CN111549001A

CN111549001A - Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

Info

Publication number: CN111549001A
Application number: CN202010466093.2A
Authority: CN
Inventors: 陈平; 李娜; 王暄; 张婷婷; 杨文清; 李娅芳; 张利娟
Original assignee: Jia Ming Guan Biotechnology Co ltd
Current assignee: Jia Ming Guan Biotechnology Co ltd
Priority date: 2020-05-28
Filing date: 2020-05-28
Publication date: 2020-08-18
Anticipated expiration: 2040-05-28
Also published as: CN111549001B

Abstract

The invention discloses a hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, the monoclonal antibody and application thereof, wherein the preservation number of the hybridoma cell strain is CCTCC NO: C202042, and the preparation method of the hybridoma cell strain comprises the following steps: 1) expressing to obtain African swine fever virus p34 protein; 2) immunizing animals to obtain immune spleen cells; 3) cell fusion and screening of positive hybridoma cell strains; 4) screening a positive hybridoma cell strain secreting a monoclonal antibody; wherein, the p34 protein prepared by the expression of CHO-S cells, SF9 insect cells and HEK293 cells transfected by recombinant adenovirus vectors is respectively adopted to screen positive hybridoma cell strains. The p34 antigen protein is prepared by adopting a mammalian cell CHO expression system, so that the folding and glycosylation of the protein are closer to those of the natural protein; and the antigen prepared by the three expression systems is used for screening hybridoma cell strains, so that the obtained hybridoma cell strains can stably secrete monoclonal antibodies and have stronger specificity.

Description

Hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

Technical Field

The invention belongs to the field of genetic engineering and recombinant vaccines, and particularly relates to a hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, the monoclonal antibody and application.

Background

African Swine Fever (ASF) is a highly contagious Swine viral disease that can lead to nearly 100% mortality in domestic pigs. ASF is caused by ASF Virus (ASFV), which is a large double-stranded DNA Virus, mainly replicates in the cytoplasm of macrophages, has a structure of a positive 20-sided body, a diameter of about 175-215 nm, a genome of 170-190 kb in total length, contains 151 open reading frames, can code 150-200 proteins, and is a double-stranded linear DNA Virus with an envelope. The structural proteins constituting the virus particle include proteins P72, P54, pp62, P220, etc., wherein pp62 and pp220 are two polyprotein precursors of ASFV, and are respectively encoded by CP530R and CP2475L genes. The pp62 protein is a virus replication late protein, and is processed by protease after translation to generate two structural proteins, P35 and P15. The pp220 protein is a membrane-bound protein of cytosol, and the major components P150, P37, P34 and P14 proteins of the virus particles are generated after protease processing, all of the structural proteins exist in the nucleocapsid of the mature virus particles, account for about 30 percent of the total protein component of ASFV, play an important role in the assembly process of the nucleocapsid and play an important role in the packaging of the virus nucleoprotein. P34 has good immunogenicity, and can be used as antigen for vaccine development. To date, due to the complexity of the AFSV genome and the diversity of the structure of the african swine fever protein, a very effective african swine fever virus vaccine has not been developed yet, and the development and research of a non-swine fever virus vaccine method are lacking.

Serological tests are the most commonly used diagnostic test for ASF because of their simple operation, relatively low cost and no need for specialized equipment, but because there is no commercial vaccine against ASF, this means that the presence of anti-ASFV antibodies indicates infection, and furthermore, anti-ASFV antibodies appear 7-10 days after infection and last for months to years, but domestic and wild pigs infected with virulent strains usually die before a specific antibody immune response occurs, serological tests are crucial for determining recovery and asymptomatic infected animals in well-defined areas of ASFV infection when attenuated and low-virulent virus circulates.

Disclosure of Invention

Based on the defects of the prior art, the invention aims to provide a hybridoma cell strain and a monoclonal antibody for secreting the African swine fever virus p34 protein monoclonal antibody, so as to lay a foundation for the detection of the African swine fever virus.

As a first aspect of the application, the application provides a hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody.

Preferably, the preservation number of the hybridoma cell strain is CCTCC NO: C202042.

As a second aspect of the application, the application provides a preparation method of a hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody.

Preferably, the preparation method comprises the following steps:

1) expressing to obtain African swine fever virus p34 protein;

2) immunizing animals to obtain immune spleen cells;

taking African swine fever virus p34 protein as an antigen, immunizing a BALB/c mouse, and obtaining immune spleen cells;

3) cell fusion and screening of positive hybridoma cell strains;

1 × 10⁸Mixing the immune spleen cells with 1 × 10⁷Fusing myeloma cells, carrying out ELISA detection on cell culture supernatant after fusing for 10-14 days, and screening to obtain positive hybridoma cell strains;

4) screening of positive hybridoma cell strains secreting monoclonal antibodies:

screening the positive hybridoma cell strain obtained in the step 3) by taking the African swine fever virus p34 protein as an antigen to obtain a hybridoma cell strain which stably secretes the monoclonal antibody, carrying out subcloning, identifying the hybridoma cell strain as IgG1 by subtype, and taking the positive subclone to establish a strain and store the positive subclone to obtain the hybridoma cell strain which secretes the African swine fever virus p34 protein monoclonal antibody.

