3 gene knockout shuttle plasmid pVax-ΔE3(L+R). Using the Ad7 genome as a template, the left arm (L-ΔE3) and the right arm (R-ΔE3) of the E3 gene were obtained by PCR.

L-ΔE3 primer:

L-ΔE3-F: CATACTAGTCTGTCTACTTCAACCCCTTCTCCG (SEQ ID NO.29);

L-ΔE3-R: GCAGAATTCATTTAAATGGAGGAAGGGTCTGGGTCTTCTG (SEQ ID NO. 30).

PCR conditions: 95°C, 3min; 95°C, 30s; 63°C 30s; 72°C, 30s; cycles 30; 72°C, 5min; 12°C storage.

R-ΔE3 primer:

R-ΔE3-F: GCAGATATCATTTAAATAGACCCTATGCGGCCTAAGAGAC (SEQ ID NO.31);

R-ΔE3-R: ACATCTAGAGACAGTTGGCTCTGGTGGGGT (SEQ ID NO.32).

PCR conditions: 95°C, 3min; 95°C, 30s; 61°C 30s; 72°C, 40s; cycles 30; 72°C, 5min; 12°C storage.

After L-ΔE3 was digested with SpeI+EcoRI, it was ligated to the pVax vector digested with the same restriction to obtain pVax-L-ΔE3. R-ΔE3 was digested with EcoRV+XbaI and connected to the pVax-L-ΔE3 backbone of the same digestion to obtain pVax-ΔE3(L+R).

2. Construction of pAd7ΔE3 plasmid.

pVax-ΔE3(L+R) was linearized with SpeI+XbaI, pAd7 was linearized with EcoRI, recovered by ethanol precipitation, and then co-transformed into BJ5183 competent cells, spread to ampicillin resistant plates, hand-extracted plasmids, and continued to transform XL-Blue Competent cells were hand-extracted and the plasmids were digested for identification. The genomic plasmid pAd7ΔE3 with the E3 gene knocked out and the only single restriction site SwaI introduced in the E3 region was obtained. The insertion of the SwaI restriction site facilitates linearization in the E3 gene region. The schematic diagram of the construction of the shuttle plasmid and pAd7ΔE3 plasmid and the restriction enzyme digestion results of the large plasmid are shown in Figure 10.

3. Knockout of E1 gene and construction of pAd7ΔE1ΔE3 plasmid

1. Construction of the shuttle plasmid pT-Ad7ΔE1(L+R) with knockout of E1 gene.

Construction of E1 gene knockout shuttle plasmid pT-Ad7ΔE1(L+R). Using the Ad7 genome as a template, the left arm (L-ΔE1) and the right arm (R-ΔE1) of the E1 gene were obtained by PCR.

L-ΔE1 primer:

L-ΔE1-F: ACTCACCGGCGGCGATCGCCTCTCTATTTAATATACCTTATAGATGG (SEQ ID NO.33);

L-ΔE1-R: ATCACAATTGAATTCGTTTAAACGTAATCGAAACCTCCACGTAA (SEQ ID NO.34).

PCR conditions: 95°C, 3min; 95°C, 30s; 54°C for 30s; 72°C, 30s; cycles 30; 72°C, 5min; 12°C storage.

R-SE1 primer:

R-SE1-F: ATAGAATTC ACTAGTGAGGCCCGATCATTTGGTGCT (SEQ ID NO.35);

R-SE1-R: ACGTATAC CTATCATTATGGATGAGTGCATGG (SEQ ID NO. 36).

PCR conditions: 95°C, 3min; 95°C, 30s; 61°C 30s; 72°C, 1min 10s; cycles 30; 72°C, 5min; 12°C storage.

The PCR product and the T vector were ligated with three fragments using Exnase recombinase to obtain pT-Ad7(L+R).

2. Construction of pAd7ΔE1ΔE3 plasmid.

pT-Ad7-ΔE1(L+R) was linearized with Bstz17I, pAd7 was linearized with AatII, and recovered by ethanol precipitation method to co-transform BJ5183 competent cells, spread to ampicillin resistant plate, hand-extract the plasmid, and continue to transform XL-Blue Competent cells were hand-extracted and the plasmids were digested for identification. Knock out the E1 gene and introduce a genomic plasmid pAd7ΔE1ΔE3 with a single restriction site PmeI in the E1 region. The insertion of the PmeI restriction site facilitates linearization in the E1 gene region. The construction diagram of the shuttle plasmid and pAd7ΔE1ΔE3 plasmid and the restriction enzyme digestion results of the large plasmid are shown in Figure 11.

