WO2023151172A1

WO2023151172A1 - Adenovirus vector vaccine for preventing sars-cov-2 omicron strain

Info

Publication number: WO2023151172A1
Application number: PCT/CN2022/085800
Authority: WO
Inventors: 陈凌; 杨臣臣; 汪乾; 关素华
Original assignee: 广州恩宝生物医药科技有限公司
Priority date: 2022-02-09
Filing date: 2022-04-08
Publication date: 2023-08-17
Also published as: CN114150005B; CN114150005A

Abstract

The present invention provides an adenovirus vector vaccine for preventing a SARS-CoV-2 Omicron strain. According to the present invention, a new S gene sequence is obtained by means of optimization by using codon usage bias. The new S gene sequence can be efficiently expressed in human cells. An immunized organism can efficiently express an S antigen and generate neutralizing antibodies targeting the SARS-CoV-2 Omicron strain, which effectively protect the organism from Omicron strain infection.

Description

Adenoviral Vector Vaccines for Prevention of SARS-CoV-2 Omicron Strain

technical field

The invention relates to the technical field of biomedicine, in particular to an adenovirus vector vaccine used to prevent the SARS-CoV-2 Omicron strain.

Background technique

In the face of the new crown pneumonia epidemic, prevention and blocking the spread of the virus are the key to controlling the epidemic. Vaccines are the most cost-effective interventions to prevent and control 2019-nCoV infection. In the virus particle structure of SARS-CoV-2 coronavirus, the S-protein that makes up the "crown" is an obvious target and has become the focus of most research teams. A research team has successfully revealed the relationship between the S protein and its receptor ACE2 in the process of invading cells through computer simulation of the three-dimensional structure of the S protein. Therefore, the S protein plays an important role in mediating the binding of virions to host cell receptors and in inducing neutralizing antibodies. According to research reports, the S protein has a pre-fusion conformation and a post-fusion conformation. The S protein binds to the ACEII receptor of the host cell and is cleaved by the furin of the host cell to divide the protein into S1 and S2, which promotes the fusion of the viral envelope with the host. Cell membrane fusion realizes the infection and invasion of viruses, and the antibodies produced after fusion are mostly binding antibodies, which have no neutralizing effect. Therefore, how to maintain the S protein in the pre-fusion conformation in vaccine development and design is the key to the success of vaccine development.

According to the report of the World Health Organization, there is a latest mutant strain (Omicron strain), which has greatly enhanced its pathogenicity and transmission ability. Moreover, the S gene of the Omicron mutant strain has at least 27 mutations. The existing vaccines have very poor immune protection effect on the Omicron mutant strain, and it is very easy to escape the neutralizing effect of the existing vaccine neutralizing antibody. It greatly weakens the immune protection effect of the current vaccine and tends to replace the Delta mutant strain. The vaccines currently on the market are inactivated vaccines, subunit protein vaccines, mRNA vaccines and adenovirus vector vaccines. These vaccines are mainly aimed at the original strain of SARS-CoV-2, and their protective effects against the mutant strain of Omicron are all reduced. All of them cannot produce a very ideal immune effect on the Omicron strain after immunization. In addition, the expression level of the natural spike protein S gene of SARS-CoV-2 is very low in human kidney cell HEK293, so if the original S codon of the SARS-CoV-2 Omicron strain is used as an antigen, its SARS -The original S gene sequence protein of the CoV-2 Omicron strain cannot be effectively and efficiently expressed in cells, and its vaccine may be ineffective or the potency is very low, which is not enough to resist virus infection.

Contents of the invention

The object of the present invention is to provide a kind of optimized S protein nucleotide sequence and novel vaccine thereof, adopt the S gene of the Omicron strain (Omicron) of carrier codon optimization, can express S antigen efficiently after immunization body, produce The neutralizing antibody against the Omicron strain of SARS-CoV-2 can effectively protect the body from the infection of the Omicron strain.

The technical scheme that the present invention takes is:

A first aspect of the present invention provides a vaccine comprising:

a) the nucleic acid sequence shown in SEQ ID NO: 2; or

b) a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to SEQ ID NO:2.