Preferably, in the step 4), the positive hybridoma cell strain is screened by using the p34 protein of the african swine fever virus expressed by CHO-S cells, the p34 protein of the african swine fever virus expressed by SF9 insect cells and the p34 protein of the african swine fever virus expressed by HEK293 cells transfected by a recombinant adenovirus vector, and the monoclonal antibody generated by the screened hybridoma cell strain can be simultaneously recognized by the p34 antigen of the african swine fever virus expressed by CHO-S cells, SF9 insect cells and the HEK293 cells transfected by the recombinant adenovirus vector.

Preferably, the preparation method of the African swine fever virus p34 protein expressed and prepared by CHO-S cells comprises the steps of connecting a gene sequence for expressing the African swine fever virus p34 protein to pSecTag-2B to obtain an expression vector pSecTag-2B-p34, transfecting the CHO-S cells by using the expression vector pSecTag-2B-p34, inducing expression and purifying to obtain the African swine fever virus p34 protein;

the preparation method of the African swine fever virus p34 protein expressed and prepared by SF9 insect cells comprises the following steps: connecting a gene sequence for expressing the African swine fever virus p34 protein to a shuttle plasmid pFastBac of Bacmid to obtain an expression vector pFastBac-p34, transforming pFastBac-p34 into the expression vector pFastBac-p34 by using a competent cell DH10 Bacmid of Bacmid, extracting a virus genome which is Bacmid-p34, transfecting the Bacmid-p34 to an SF9 cell, performing induced expression and purifying to obtain the African swine fever virus p34 protein;

the preparation method of the African swine fever virus p34 protein prepared by transfecting HEK293 cells with the recombinant adenovirus vector comprises the following steps: and (3) inoculating the recombinant adenovirus vector pAd5-p34 into HEK293 cells, and performing induced expression and purification to obtain the African swine fever virus p34 protein.

As a third aspect of the present application, the present application provides a monoclonal antibody against protein p34 of African swine fever virus.

Preferably, the monoclonal antibody is secreted by a hybridoma cell strain with the preservation number of CCTCC NO: C202042.

As a fourth aspect of the application, the application provides the application of the African swine fever virus p34 protein monoclonal antibody in the third aspect in detecting the African swine fever virus.

As a fifth aspect of the application, the application provides the application of the African swine fever virus p34 protein monoclonal antibody of the third aspect in the preparation of an immunoassay tool for detecting the African swine fever virus.

Preferably, the immunoassay means is a reagent, a kit, a test strip or a biochip.

As a fifth aspect of the present application, there is provided a kit for detecting the presence and/or level of a filbert virus in a sample.

Preferably, the kit comprises the African swine fever virus p34 protein monoclonal antibody of the third aspect.

Preferably, the kit also comprises an African swine fever virus cell culture or African swine fever virus p34 protein-coated ELISA plate, an HPR-labeled goat anti-mouse secondary antibody, a washing solution, a blocking solution, an antibody diluent, a developing solution and a stop solution.

The beneficial effect of this application:

1) the p34 antigen protein is prepared by adopting a mammalian cell CHO expression system, so that the folding and glycosylation of the protein are closer to those of the natural protein;

2) the method screens hybridoma cell strains capable of secreting monoclonal antibodies through antigens prepared by three expression systems, and the obtained hybridoma cell strains can stably secrete anti-African swine fever virus p34 protein monoclonal antibodies, so that the prepared monoclonal antibodies have stronger specificity and can be more suitably used for various detection works;

3) the monoclonal antibody can be applied to detection of p34 protein packaged by adenovirus, fills up the blank of domestic detection kits due to no sale of p34 antibody in the market, and can be better applied to detection of antigens packaged by mammalian cells.

Drawings

FIG. 1 is an electrophoretogram of p34 protein amplification;

FIG. 2 is an agarose map showing the results of electrophoresis of the cleavage products, lane 1 shows the recovery products of the p34 fragment, and

lanes

2 and 3 show the cleavage products of the vector;

FIG. 3 is a diagram showing the results of PCR verification of a colony of a recombinant vector pSecTag-2B-p34, wherein the restriction enzyme digestion verification was performed by selecting the vectors corresponding to

lanes

17, 20, 21 and 22;

FIG. 4 is a diagram showing the results of digestion of the vectors corresponding to

lanes

17, 20, 21 and 22 in FIG. 3;

FIG. 5 is a schematic diagram of Ni column purification;

FIG. 6 shows SDS-PAGE results of gradient imidazole elution;

FIG. 7 shows the quantitative determination of BSA after ultrafiltration concentration of p 34;

FIG. 8 is a graph showing the results of an experiment in which a monoclonal antibody immunoreactive with adenovirus-packaged p34 protein;

FIG. 9 is a graph showing the amplification result of a p34 gene fragment according to an example of the present invention;

FIG. 10 is a vector map of recombinant shuttle plasmid pS5E1-p34 according to an embodiment of the present invention;

FIG. 11 is a diagram showing the XhoI cleavage result of the recombinant adenovirus vector pAd5-p34 according to the embodiment of the present invention;

FIG. 12 is a vector map of recombinant adenovirus vector pAd5-p34 according to an embodiment of the present invention.