Fourth, construct the plasmid pAd7ΔE1ΔE3 (Orf2-6) that integrates the Ad5 E4 Orf2-6 sequence

1. Construct the shuttle plasmid p7SE4 of the E4 gene region. The left arm (L-SE4) and the right arm (R-SE4) of the E4 gene region were obtained by PCR using the Ad7 genome as a template.

Amplification of Ad7 L-SE4 primer sequence:

L-SE4-F: CGCGGATCTTCCAGAGATGTTTAAACAACCAGTTACTCCTAGAACAGTCAGC (SEQ ID NO.37);

L-SE4-R: ACGCGTATGGATTTAAAT CGATGCAGGCGAGAGTCTATTC (SEQ ID NO.38).

PCR conditions: 95℃, 3min; 95℃, 30s; 60℃ 30s; 72℃, 45s; cycles 30; 72℃, 5min;

Amplification of Ad7 R-SE4 primer sequence:

R-SE4-F:ATTTAAATCCATACGCGTGGAGTTCTTATTAAGTGCGGATGG(SEQ ID NO.39)

R-SE4-R: GCCTGCCGTTCGACGATGTTTAAAC CAGCTGGCACGACAGGTTTC (SEQ ID NO.40)

PCR conditions: 95℃, 3min; 95℃, 30s; 60℃30s; 72℃, 30s; cycles 30; 72℃, 5min;

The L-SE4 and R-SE4 fragments obtained by PCR and the blunt-ended T vector were ligated with three fragments to obtain p7SE4.

2. Construction of the shuttle plasmid p7SE4 (Orf2-6) carrying the E4 gene region of the Ad5 E4 Orf2-6 sequence. Using Ad5 genome as a template, the Orf2-6 of Ad5 E4 was obtained by PCR.

Ad5 Orf2-6-F: TCACAGTCCAACTGCT CCTACATGGGGGTAGAGTCATAATCG (SEQ ID NO.41);

Ad5 Orf2-6-R: GCGCGGTAACCTATTG CATGCAGAAACCCGCAGACATG (SEQ ID NO. 42).

PCR conditions: 95℃, 3min; 95℃, 30s; 65℃30s; 72℃, 2min; cycles 30; 72℃, 5min;

Use p7SE4 as template PCR to obtain its backbone sequence

p7SE4-F: CAATAGGTTACCGCGCTGCG (SEQ ID NO.43);

P7SE4-R: AGCAGTTGGACTGTGAAAGCGC (SEQ ID NO.44).

PCR conditions: 95℃, 3min; 95℃, 30s; 60℃30s; 72℃, 6min; cycles 30; 72℃, 6min;

The fragments obtained by the above PCR were double-fragmented with Exnase enzyme to obtain p7SE4 (Orf2-6);

3. Construction of plasmid pAd7ΔE1ΔE3 (Orf2-6).

p7SE4 (Orf2-6) uses PmeI for restriction digestion and linearization, pAd7ΔE1ΔE3 uses SwaI for restriction digestion and linearization. The above two digestion products are recovered by ethanol precipitation, and the BJ5183 competent cells are co-transformed for recombination, and the ampicillin plate is resistant. Screening, after screening the monoclonal amplification, the plasmid is extracted and transformed into XL-Blue competent cells, the plasmid is extracted to obtain pAd7ΔE1ΔE3 (Orf2-6), the plasmid is extracted for identification by restriction enzyme digestion, pAd7ΔE1ΔE3 (Orf2-6) specific construction process and large plasmid See Figure 12 for the identification results.

5. Construction of the shuttle plasmid of the E1 gene region carrying the foreign gene and the plasmid pAd7ΔE1ΔE3(Orf2-6)-EGFP.

1. Construction of the shuttle plasmid pGK71-EGFP carrying the E1 gene region of the foreign gene expression cassette.

1) The left arm SE1L and the right arm SE1R of the E1 gene region shuttle plasmid were obtained by PCR using the Ad7 genome as a template.

Amplification of SE1L:

SE1L-F: CCAGATATACGCGTGTATACTTAATTAACGGCATCAGAGCAGATTGTACTG (SEQ ID NO.45);

SE1L-R: GTTTAAACAAGATTTAAATGTAATCGAAACCTCCACGTAAACG (SEQ ID NO. 46).

SE1R amplification:

SE1R-F: ATTTAAATCTTGTTTAAACGAATTCACTAGTGAGGCCCGATC (SEQ ID NO.47);

SE1R-R: GCCCAGTAGAAGCGCCGGTGTTAATTAACAAGTAGCTTGTCCTCAGCCAGG (SEQ ID NO. 48).

2) Construct the shuttle plasmid pSE1LR carrying the recombination arm of the E1 gene region.