In some examples, the vaccine is used to prevent or treat infection caused by SARS-CoV-2. In some examples, the vaccine is used to prevent or treat infection caused by a mutant strain of SARS-CoV-2 omecroron. In some examples, the vaccine is used to prevent or treat SARS-CoV-2 original strain, SARS-CoV-2 Delta mutant strain, SARS-CoV-2 Alpha mutant strain, SARS-CoV-2 Beta mutant strain, SARS-CoV-2 Infection caused by one or more of the CoV-2 Gamma mutant strains.

In some examples, the nucleic acid sequence is used to express a protein that is immunogenic to SARS-CoV-2. In some examples, the nucleic acid sequence is used to express a protein that is immunogenic to a mutant strain of SARS-CoV-2 omecroron. In some examples, the nucleic acid sequence is used to express the original strain of SARS-CoV-2, SARS-CoV-2 Delta mutant strain, SARS-CoV-2 Alpha mutant strain, SARS-CoV-2 Beta mutant strain, SARS-CoV-2 One or more immunogenic proteins in CoV-2 Gamma mutants.

In some examples, the nucleic acid sequences are used to express proteins in humans or in cells of human origin.

In some examples, the protein can be in the human body:

induce an immune response; and/or

produce biological reporter molecules; and/or

produce molecules for detection; and/or

Modulates gene function; and/or

become therapeutic molecules.

The induced immune response includes antibody and cell-mediated immune response.

In some examples, the vector of the vaccine is a DNA plasmid, an RNA expression plasmid or a viral vector.

In some examples, the vaccine is an adenovirus vector vaccine. In some examples, the vaccine includes an adenovirus vector loaded with a nucleic acid sequence shown in SEQ ID NO: 2 or a homologous sequence thereof. In some examples, the adenovirus vector is Ad1 vector, Ad2 vector, Ad3 vector, Ad4 vector, Ad5 vector, Ad6 vector, Ad7 vector, Ad8 vector, Ad9 vector, Ad10 vector, Ad11 vector, Ad12 vector, Ad13 vector, Ad14 vector, Ad15 vector, Ad16 vector, Ad17 vector, Ad18 vector, Ad19 vector, Ad20 vector, Ad21 vector, Ad22 vector, Ad23 vector, Ad24 vector, Ad25 vector, Ad26 vector, Ad27 vector, Ad28 vector, Ad29 vector, Ad30 vector , Ad31 vector, Ad32 vector, Ad33 vector, Ad34 vector, Ad35 vector, Ad36 vector, Ad37 vector, Ad38 vector, Ad39 vector, Ad40 vector, Ad41 vector, Ad42 vector, Ad43 vector, Ad44 vector, Ad45 vector, Ad46 vector, Ad47 At least one of vectors, Ad48 vectors, Ad49 vectors, Ad50 vectors, Ad51 vectors, or Ad52 vectors. In some examples, the vector is an empty vector. In some examples, the adenoviral vector is a replication defective vector. In some examples, the replication-defective vector is a replication-defective adenovirus vector with genes in the E1 and E3 regions deleted. In some examples, the vaccine comprises an Ad5 vector loaded with a nucleic acid sequence shown in SEQ ID NO: 2 or a homologous sequence thereof. In some examples, the vector is an Ad5 empty vector. In some examples, the adenoviral vector is a replication-defective Ad5 vector. In some examples, the replication-deficient Ad5 vector is a replication-deficient Ad5 vector with genes in E1 and E3 regions deleted. In some examples, the vaccine comprises an Ad35 vector loaded with a nucleic acid sequence shown in SEQ ID NO: 2 or a homologous sequence thereof. In some examples, the vector is an Ad35 empty vector. In some examples, the adenoviral vector is a replication-defective Ad35 vector. In some examples, the replication-defective Ad35 vector is a replication-defective Ad35 vector with genes in E1 and E3 regions deleted.

In some instances, the vaccine further includes at least one of a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient. At least one of suitable adjuvants, carriers, diluents or excipients can be selected according to specific needs.

In some examples, the dosage form of the adenovirus vector vaccine includes but not limited to common vaccine dosage forms such as oral dosage, injection, and aerosol inhalation.

In some instances, the adenovirus vector vaccine can also be used in combination with other drugs. In some instances, the vaccine further includes at least one drug that has prophylactic and/or therapeutic effects on COVID-19.