FIG. 13A is a drawing of the results of agarose gel electrophoresis of a CMV-MCS fragment and a SV40 earlyployA fragment, M being 2000Marker, 1 being a CMV-MCS fragment, 2 being an SV 40-earlyployA fragment; FIG. 13B is a diagram showing the results of agarose gel electrophoresis of CMV-MCS-SV40 earlyploA fusion fragment, PUC fragment, Ad5 right arm and Ad5 left arm, M being 2000Marker, 1 being CMV-MCS-SV40 earlyploA fusion fragment, 2 being PUC, 3 being Ad5 right arm, 4 being Ad5 left arm; FIG. 13C is a diagram showing the results of agarose gel electrophoresis of the left arm of CMV-MCS-SV40 polyA and Ad5 amplified by colony PCR; FIG. 13D is a single-restriction validation result of shuttle plasmid pS5E 1.

The hybridoma cell strain is preserved in China Center for type culture Collection (CCTCC for short), and the preservation addresses are as follows: eight Wuhan university No. 299 in Wuhan district, Wuhan city, Hubei province, the preservation date is: 16 days 1 month in 2020, the preservation number is CCTCC NO: C202042, and the classification names are: AYP 34-83.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. It should be understood that the illustrated embodiments are exemplary only, and are not intended to limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

In the present invention, unless otherwise specified, the methods used in the examples are techniques commonly used in the art, and all the equipment, raw materials and the like are products commonly used in the industry and are commercially available.

Example 1 preparation of p34 antigen

First, construction of pSecTag-2B-p34 vector

1. Primer synthesis

p34-HindIII-F cccAAGCTTATGGGGAATCGCGGGTCTTCTA(SEQ ID No.1)

p34-Tb-NotI-R atttGCGGCCGCGCTGCCGCGCGGCACCAGGCCCTTTTT

GGCGCAGCTGTT(SEQ ID No.2)

2. PCR amplification of p34 gene fragment

And (3) PCR reaction system: q5 Mix 25 μ L, Primer F & R2 μ L, Template 0.5 μ L (artificial synthesis), water supplement to 50 μ L; reaction conditions are as follows: x 35 cycles at 98 ℃ for 10s (98 ℃ for 10s, 60 ℃ for 30s, 72 ℃ for 1min), 4min at 72 ℃, 4 ℃ and infinity; as a result of amplification, an amplified band was generated at 1100bp, as shown in FIG. 1.

3. Single cleavage of the target fragment and vector

An enzyme digestion reaction system: 3 μ g each of the vector and the target fragment, NotI 1 μ L; 10 Xcutmarstat buffer 5. mu.L; adding water to 50 mu L; among them, the pSecTag 2B vector was purchased from Invitrogen corporation.

Reaction conditions are as follows: 1h at 37 ℃; inactivating at 65 deg.C for 20 min.

4. Purifying with PCR clean-up kit, enzyme cutting after purification, and recovering enzyme cutting product with kit

An enzyme digestion reaction system: 3 mu g of each of the vector and the target fragment, and 1 mu L of Hind III; 10 Xcutmarstat buffer 5. mu.L; water was added to 50 μ L.

Reaction conditions are as follows: 1h at 37 ℃; inactivating at 65 deg.C for 20 min. The cleavage results are shown in FIG. 2.

5. Ligation vectors and fragments

A connection system: 1. mu.L of pSecTag-2B (100ng) vector; p34(63ng) fragment 0.75 μ L; 1 μ L of T4 DNA ligase; 10 Xligase buffer 1. mu.L; water was added to 10 μ L.

Reaction conditions are as follows: at room temperature, 50 min.

The recombinant vector pSecTag-2B-p34 was transferred into NEB10 beta competent cells, plated with LB solid medium (Amp-resistant) and cultured overnight at 37 ℃.

6. Vector construction validation

And selecting a single colony for PCR and double enzyme digestion verification, sequencing and identifying, wherein the results of PCR verification and enzyme digestion verification of the colony of the pSecTag-2B-p34 recombinant vector are shown in FIGS. 3 and 4, which shows that the vectors corresponding to

lanes

17, 20, 21 and 22 are accurately constructed, and the pSecTag-2B-p34 recombinant vector which is accurately constructed is selected.

Secondly, expressing and purifying p34 protein:

1. electrotransfection

1) Day1, CHO-S cells were prepared according to 5 × 10⁶cells/mL, inoculated into a triangular shake flask;

2) day2, will identify the correct pSecTag-2B-p34 expression vector, according to Celetrix instructions for the operation of transfection plasmid (due to the electric shock cup volume of 200. mu.L maximum capacity, each time need 10. mu.g plasmid and 1 × 10. mu.g plasmid and maximum 1)⁷Culturing in medium of 30 mL/time cell)

The transfection condition is that V1100V T is 30ms P1;

3) and (3) harvesting a sample after 96-120 hours (when the cell viability is reduced to about 80%), taking cell supernatant, carrying out protein level detection, identifying by using Western Blot, and revising a detection operation flow according to SOP-Western Blot (Western Blot).