The plasmid pVax was digested with Bstz17I+SgraI to recover the plasmid backbone, and then SE1L was obtained with the above PCR, and SE1R was ligated with three fragments using Exnase enzyme to obtain pSE1LR.

3) Construct the shuttle plasmid pGK71-EGFP carrying the EGFP expression cassette.

Using the pGA1-EGFP plasmid stored in the laboratory as a template, the expression cassette of CMV-EGFP-BGH was obtained by PCR amplification.

The primer sequence for amplifying CMV-EGFP-BGH:

CMV-EGFP-BGH-F: ACTAGTGAATTCGTTTACTAGTTATTAATAGTAATCAATTACGGG (SEQ ID NO.49);

CMV-EGFP-BGH-R:CATTTAAATCTTGTTTCCTGCTATTGTCTTCCCAATC (SEQ ID NO.50);

PCR conditions: 95℃, 3min; 95℃, 30s; 60℃30s; 72℃2min; cycles 30; 72℃, 5min;

pSE1LR was linearized by PmeI digestion, and then ligated with the CMV-EGFP-BGH expression box obtained by PCR amplification with Exnase enzyme to obtain pGK71-EGFP.

2. Construct the adenovirus recombinant plasmid pAd7ΔE1ΔE3(Orf2-6)-EGFP into which the foreign gene EGFP is inserted.

pGK71-EGFP is linearized with PacI, pAd7ΔE1ΔE3 (Orf2-6) is linearized with PmeI digestion, the above two digestion products are recovered by ethanol precipitation, and the BJ5183 competent cells are co-transformed for recombination, and the ampicillin plate is resistant Screening, after screening the monoclonal amplification, the plasmid is extracted and transformed into XL-Blue competent cells, the plasmid is extracted to obtain pAd7ΔE1ΔE3(Orf2-6)-EGFP, and the plasmid is extracted and identified by restriction enzyme digestion. The specific construction of pAd7ΔE1ΔE3(Orf2-6)-EGFP Refer to Figure 13 for the process and the identification results of large plasmids.

6. Rescue and production of replication defective Ad7 vector

According to the conventional method, pAd7ΔE1ΔE3(Orf2-6) and pAd7ΔE1ΔE3(Orf2-6)-EGFP were linearized with AsiSI, recovered by ethanol precipitation, and transfected into 293 cells by cationic liposome transfection method, 4-6 hours after transfection, added 2 ml of DMEM medium containing 5% fetal bovine serum, incubate for 7-10 days, observe the cell pathology; after the virus is found, collect the cells and culture supernatant, freeze and thaw them in a 37°C water bath and liquid nitrogen three times and remove them by centrifugation Cell debris, the supernatant infects 10 cm dishes; 2-3 days later, collect cells and culture supernatant, freeze-thaw three times and centrifuge to remove cell debris, supernatants infect 10-15 15 cm dishes; 2-3 days later, collect Cells were repeatedly frozen and thawed three times and centrifuged to remove cell debris. The supernatant was added to a cesium chloride density gradient centrifuge tube; 4°C, 35,000 rpm, centrifuged for 4 hours; virus bands were aspirated, desalted, and aliquoted; virus was determined by OD260 absorbance The particle titer, the calculation formula is: virus concentration=OD260×dilution factor×36/genome length (Kb); virus stock solution is frozen at -80°C. The results of the production and purification of the replication-defective Ad7 vector are shown in Figure 14.

7. Determination of replication ability of replication-deficient Ad7 in 293 and A549 cells

The plaque experiment was used to determine the replication ability of the replication-deficient Ad7 vector in the helper cell 293 and the non-helper cell A549. Inoculate 293 or A549 cells in a 6-well cell plate. When the cell density approaches 100%, dilute the harvested P1 generation Ad7ΔE1ΔE3(Orf2-6)-EGFP virus stock solution and infect 293 or A549 cells respectively, each virus Do two repetitions for the concentration. After the virus infects the cells for 2 hours, aspirate the medium, and spread about 2ml agarose gel on each well (containing 1ml 1.4% agarose, 1ml 1×MEM medium, 200ul BSA, 1× penicillin antibiotic). Cultivate for about 9-12 days, use a fluorescence microscope to observe the green fluorescence expression carried by the virus, and look for the formation of virus clones, take pictures and record. The results are shown in Figure 15, Ad14ΔE1ΔE3(Orf2-6)-EGFP deleted both the E1 and E3 genes, and could only form viral plaques in the helper cell 293, but could not form viral plaques in normal human A549 cells. The above results indicate that the replication-deficient Ad7 vector can replicate in helper cells 293, but cannot replicate in human normal cells such as A549 cells, and has an attenuated phenotype. In addition, the replication-deficient Ad7 vector can express the reporter gene carried in the infected cells and be used in the biological tracing system.