In order to further improve the purity and safety of the product, in some examples, the vector (such as Ad5 vector, Ad35 vector and other adenoviral vectors) can regulate the expression of the nucleic acid sequence.

In order to ensure more efficient expression of the nucleic acid sequence shown in SEQ ID NO: 2 or its homologous sequence, in some examples, the transcription direction of the nucleic acid sequence shown in SEQ ID NO: 2 or its homologous sequence is the same as that of the vector (such as Ad5 vectors, Ad35 vectors and other adenoviral vectors) the direction of transcription of other genes is opposite.

A second aspect of the present invention provides an expression vector, which contains the nucleic acid sequence described in the first aspect of the present invention (the nucleic acid sequence shown in SEQ ID NO: 2 or its homologous sequence).

In some examples, the vector can regulate the expression of the nucleic acid sequence of the first aspect of the present invention. In some examples, the transcription direction of the nucleic acid sequence described in the first aspect of the present invention is opposite to that of other genes of the vector. It can further ensure that the expressed protein has higher purity and safety.

In some examples, the vector is a DNA plasmid, RNA expression plasmid or viral vector.

In some examples, the viral vector is an adenoviral vector. In some examples, the adenoviral vector is at least one of the aforementioned Ad1-Ad52 vectors. In some examples, the vector is an empty vector. In some examples, the adenoviral vector is a replication-defective adenoviral vector. In some examples, the replication-deficient adenoviral vector is a replication-deficient adenoviral vector with genes in E1 and E3 regions deleted. In some examples, the adenoviral vector is an Ad5 vector. In some examples, the vector is an Ad5 empty vector. In some examples, the adenoviral vector is a replication-defective Ad5 vector. In some examples, the replication-deficient Ad5 vector is a replication-deficient Ad5 vector with genes in E1 and E3 regions deleted. In some examples, the adenoviral vector is an Ad35 vector. In some examples, the vector is an Ad35 empty vector. In some examples, the adenoviral vector is a replication-defective Ad35 vector. In some examples, the replication-defective Ad35 vector is a replication-defective Ad35 vector with genes in E1 and E3 regions deleted.

The third aspect of the present invention provides: the application of the vaccine described in the first aspect of the present invention or the expression vector described in the second aspect of the present invention, the application comprising:

A medicament for preventing or treating infection caused by SARS-CoV-2 is prepared.

Prepare COVID-19 testing reagents; or

Preparation of modulators of gene function.

In some examples, the infection is an infection caused by a mutant strain of SARS-CoV-2 omecroron.

In some examples, the infection is a SARS-CoV-2 original strain, a SARS-CoV-2 Delta mutant, a SARS-CoV-2 Alpha mutant, a SARS-CoV-2 Beta mutant, a SARS-CoV-2 Gamma Infection induced by one or more of the mutant strains.

The fourth aspect of the present invention provides a method for preventing or treating infection caused by SARS-CoV-2 strains, comprising administering a prophylactically effective amount or a therapeutically effective amount of the first aspect of the present invention to a subject in need. vaccine.

According to the foregoing aspects of the present invention, in some examples, the amino acid sequence of the spike protein (Spike protein, S) of the original strain of SARS-CoV-2 of the present invention is shown in NCBI accession number YP_009724390.1. In some examples, the whole genome sequence of the original strain of SARS-CoV-2 in the present invention is shown in NCBI accession number NC_045512.2.

The beneficial effects of the present invention are:

1) The original S gene sequence protein of the SARS-CoV-2 Omicron strain cannot be efficiently expressed in cells. We optimized the codon bias to obtain a new S gene sequence, which can be efficiently expressed in human cells. Expression, S antigen can be highly expressed after immunization.

2) After the optimized sequence is expressed in the human body or human-derived cells, it can induce a higher titer of neutralizing antibodies against the Omicron strain of SARS-CoV-2, which can effectively protect the body from Omicron It can also induce specific antibodies against the original strain of SARS-CoV-2 and other types of mutant strains, exerting multiple protective effects.

Description of drawings

In order to illustrate the technical solutions in the embodiments of the present application more clearly, the drawings that need to be used in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application. For Those skilled in the art can also obtain other drawings based on these drawings without going beyond the protection scope of the present application.