2. Purification of

Sample treatment:

1. collecting cells with cell viability of about 80%, centrifuging at 4000rpm for 30min, and keeping supernatant;

2. removing cells, and filtering the supernatant with 0.45 μm filter membrane;

3. and (3) purifying by using a Ni column, wherein the schematic diagram of the Ni column purification is shown in FIG. 5, and the Ni column purification process is as follows:

1) opening the purification instrument to be connected with a computer, ensuring that the pipeline connection does not leak liquid, and setting parameters;

2) liquid inlet lines A, B were all placed in ultrapure water, with initial parameter settings: the flow rate is 3mL/min, the component B is 50%, the absorbance of 280mm is started, the rest is closed, and the absorbance value returns to zero; the maximum pressure limit is set to 0.3 MPa; opening A, B the pump for cleaning;

3) when the pump is cleaned A, B, observing that the conductivity and absorbance value tend to zero and are stable, and connecting the column (if the change range of the absorbance value is too large, checking the reason, and checking whether bubbles or other impurities exist in the pipeline;

4) connecting the columns: firstly, opening the upper peak head of the column, removing possible bubbles, enabling the equipment to still operate to discharge liquid (operate at a low flow rate, the flow rate is 1mL/min), connecting the upper end of the column, and quickly opening the lower end socket of the column to discharge liquid; the lower end is connected with equipment, so that air bubbles do not enter the pipeline;

5) column equilibration: rinsing the column with ultrapure water, discharging ethanol protection solution therein at a flow rate of 3mL/min, wherein the volume of the column is at least 3 times, and when the conductivity and the absorption peak value tend to zero and are stable, introducing a sample (50% of component B) balance buffer solution into an A, B pipeline at the same time, wherein the conductivity rises to a stable level, and the absorbance slightly rises (<10) and is kept stable, and then starting to sample;

6) loading: the sample is fed with liquid through the pipeline B in the whole process, the pipeline A is placed in a balanced buffer solution, the flow rate is 1ml/min, the conductivity can be reduced for a section after the sample is stabilized, and the absorbance is rapidly increased to a stable value;

7) washing: after the sample is loaded, the liquid is continuously fed by using the pipeline B, the pipeline B is immersed into the equilibrium buffer solution to wash the column, the conductivity rises to a value during equilibrium after the flow rate is stabilized at 3mL/min, and the absorbance is reduced to be nearly zero (the condition that some background absorbance values are more than 10 can be considered as normal);

8) and (3) elution: after the absorbance is stable, the pipeline B is replaced into an elution buffer solution (the balance buffer solution remained in a pump B can be firstly pumped out by using a syringe to fill the pipeline with the elution buffer solution), the elution is started by 5%, 10%, 20%, 30%, 35%, 40%, 50% and 100% of the component B, the flow rate is 1mL/min, and the elution peaks with peak values are collected in sequence (if the absorbance is rapidly increased, the absorbance range of the display interface can be adjusted to a small range to reduce the volume amount of the collected liquid);

9) flushing a pipeline: after the effluent liquid under each elution peak is collected, the A, B pipeline is placed in pure water, the B component is set to be 50%, the flow rate is 3mL/min, the column is washed by pure water until the absorbance and the conductivity are close to zero and stable, the A, B pipeline is placed in 20% ethanol, and the column is washed until the column is stored, the B component is set to be 50%, the flow rate is 3mL/min, and the volume of about 3 columns is obtained;

10) and (3) disassembling the column: storing the column and disassembling the connection between the column and the equipment, wherein the equipment runs at a low flow rate of 1mL/min when being disassembled, the lower end socket is firstly blocked and screwed down to prevent the lower end socket from leaking liquid, and the upper end socket is quickly disassembled and screwed down;

11) save data, clean up equipment and shut down.

And respectively collecting samples eluted by each gradient, and detecting the protein content by Western blot and SDS-PAGE: and the target protein collected under the elution peak is subjected to ultrafiltration concentration, and is quantified by BSA, so that the concentration of the target protein is determined. The SDS-PAGE results are shown in FIG. 6, which shows that the p34 gene can be correctly expressed in CHO-S cells with good yield, and the BSA quantitative detection results are shown in FIG. 7, which shows that the expressed p34 protein is 55kDa and the total amount of the protein is about 2 mg.

EXAMPLE 2 preparation of hybridoma cells

(I) preparation of immune splenocytes

1. Mice immunized with p34 protein

The African swine fever virus p34 protein prepared in example 1 is used as an antigen to immunize a BALB/c mouse, after the antigen and an equivalent amount of Freund's complete adjuvant are completely emulsified for the first immunization, the mouse is injected into the abdomen subcutaneously, the dose is 100 mu g/mouse, and negative serum is collected for standby before immunization. After 14 days, the second immunization is carried out, the second immunization is injected into mice after the second immunization is mixed and emulsified by using the same dose of antigen and the same amount of Freund incomplete adjuvant, the dose is 50 mu g/mouse, and the second immunization is carried out once every 7 days. After 5 times of immunization, blood is collected from the tail vein of the mouse, serum is separated, and the antibody titer of the serum is detected by ELISA, wherein the antibody titer detection method comprises the following steps:

1) coating p34 antigen 100 μ L/well, overnight at 4 deg.C, with antigen concentration of 2 μ g/mL;

2) the next day, washing with PBST 3 times, blocking with 2% BSA, and standing overnight at 4 deg.C;

3) washing with PBST for 3 times on the third day, drying, diluting the serum by multiple times, adding diluted p34 immune serum, negative mouse serum and PBS, adding 100 μ l, and keeping at 37 deg.C for 45 min;

4) washing with PBST for 3 times, drying, adding 100 μ l goat-anti-mouse (HRP-labeled secondary antibody), and keeping at 37 deg.C for 45 min;

5) washing with PBST for 3 times, drying, adding TMB developing solution 100 μ l, and developing at 37 deg.C for 20 min;

6) adding stop solution (2 MH)₂SO₄) And OD450 values were read. The results of the experiments are shown in the following table:

degree of dilution	1:2000	1:4000	1：8000	1:16000	1:32000	1:64000	1:128000	1:256000	1:512000	PBS
											Mouse
1	3.3091	3.2757	3.2484	3.2542	3.3244	2.8511	1.6995	0.9812	0.5606	0.201
											Mouse 2	3.1974	3.2446	3.4045	3.2521	3.1295	1.9727	1.0324	0.6045	0.3988	0.2911
Mouse 3	3.2101	3.1763	3.2443	2.6272	1.4269	0.7637	0.4855	0.3198	0.2899	0.2001
											Negative mice	0.4318	0.4327	0.2929	0.3063	0.3029	0.2563	0.2844	0.2803	0.2943	0.2523

ELISA results show that the antibody titer of three mice is more than 1:64000, the antibody titer of the mouse 1 is at most 1:512000, and finally spleen cells of the mouse 1 are selected for cell fusion.