Example 3 Preparation of Ad4 and Ad7 bivalent vaccine

1. Vaccine preservation

The replication-defective Ad4 and Ad7 vaccines purified by cesium chloride density gradient force centrifugation were carried out until the concentration of Ad4 was 4×10 ¹¹ vp/ml and the concentration of Ad7 was 4×10 ¹¹ vp/ml, and stored at -80°C.

2. Evaluation of the immunogenicity of Ad4 and Ad7 bivalent vaccines in rhesus monkeys

The immunogenicity evaluation protocol of Ad4 and Ad7 tetravalent vaccines in rhesus monkeys was designed. As shown in Table 1, the immunogenicity of Ad4 and Ad7 bivalent vaccines was evaluated according to the designed immunization protocol. Ad4 and Ad7 bivalent vaccines (Ad4: 2×10 ¹⁰ vp/ml, Ad7: 2×10 ¹⁰ vp/ml).

Table 1

Select adult rhesus monkeys and divide them into 2 groups with 4 in each group. Intramuscular injection (arm) was used for immunization, the first group was immunometer Ad4 and Ad7 bivalent vaccine (experimental group), and the second group was injected with vaccine preservation solution (control group). On the 28th day after immunization, blood was collected from vein to separate serum, and anti-Ad4 and Ad7 neutralizing antibodies were determined. At the same time, boost the immunization on the 35th day according to the above scheme; on the 49th day (both 2 weeks of booster immunization), blood was taken intravenously and the serum was separated to determine the neutralizing antibodies against Ad4 and Ad7; in addition, we used the serum two weeks after the booster for Ad3 , Ad11, Ad14 cross-neutralizing antibody level determination. The results are shown in Figure 16, the experimental group can produce Ad4 and Ad7 specific neutralizing antibodies after the initial immunization, and the Ad4 and Ad7 specific neutralizing antibody titers are significantly increased after the boost. In addition, we tested the cross-protection of the bivalent vaccine against Ad3, Ad11, and Ad14, and found that there were higher titers of neutralizing antibodies against Ad3, Ad11 and Ad14 in some rhesus monkeys two weeks after the booster immunization (as shown in Figure 17) It proved that the Ad4 and Ad7 bivalent vaccine has a certain cross-protection effect on Ad3, Ad11 and Ad14. The neutralizing antibodies of Ad3, Ad4, Ad7 and Ad55 in the serum of rhesus monkeys in the MOCK control group were negative. We separated the whole blood of rhesus monkeys after two weeks of primary immunization and booster immunization, and isolated rhesus monkey peripheral blood mononuclear cells (PBMC) for ELISPOT analysis. The results are shown in Figure 18. Ad4 and Ad7 after primary immunization and booster immunization can effectively stimulate the macaque body Produce a strong specific cellular immune response.

Claims (10)

1. A composition comprising replication-deficient human type 4 adenovirus and type 7 adenovirus.
2. The composition according to claim 1, wherein the E1 and E3 genes of the replication-deficient human type 4 adenovirus are deleted, and part of the coding frame of the E4 gene is replaced with the corresponding coding frame of the human type 5 adenovirus E4 gene.
3. The composition according to claim 1, wherein the E1 and E3 genes of the replication-deficient human adenovirus type 7 are deleted, and part of the coding frame of the E4 gene is replaced with the corresponding coding frame of the human type 5 adenovirus E4 gene.
4. The composition according to claim 2, wherein the coding frame of the E4 gene comprises Orf2, Orf3, Orf4 and Orf6 coding frames.
5. The composition according to claim 3, wherein the coding frame of the E4 gene comprises Orf2, Orf3, Orf4 and Orf6 coding frames.
6. The composition according to claim 1, wherein at least one E1 gene region of the replication-defective adenovirus integrates an expression cassette of a foreign gene.
7. The composition according to claim 6, wherein the exogenous gene expression cassette contains tracking molecules or regulating gene function or therapeutic molecules that can induce immune response in the human body or generate biological reporter molecules or used for detection. The nucleotide sequence.
8. The composition according to claims 1-7, wherein the mixing ratio of the number of virus particles of the replication-defective human type 4 adenovirus and the replication-defective human type 7 adenovirus is between 1:10 and 10:1. between.
9. The use of any composition of claims 1-8 in the preparation of vaccines, detection reagents, preparations for regulating gene function, or therapeutic drugs.
10. The composition of any one of claims 1-9 further comprises a pharmaceutically acceptable adjuvant, carrier, diluent or excipient.

Images