Figure 1 shows the expression results of S protein after transfection of equal amounts of pGA1-S-Ori, PGA1-S50, PGA261-S50 and PGA351-S50 respectively.

Figure 2 is a flowchart of the construction of pAd5-S50.

Fig. 3 is a virus purification diagram of pAd5-S50.

Figure 4 is a flowchart of the construction of pAd35-S50.

Fig. 5 is a virus purification diagram of pAd35-S50.

Fig. 6 is a graph showing the expression of S protein after infecting A549 cells with pAd5-S50 and Ad35-S50. 1 is the blank control of A549 cells, 2 is the Ad35-S50 sample, 3 is the Ad5-S50 sample, 4 is the S protein positive control, and M is the Marker.

Figure 7 is the serum binding antibody level of Ad5-S50 immunized mice against the new coronavirus Omicron strain.

Figure 8 is the serum binding antibody level of Ad5-S50 immunized mice against the original strain of the new coronavirus.

Figure 9 shows the serum binding antibody levels of Ad5-S50 immunized mice against the new coronavirus Delta strain.

Fig. 10 is the serum neutralizing antibody level of Ad5-S50 immunized mice.

Figure 11 is the serum binding antibody level of Ad35-S50 immunized mice against the new coronavirus Omicron strain.

Figure 12 is the serum binding antibody level of Ad35-S50 immunized mice against the original strain of the new coronavirus.

Figure 13 is the serum binding antibody level of Ad35-S50 immunized mice against the new coronavirus Delta strain.

Fig. 14 is the serum neutralizing antibody level of Ad35-S50 immunized mice.

Detailed ways

The following will clearly and completely describe the technical solutions in the embodiments of the present application with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of them. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without making creative efforts belong to the scope of protection of this application.

It should be noted that, in the case of no conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with examples.

The nucleic acid sequence of the Spike protein (S) of SARS-CoV-2 is shown in GISAID: EPI_ISL_6640916, named as SEQ ID NO: 1. The pre-mRNA transcribed by eukaryotic cells can produce different mRNA splicing isoforms through different splicing methods (selecting different combinations of splicing sites), which ultimately leads to different proteins produced by the same gene sequence. This is very detrimental to protein expression. The inventor optimized the codon of the wild-type natural nucleic acid sequence and removed potential variable splicing sites based on his own technology, which ensured the uniqueness of protein expression and reduced the occurrence of erroneous splicing of protein expression. The optimized nucleic acid sequence is recorded as SEQ ID NO: 2 (hereinafter the vector is named S50).

The present invention will be described in further detail below in conjunction with specific examples, and these examples should not be construed as limiting the scope of protection claimed in this application.

Example 1 Analysis of Spike gene codon optimization effect

1. Construction of the shuttle plasmid pGA1-S50 of the S gene of the Omicron mutant strain

Using pcDNA3.1-S50 (synthesized by Nanjing GenScript Biotechnology Co., Ltd., S50 is SEQ ID NO: 2) plasmid as template, S50-F and S50-R as primers, using Primer Star Mix (TaKaRa) PCR The target fragment S50 was amplified.

S50 amplification primer sequence:

S50-F: gtaccgagctcggatccgccaccatgttcgtgttcctggtcctactgcc (SEQ ID NO: 3);

S50-R: agaatagggccctctagactagtttatcaggtgtagtgcagcttt (SEQ ID NO: 4).

PCR program: 98°C for 3min; 98°C for 10s, 60°C for 5s, 72°C for 30s, 28 cycles; 72°C for 5min, store at 4°C.

Using the PGA1-EGFP plasmid (preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template and CMV-R and BGH-F as primers, the target fragment PGA1 was amplified by PCR with Primer Star Mix (TaKaRa).

pGA1 Backbone Amplification Primer Sequence:

CMV-R: ggatccgagctcggtaccaagcttaagtttaaacgctagagtccgg (SEQ ID NO: 5);

BGH-F: tctagagggccctattctatagtgtc (SEQ ID NO: 6).

The target fragment S50 and the vector backbone pGA1 were recombined using a homologous recombinase (Vazyme) to obtain the shuttle plasmid pGA1-S50 carrying the S gene of the omecro mutant strain.