2. Immune spleen cell collection

1) Euthanasia was performed on mice by cervical dislocation;

2) placing the whole mouse in 200ml beaker containing 70% ethanol for sterilizing epidermis, fixing on paraffin plate after 5min, and taking spleen aseptically;

3) placing the spleen in a petri dish containing 5mL of RPMI1640+ 10% FBS; the spleen was then transferred to a new petri dish of 1 mlpmrpi 1640+ 10% FBS, trimmed of fat and connective tissue, and then cut into small pieces;

4) using sterile forceps, a forceps was used to hold one spleen while "squeezing" cells from one spleen into the medium;

5) washing with 2-3mL of culture medium for multiple times, and transferring the cells into a 50mL centrifuge tube; using a pipette to suck the cells for several times, and then standing until a larger tissue block falls to the bottom of the tube;

6) collecting the cell suspension, placing the cell suspension in a new 50mL centrifuge tube, and centrifuging at 900-;

7) collecting cell supernatant, and resuspending spleen cells with 20mL of RPMI1640+ 10% fetal bovine serum;

8) counting spleen cells;

3. fusion of immune spleen cells with myeloma cells

1) Take 1 × 10⁸Spleen cells and 1 × 10⁷After mixing the mouse myeloma cells, centrifuging the mixture at 100rpm of 900-;

2) to every 3 × 10⁸1.5mL PEG1500 was slowly added to each cell, and after incubation for 1min at 37 deg.CSlowly adding 20mLRPMI1640, centrifuging, and discarding the supernatant;

3) calculating the total amount of HAT screening culture medium, and resuspending the cells by using the HAT screening culture medium;

4) the cells were then added directly to feeder cells plated 96-well plates for selection culture at 100. mu.L per well.

4. Screening clones

1) After the cells grow in a 96-well plate for 10-14 days, clones can be seen by naked eyes, culture media of partial wells begin to yellow, and supernatants are detected by ELISA;

2) after 3 days, the clones were detected to be positive by ELISA;

3) after the cells grow up, positive clones are picked out by using ELISA method detection, and 25 positive clones are picked out.

4) 25 positive clones were subjected to ELISA screening of three different systems.

EXAMPLE 3 selection of hybridoma cells

And (3) screening hybridoma cells capable of secreting monoclonal antibodies by using antigens prepared by three expression systems, wherein the three antigens are p34 antigen prepared by CHO-S cell expression, p34 antigen prepared by SF9 insect cell expression and p34 antigen prepared by HEK293 cell transfection by recombinant adenovirus vector pAd5-p 34.

The process for preparing the p34 antigen by expressing SF9 insect cells is as follows:

the gene sequence for expressing the African swine fever virus p34 protein is connected to a shuttle plasmid pFastBac of Bacmid to obtain an expression vector pFastBac-p34, a competent cell DH10Bac of Bacmid is used for transforming pFastBac-p34 into the expression vector pFastBac-p34, a virus genome is extracted to be Bacmid-p34, the Bacmid-p34 is transfected into an SF9 cell, induction expression is carried out, and the African swine fever virus p34 protein is obtained after purification. Among them, Bacmid was purchased from Invitrogen corporation, and used for amplification of p34 gene, cleavage of vector, ligation, transfection, and purification of p34 protein in the same manner as in example 1.

The process for preparing p34 antigen by transfecting HEK293 cells with recombinant adenovirus vectors pAd5-p34 is as follows:

inoculating the recombinant adenovirus vector pAd5-p34 into HEK293 cells (T225), sucking the cells in a 50ml centrifuge tube at 1200rpm for 5min after 2-3 days before the lesions are floated, collecting the cells, resuspending the cells with 3-5ml PBS, repeatedly freezing and thawing for 2 times, centrifuging to discard cell debris, taking the supernatant and suspending with a carbonate buffer solution with pH9.6, coating on an ELISA plate, coating antigen 100 mu L/hole, standing overnight at 4 ℃ and keeping the antigen concentration (2 mu g/ml); preparing blank 293 cells as negative control by the same method;

and (3) sealing: the following day the coating solution was discarded, washed 3 times with PBST, blotted clean, and 100. mu.L of 2% BSA (PBS) was added to each well and blocked overnight at 4 ℃.