2. Construction of the shuttle plasmid pGA261-S50 of the S gene of the Omicron mutant strain

Using pcDNA3.1-S50 (synthesized by Nanjing GenScript Biotechnology Co., Ltd., S50 is SEQ ID NO: 2) plasmid as a template, S50-F (SEQ ID NO: 3) and S50-R (SEQ ID NO: 3) : 4) as primers, using Primer Star Mix (TaKaRa) PCR amplification to obtain the target fragment S50.

Using the PGA261-EGFP plasmid (preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6) as primers, Primer Star Mix ( TaKaRa) PCR amplification to obtain the target fragment PGA261.

The target fragment S50 and the vector backbone pGA261 were recombined using a homologous recombinase (Vazyme) to obtain a shuttle plasmid pGA261-S50 carrying the S gene of the Omicron mutant strain.

3. Construction of the shuttle plasmid pGA351-S50 of the S gene of the Omicron mutant strain

Using the PGA351-EGFP plasmid (carrying the homologous recombination arm plasmid in the Ad35E1 region, preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6 ) as primers, the target fragment PGA351 was amplified by PCR with Primer Star Mix (TaKaRa).

The target fragment S50 and the vector backbone pGA351 were recombined using a homologous recombinase (Vazyme) to obtain a shuttle plasmid pGA351-S50 carrying the S gene of the Omicron mutant strain.

4. Construction of the shuttle plasmid pGA1-S-Ori of the original S gene of the Omicron mutant strain

Using pcDNA3.1-S-Ori (purchased from Nanjing GenScript Biotechnology Co., Ltd., loaded with S-Ori, ie, SEQ ID NO: 1) plasmid as template, SOri-F and SOri-R as primers, using Primer Star The target fragment S-Ori was amplified by Mix(TaKaRa) PCR.

S-Ori amplification primer sequence:

SOri-F: gtaccgagctcggatccgccaccatgtttgtttttcttgtttttgccact (SEQ ID NO: 7);

SOri-R: tagaatagggccctctagactagtttattatgtgtaatgtaatttgactcctt (SEQ ID NO: 8).

Using the PGA1-EGFP plasmid (preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6) as primers, Primer Star Mix ( TaKaRa) PCR amplification to obtain the target fragment PGA1.

The target fragment S-Ori and the vector backbone pGA1 were recombined using a homologous recombinase (Vazyme) to obtain the shuttle plasmid pGA1-S-Ori carrying the original S gene of the Omicron mutant strain.

5. Analysis of Spike gene codon optimization effect

According to conventional methods, using cationic liposomes, respectively, 2.5 g of pGA1-S-Ori, PGA1-S50, PGA261-S50 and PGA351-S50 transfection methods prepared in step 1-4 of Example 1 were used to transfect HEK293 cells. After 48 hours of staining, the cells were collected, and the samples were processed according to the conventional WesternBlot method, and protein detection was performed. Referring to Figure 1, it can be seen that the expression of S protein was not detected in the pGA1-S-Ori sample, while the codon-optimized PGA1-S50, PGA261-S50 and

High-efficiency S protein expression can be observed in PGA351-S50 samples, indicating that our optimized S50 sequence has unexpected effects.

Example 2 Construction of the S antigen vector pAd5-S50 carrying the Omicron mutant strain

Using the PGA1-EGFP plasmid (carrying the homologous recombination arm plasmid in the Ad5E1 region, preserved by Guangzhou Enbao Biomedical Technology Co., Ltd.) as a template, CMV-R (SEQ ID NO: 5) and BGH-F (SEQ ID NO: 6 ) as primers, the target fragment PGA1 was amplified by PCR with Primer Star Mix (TaKaRa).

2. Construction of pAd5-S50 carrying the S gene of the Omicron mutant strain

Using the pGA1-S50 plasmid as a template, the CMV-S50-BGH target fragment carrying the homologous recombination arm was amplified by PCR, and recovered by gel.

CMV-S50-BGH target fragment amplification primer sequence:

Ad5-SB-F: TTGGATTGAAGCCAATATGATAATGAGGGGGTGG (SEQ ID NO: 9);

Ad5-SB-R: GCATCGGTCGAGGACAGGCCTCTCAAGTCTGTATAC (SEQ ID NO: 10).

PCR program: 98°C for 3min; 98°C for 10s, 60°C for 5s, 72°C for 50s, 28 cycles; 72°C for 5min, use the gel recovery kit to recover the target fragment, and store at 4°C.

pAd5ΔE1ΔE3 was linearized with ClaI and recovered by ethanol precipitation; the CMV-S50-BGH target fragment carrying the homologous recombination arm and the linearized PAd5ΔE1ΔE3 were co-transformed into BJ5183, and the pAd5-S50 plasmid carrying the S50 gene was obtained by homologous recombination. The technical process is shown in the figure 2 shown.

3. Rescue and production of Ad5-S50 vector

1) According to conventional methods, Ad5-S50 was linearized with PacI, recovered by ethanol precipitation, and cationic liposome transfection method was used to transfect 293 cells; 2) 4 hours after transfection, 2 ml of DMEM containing 5% fetal bovine serum was added to culture 3) After detoxification, collect cells and culture supernatant, freeze and thaw 3 times in 37-degree water bath and liquid nitrogen, and centrifuge to remove cell debris, supernatant infects 10 cm dish ;4) After 2-3 days, collect cells and culture supernatant, freeze-thaw repeatedly 3 times and centrifuge to remove cell debris, supernatant infects 3-5 15 cm dishes; 5) After 2-3 days, collect cells, freeze-thaw repeatedly 3 times and centrifuged to remove cell debris; 6) After the supernatant infected 30 15 cm dishes for 2-3 days, collect the cells, freeze and thaw 3 times and centrifuge to remove cell debris; 7) Add the supernatant to a cesium chloride density gradient centrifuge tube ; 4°C, 40000 rpm, centrifuged for 4 hours; sucked out the virus band, desalted, subpackaged; 8) measure the titer of virus particles with OD260 absorbance, the calculation formula is: virus concentration=OD260×dilution factor×36/genome length (Kb ); the virus stock solution was frozen at -80°C. Virus purification is shown in Figure 3.

Example 3 Construction of the S antigen vector pAd35-S50 carrying the Omicron mutant strain

1. Construction of the shuttle plasmid pGA351-S50 of the S gene of the Omicron mutant strain

2. Construction of pAd35-S50 carrying the S gene of the mutant strain of Omicron

Using the pGA351-S50 plasmid as a template, the CMV-S50-BGH target fragment carrying the homologous recombination arm was amplified by PCR, and recovered by gel.

CMV-S50-BGH target fragment amplification primer sequence:

Ad35-SB-F: agaattggatccgaattcgcggccgcgcgatcgccatcatcaataatatacctt (SEQ ID NO: 11);

Ad35-SB-R: gcgtcgcagatccgaattcgtatacccatccaagctgcacgataa (SEQ ID NO: 12).

pAd35ΔE1ΔE3 was linearized with PmeI and recovered by ethanol precipitation; the CMV-S50-BGH target fragment carrying the homologous recombination arm and the linearized PAd35ΔE1ΔE3 (5E4) were co-transformed into BJ5183, and the pAd35-S50 plasmid carrying the S50 gene was obtained by homologous recombination. The process is shown in Figure 4.

3. Rescue and production of Ad35-S50 vector

1) According to conventional methods, Ad35-S50 was linearized with AsisI, recovered by ethanol precipitation, and transfected into 293 cells by cationic liposome transfection; 2) 4 hours after transfection, 2 ml of DMEM containing 5% fetal bovine serum was added to culture 3) After detoxification, collect cells and culture supernatant, freeze and thaw 3 times in 37-degree water bath and liquid nitrogen, and centrifuge to remove cell debris, supernatant infects 10 cm dish ;4) After 2-3 days, collect cells and culture supernatant, freeze-thaw repeatedly 3 times and centrifuge to remove cell debris, supernatant infects 3-5 15 cm dishes; 5) After 2-3 days, collect cells, freeze-thaw repeatedly 3 times and centrifuged to remove cell debris; 6) After the supernatant infected 30 15 cm dishes for 2-3 days, collect the cells, freeze and thaw 3 times and centrifuge to remove cell debris; 7) Add the supernatant to a cesium chloride density gradient centrifuge tube ; 4°C, 40000 rpm, centrifuged for 4 hours; sucked out the virus band, desalted, subpackaged; 8) measure the titer of virus particles with OD260 absorbance, the calculation formula is: virus concentration=OD260×dilution factor×36/genome length (Kb ); the virus stock solution was frozen at -80°C. The results of virus purification are shown in Figure 5.