Incubation of the antibody:

1) on the third day, the blocking solution is discarded, PBST is used for washing for 3 times, and after being patted dry, 100 mu L of hybridoma supernatant per hole is directly loaded;

2) diluting the negative and positive serum with PBS at a ratio of 1:1000, and 100. mu.L/well;

3) incubating at 37 ℃ for 45 min;

4) washed 3 times with PBST, added 100 μ Ι/well diluted goat anti-mouse HRP labeled secondary antibody per well, incubated for 45min at 37 ℃ to develop color:

5) washing with PBST for 3 times, adding TMB color developing solution with each well of 100 μ L/well, and developing for 20 min;

6) then 100. mu.L/well of stop solution per well (2M H)₂SO₄) The OD450 value is read by a rear microplate reader.

The antibodies were further coated, blocked and incubated with p34 antigen prepared by expression in CHO-S cells and p34 antigen prepared by expression in SF9 insect cells, respectively, in a manner similar to that described above, coating 100. mu.L/well of antigen.

The monoclonal antibodies secreted by the hybridoma cells were detected by the following method:

western blotting for hybridoma monoclonal antibody detection:

1. preparing a sample:

for example, the pAd5-p34 diseased virus is inoculated into HEK293 cells, after 2-3 days of disease, the cells are sucked into a centrifuge tube by blowing at 12000rpm for 5min, the cells are collected, 160 mu LPBS is added and mixed uniformly, and the control operation is synchronized with 40 mu L of 5 x protein Loading Buffer, boiling for sample preparation and HEK293 blank cells;

2. western Blot: the detection protocol was revised with reference to SOP-Western Blot (Western Blot).

(II) detecting antibody ascites and partial hybridoma supernatant by using an ELISA method and a Western blotting method simultaneously:

ELISA: the operation is carried out as above;

western blotting: the detection protocol was revised with reference to SOP-Western Blot (Western Blot).

The results of the ELISA experiments are shown in the following table:

three clones (numbers 747, 696 and 411, underlined in the tables) were screened by ELISA and detected by the antigenic proteins expressed by the three systems simultaneously, wherein the 747 clone was selected as the dominant positive clone and subcloned to obtain the subclone with the code 83, which was subtype-identified as IgG1 and named AYP 34-83.

Further, monoclonal antibody ascites preparation is carried out by AYP34-83, Abdominal cavity injection is carried out on AYP34-83 to BALB/c mice, ascites collection and purification are carried out, WB detection is carried out by pAd5-P34 protein packaged by adenovirus, the result is shown in figure 8, and as can be seen from the figure, bands appear at corresponding size positions, which shows that the prepared monoclonal antibody can generate obvious immunoreaction with P34 protein, has better reaction characteristic, and shows that the monoclonal antibody can be applied to detection of P34 protein packaged by adenovirus.

The African swine fever virus p34 protein is successfully induced and expressed, 1 strain of hybridoma capable of secreting the anti-p 34 monoclonal antibody is screened and identified, the hybridoma can secrete the anti-African swine fever virus p34 monoclonal antibody, and the monoclonal antibody has high stability and specificity, can be used for preparing preparations, kits, test paper strips or biochips for detecting the African swine fever virus, and lays a foundation for quickly and conveniently realizing qualitative and quantitative detection of the African swine fever virus.

One embodiment of the recombinant adenovirus vector pAd5-p34 is prepared as follows:

construction of recombinant shuttle plasmid pS5E1-p34

1. According to the sequence of African Swine Fever (ASFV) p34 gene in GenBank, the sequence of p34 gene is shown in SEQ ID No.3, and the synthesis of gene fragment is entrusted to biological company.

ATGGGGAATCGCGGGTCTTCTACCTCCTCTCGCCCCCTGCCCTCCTCCGAAGCCAATATCTATGCCAAGCTGCAGGACCATATCCAGCGCCAGACCCGCCCCTTCTCCGGAGGAGGATACTTTAACGGAGGCGGCGACAAAAACCCCGTGCAGCACATCAAGGACTACCACATCGACAGCGTGAGCTCCAAAGCCAAGCTCAGAATCATCGAAGGAATTATCCGCGCCATCGCCAAGATCGGCTTTAAGGTGGACACAAAACAGCCCATCGAAGACATCCTCAAGGACATCAAGAAACAGCTGCCCGACCCCCGCGCCGGCTCTACCTTTGTGAAGAACGCCGAAAAACAGGAAACCGTCTGCAAGATGATTGCCGACGCCATCAACCAGGAATTCATCGACCTGGGCCAGGACAAGCTGATCGACACCACCGAAGGGGCCGCCTCCATCTGCCGCCAGATCGTCCTCTATATCAATAGCCTGACCCACGGACTGCGGGCCGAATACCTGGACGTGCACGGCAGCATCGAGAACACCCTGGAAAACATCAAACTGCTGAACGACGCCATCAAACAGCTGCACGAACGGATGGTGACCGAAGTGACCAAGGCCGCCCCCAACGAGGAAGTGATTAACGCTGTGACAATGATCGAAGCCGTGTACCGCCGCCTGCTCAACGAGCAGAACCTCCAGATCAACATCCTCACCAACTTCATCGACAACATCCTGACCCCCACCCAGAAAGAACTGGACAAGCTCCAGACCGACGAAGTCGACATCATCAAACTCCTCAACGACACCAACAGCGTCCTCGGCACCAAAAACTTCGGCAAAGTGCTGAGCTACACCCTCTGCAACCTGGGCATCGCCGCCAGCGTCGCCAACAAGATCAACAAGGCCCTCCAGAAAGTGGGACTGAAGGTGGAGCAGTATCTCCAGAGCAAGAACTGGGCCGAATTCGACAAAGAACTCGACCTGAAACGCTTCTCCGGCCTGGTGAGCGCCGAGAACATCGCCGAATTCGAGAAGGCTGTGAACCTGCTGAGGCAGACCTTCAACGAAAGGCACAAGATCCTGGAGAACAGCTGCGCCAAAAAGGGCTACCCCTACGACGTGCCCGACTATGCCTGA(SEQ ID No.3)