Embodiment 4 detects Spike gene expression

A549 cells were infected with Ad5-S50 and Ad35-S50 viruses, and the cells were collected after 24 hours. The samples were processed according to the conventional Western Blot method, and protein detection was performed, and the results are shown in Figure 6. It can be seen that the expression of the S protein of the Omicron mutant strain can be observed in the samples of the vaccine candidate strains Ad5-S50 and Ad35-S50, indicating that the Ad5-S50 and Ad35-S50 vaccine candidate strains are constructed correctly and can successfully express the S antigen protein antigen protein.

Embodiment 5Ad5-S50 animal immunogenicity evaluation

6-8 weeks old Balb/c mice (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were divided into 2 groups, 10 in each group; on the 0th day, the vaccine group (i.e. the sample group) was injected intramuscularly. Example 2 Ad5-S50 dose prepared: 5×10 ⁹ vp/monkey, Ad5-empty dose administered intramuscularly to the control group (ie negative group): 5×10 ⁹ vp/bird; on the 9th day, blood was collected from the orbit and serum was separated.

1. Binding antibody

Enzyme-linked immunosorbent assay (ELISA) was used to detect the antibody level in the serum with the RBD protein of the new coronavirus Omicron mutant strain, original strain, and Delta mutant strain (purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.) as antigens.

The specific operation is:

1) 96-well plate, add 50ng of RBD protein to each well, overnight at 4°C;

2) Aspirate off the supernatant, wash 3 times with PBST, add 200 μl 5% BSA to each well and block at room temperature for 2 h;

3) Wash 3 times with PBST; add mouse serum diluted with PBS at 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, and 1:51200 to each well , incubate at 37°C for 2h;

4) Add enzyme-labeled antibody: add 100 μl diluted HRP-labeled IgG secondary antibody, and incubate at 37°C for 2 hours;

5) Wash with PBST 6-8 times;

6) Add substrate solution for color development: add 100 μl TMB for color development;

7) Stop the reaction: add 50 μl of 1M sulfuric acid to stop the reaction;

8) Judgment of the result: measure the OD value, and control the OD value at 0.1-4;

9) The experimental results are shown in Figure 7, Figure 8 and Figure 9, and Figure 7 shows that Ad5-S50 can induce mice to produce specific binding antibodies against the RBD protein of the Omicron mutant strain; in addition Figure 8 and Figure 9 show Ad5-S50 can also produce specific binding antibodies against the original strain RBD protein and the Delta mutant strain RBD protein.

2. Neutralizing antibodies

The specific operation of the determination of pseudovirus neutralizing antibody is:

1) The serum to be tested was inactivated in a water bath at 56°C for 30 minutes, and centrifuged at 6000g for 3 minutes; the serum was serially diluted 30 times;

2) Dilute Omicron pseudovirus (purchased from Nanjing Novizan Biotechnology Co., Ltd., Cat. No.: DD1768-02) with DMEM serum-free medium to 1.3×10 ⁴ TCID50/ml and mix well with the above-mentioned diluted serum Mix well, and place in a cell culture incubator (37°C, 5% CO ₂ ) to incubate for 1 hour;

3) Add the incubated serum to the ACEII cells in a 96-well plate, put them in a cell culture incubator, and incubate for 72 hours at 37° C. and 5% CO ₂ ;

4) After culturing for 72 hours, take out the 96-well plate from the cell culture incubator, use a multichannel pipette to discard 100 μl of supernatant from each sample well, then add 100 μl of luciferase detection reagent, and react at room temperature for 2 minutes in the dark;

5) Calculation of neutralization inhibition rate: inhibition rate = [1-(mean value of luminous intensity of sample group - mean value of luminous intensity of blank control)/(mean value of luminous intensity of negative group - mean value of luminous intensity of blank control value)] × 100%; blank The control refers to the background value of 96-well cells; the negative group refers to the Ad5-empty immune group;

6) According to the result of neutralization inhibition rate, use Reed-Muench method to calculate IC50.

The results are shown in Figure 10: the vaccine can stimulate the mice to produce a higher titer of specific neutralizing antibodies against the new coronavirus of the Omicron strain.