2. The upstream and downstream primers of p34 were designed based on the sequence of African Swine Fever (ASFV) p34 gene in GenBank, which was synthesized by Biometrics, and the sequences of the primers are shown below.

p34-BamHI-F:CGCggatccgccaccATGGGGAATCGCGGGTCTTCTAC(SEQ ID No.4)；

p34-EcoRV-R：CGgatatcTCAGGCATAGTCGGGCACGTCGT(SEQ ID No.5)；

The underlined parts of the upstream primer P34-BamHI-F and the downstream primer P34-EcoRV-R are respectively introduced into the restriction sites, wherein the restriction sites are BamHI and EcoRV.

3. The synthesized p34 gene fragment was used as a template, and p34-BamHI-F/p34-EcoRV-R was used as a primer to amplify the p34 gene to obtain a p34 target gene fragment, and the amplification results are shown in FIG. 9.

4. The amplified p34 target gene fragment was purified by Axygen PCR purification kit (see the specification for details).

5. Carrying out double enzyme digestion on the purified product in the step 4 by using restriction enzymes BamHI and EcoRV to obtain a linearized p34 gene fragment; the shuttle plasmid pS5E1 was subjected to double digestion with restriction enzymes BamHI and EcoRV to obtain a pS5E1 vector fragment, the double digestion system was as follows:

p34 Gene fragment or pS5E1 vector (2. mu.g)	4-8μL
		10×Buffer	5μL
BamHI	1μL
		EcoRV	1μL
ddH₂O	Complement
		Total of	50μL

Reaction conditions are as follows: the temperature was 37 ℃ for 30 minutes;

6. and (3) performing gel recovery and purification on the linearized p34 gene fragment obtained in the step (5) and the pS5E1 vector fragment by using an Omega gel recovery and purification kit, and connecting the p34 gene fragment and the purified product of the pS5E1 vector fragment at a ratio of the p34 gene fragment to the pS5E1 vector fragment (molar ratio) of 1: 3, obtaining pS5E1-p34, transforming into competent DH5a (preparation of competence and transformation method are referred to in the third edition of Experimental Manual of molecular cloning, laboratory), plating on Amp resistant plates, and screening positive clones, wherein the connection system is as follows:

target gene p34 fragment	2-5μL
		Vector pS5E1-p34 fragment	2-4μL
10×T4 Buffer	1μL
		T4 ligase	1μL
In total	10μL

Connection conditions are as follows: connecting at normal temperature for 60 minutes;

7. and (3) carrying out colony PCR screening on the positive colonies obtained in the step 6, selecting the screened positive clones to be cultured in 5ml of LB liquid medium (containing Amp resistance) under overnight oscillation, extracting plasmids, carrying out enzyme digestion verification of BamHI and EcoRV, sending the plasmids to a biological company for sequencing after verification is correct, and comparing the sequences with expected gene sequences to show that the recombinant shuttle plasmid pS5E1-p34 is successfully constructed, wherein the vector map of pS5E1-p34 is shown in figure 10.

(II) construction of recombinant adenovirus vector pAd5-p34

1. And (3) carrying out single enzyme digestion on the obtained recombinant shuttle plasmid pS5E1-p34 by using a restriction enzyme PacI to obtain a linearized recombinant shuttle plasmid pS5E1-p34, wherein the single enzyme digestion system is as follows:

recombinant shuttle plasmid pS5E1-p34 (2-3 ug)	10-12μL
		Restriction enzyme PacI	1μL
10×Buffer	4μL
		Distilled water	Complement
Total of	40μL

Reaction conditions are as follows: the temperature was 37 ℃ for 30 minutes; inactivating at 65 ℃ for 20 minutes;

further, the adenovirus backbone vector pAd5 (human adenovirus type 5 vector) was subjected to single digestion with restriction enzyme SwaI to obtain linearized pAd5, which is shown below:

adenovirus backbone vector pAd5(2 ug to 3ug)	10-15ul
		Restriction enzyme SwaI	1ul
10×Buffer3.1	4ul
		Distilled water	Complement
Total of	40μL

Reaction conditions are as follows: the temperature is 25 ℃, 30 minutes; inactivating at 65 ℃ for 20 minutes;

2. the linearized recombinant shuttle plasmid pS5E1-p34 and the adenovirus skeleton vector pAd5 obtained in the step 1) are dephosphorylated respectively, and the dephosphorylation system is shown as follows:

linearized recombinant shuttle plasmid pS5E1-p34 or linearized adenovirus backbone vector pAd5	40μL
		Dephosphorylating enzyme	1μL
Dephosphorylation enzyme Buffer	5μL
		Distilled water	4μL
In total	50μL

Reaction conditions are as follows: the temperature is 37 ℃ for 60 minutes; inactivating at 65 ℃ for 5 minutes;

3. purifying the dephosphorylated product in the step 2) by using a phenol chloroform isoamyl alcohol (PCI) method;