Embodiment 6 Ad35-S50 animal immunogenicity evaluation

6-8 week-old Balb/c mice (Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were divided into 2 groups, 5 in each group; on the 0th day, the vaccine group (i.e. the sample group) was intramuscularly injected with immunization Example 3 Preparation Ad35-S50 dose: 5×10 ⁹ vp/monkey, Ad35-empty dose: 5×10 ⁹ vp/bird for intramuscular injection in the control group (ie negative group); on the 14th day, blood was collected from the orbit and serum was separated.

1. Binding antibody

Enzyme-linked immunosorbent assay (ELISA) was used to detect the antibody level in serum using the RBD protein of the new coronavirus Omicron mutant strain, the original strain, and the Delta mutant strain (purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.) as antigens.

The specific operation of ELISA binding antibody assay is as follows:

1) 96-well plate, add 50ng of RBD protein to each well, overnight at 4°C;

3) Wash 3 times with PBST; add mouse serum diluted with PBS at 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600 and 1:51200 to each well , incubate at 37°C for 2h;

5) Wash with PBST 6-8 times;

7) Stop the reaction: add 50 μl of 1M sulfuric acid to stop the reaction;

9) The experimental results are shown in Figure 11, Figure 12 and Figure 13, and Figure 11 shows that Ad35-S50 can induce mice to produce specific binding antibodies against the RBD protein of the Omicron mutant strain. Figure 12 and Figure 13 show that Ad35-S50 can also produce specific binding antibodies against the RBD protein of the original strain and the RBD protein of the Delta mutant strain.

2. Neutralizing antibodies

5) Calculation of neutralization inhibition rate: inhibition rate = [1-(mean value of luminous intensity of sample group - mean value of luminous intensity of blank control)/(mean value of luminous intensity of negative group - mean value of luminous intensity of blank control value)] × 100%; blank The control refers to the background value of 96-well cells; the negative group refers to the Ad35-empty immune group;

The results are shown in Figure 14: the vaccine can stimulate the mice to produce a higher titer of specific neutralizing antibodies against the new coronavirus of the Omicron strain.

The above is a detailed introduction to the embodiments of the present application. In this paper, specific examples are used to illustrate the principles and implementation methods of the present application. The descriptions of the above embodiments are only used to help understand the methods and core ideas of the present application. At the same time, changes or deformations made by those skilled in the art based on the ideas of the application, specific implementation methods and application scopes of the application all belong to the scope of protection of the application. To sum up, the contents of this specification should not be understood as limiting the application.

Claims

A vaccine comprising:

a) the nucleic acid sequence shown in SEQ ID NO: 2; or

b) a nucleic acid sequence having at least 90% sequence homology to SEQ ID NO:2.
The vaccine according to claim 1, characterized in that, the nucleic acid sequence can express proteins in human cells or in the human body; the protein can be in the human body:

induce an immune response; and/or

produce biological reporter molecules; and/or

produce molecules for detection; and/or

Modulates gene function; and/or

become therapeutic molecules.
The vaccine according to claim 1, characterized in that: the vaccine is an adenovirus vector vaccine.
The vaccine according to claim 3, comprising an Ad5 vector loaded with the nucleic acid sequence of claim 1 or 2, or an Ad35 vector loaded with the nucleic acid sequence of claim 1 or 2.
The vaccine according to any one of claims 1-4, further comprising at least one of a pharmaceutically acceptable adjuvant, carrier, diluent or excipient.
The vaccine according to any one of claims 1-4, characterized in that: it also includes at least one drug that has preventive and/or therapeutic effects on COVID-19.
An expression vector, characterized in that the expression vector contains the nucleic acid sequence according to claim 1 or 2.
The expression vector according to claim 7, characterized in that: the vector is a DNA plasmid, an RNA expression plasmid or a viral vector.
The expression vector according to claim 7 or 8, characterized in that: the vector can regulate the expression of the nucleic acid sequence.
The application of the vaccine according to any one of claims 1-6 or the expression vector according to any one of claims 7-9, said application comprising:

Preparation of medicaments for the prevention and/or treatment of infections caused by SARS-CoV-2;

Preparation of testing reagents for COVID-19; and/or

Preparation of modulators of gene function.