4. co-transforming BJ5813 competent cells (purchased from Bomaide Biotechnology Co., Ltd.) with 100ng of purified recombinant shuttle plasmid pS5E1-p34 and 100ng of purified adenovirus skeleton vector pAd5, coating the transformed product on an LB plate containing Kan, and culturing at 37 ℃ for 12-16 h;

5. selecting a colony with positive PCR identification, and carrying out shake culture at 37 ℃ for 12-16 h in 5mL of LB liquid medium containing Kan;

6. and extracting plasmids, carrying out plasmid PCR identification and single enzyme digestion identification of Pac I and Xho I on the plasmids, and selecting the recombinant positive plasmids to obtain a recombinant adenovirus vector pAd5-p34 for subsequent experiments. The XhoI digestion results of the recombinant adenovirus vector pAd5-p34 are shown in FIG. 11, wherein Lane M is 15000DNA Marker,

Lanes

1 and 2 are pAd5-p34 XhoI single digestion, and Lane 3 is pAd5 XhoI single digestion, which indicates that the vector construction is accurate. A vector map of recombinant adenovirus vector pAd5-p34 is shown in FIG. 12.

One embodiment of the construction method of the shuttle plasmid pS5E1 is as follows:

the skeleton of the shuttle plasmid pS5E1 adopts puc origin, amp and other basic elements (2796bp), an ITR partial sequence (355bp) of the left arm of Ad5, a PIX partial sequence (2100bp) of the right arm, PIVa2 partial sequence (2100bp) and CMV-MCS (944bp) SV40 earlyployA (160 bp).

Firstly, gene synthesis: the pS5E1 backbone (2796bp), CMV promoter, MCS, SV40early polyA terminator (957bp) were synthesized by Bommander, and the nucleotide sequence of the pS5E1 backbone is shown in SEQ ID No. 6.

GAATTCCGTGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCCGCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTGAAGCAGACCCTATCATCTCTCTCGTAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTTCCGCACCCCGGAAATGGTCAGCGAACCAATCAGCAGGGTCATCGCTAGCCAGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCATTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCTTATCGAAA(SEQ IDNo.6)。

(II) primer design

puc-Ad5-right arm-F：

TAATGCAGCTGGCTTATCGAAACGTGGAATGCGAGACCGTCT(SEQ ID No.7)；

Ad5-right arm-CMV-R：

ACACACAAGCAGGGAGCAGATACAAGGGTGGGAAAGAATATATAAG(SEQ ID No.8)；

CMV-F：GTATCTGCTCCCTGCTTGTG(SEQ ID No.9)；

CMV-SV40-R：TAAACAAGTTGGGGTGGGCGAAGTGATCAGCGGGTTTAAACGGG(SEQ IDNo.10)；

SV40-F：CTTCGCCCACCCCAACTTGT(SEQ ID No.11)；

SV40-R：AGAGGTCGACGGTATACAGAC(SEQ ID No.12)；

SV40-Ad5-left arm-F：

TGTCTGTATACCGTCGACCTCTCCGGGCCCTAGACAAATATTA(SEQ ID No.13)；

Ad5-left arm-puc-R：

ACACTATAGAATACACGGAATTCTTAATTAAATCATCAATAATATACCTTATTTTG(SEQIDNo.14)；

puc-F：GAATTCCGTGTATTCTATAGTGT(SEQ ID No.15)；

puc-R：TTTCGATAAGCCAGCTGCATTA(SEQ ID No.16)；

(III) amplification of the fragment of interest

1. The CMV promoter MCS fragment of the shuttle plasmid pS5E1 was amplified using pCDNA3.1(+) as a template (this plasmid was purchased from Seimerle fly Co., Ltd.) and CMV-F and CMV-SV40-R as primers;

an amplification system: 50ng of pCDNA3.1(+) plasmid, 1 mu L of 10 mu M CMV-F primer, 1 mu L of 10 mu M CMV-SV40-R primer and 20 mu L of Q5 high fidelity enzyme; water is added to 40 mu L; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 1min, 35 cycles; 72 ℃ for 5 min.

2. Amplifying an SV 40-earlyployA fragment of the shuttle plasmid pS5E1 by using pCDNA3.1(+) as a template and SV40-F and SV40-R as primers;

an amplification system: 50ng of pCDNA3.1(+) plasmid, 1 mu L of 10 mu M SV40-F primer, 1 mu L of 10 mu M SV40-R primer and 20 mu L of Q5 high-fidelity enzyme, and supplementing water to 40 mu L; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 10 sec; 72 ℃ for 5 min;

3. the above fragments were purified using the Axygen gel recovery kit.

4. PCR amplification is carried out on pS5E1 shuttle plasmid skeleton PUC by taking pS5E1 skeleton synthesized by Bomaide company as a template and PUC-F and PUC-R as primers;

an amplification system: pS5E1 backbone plasmid 50ng, 10. mu.M puc-F primer 1. mu.L, 10. mu.M puc-R primer 1. mu.L, Q5 high fidelity enzyme 20. mu.L, water supplement to 40. mu.L; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 1min, 20 sec; 72 ℃ for 5 min.

5. Amplifying the left arm of the shuttle plasmid pS5E1 by using pAd5 plasmid as a template and SV40-Ad5-left arm-F and Ad5-left arm-puc-R as primers;

an amplification system: 50ng of pAd5 plasmid, 1 muL of 10 muM SV40-Ad5-left arm-F primer, 1 muL of 10 muM Ad5-left arm-puc-R primer, 20 muL of Q5 high fidelity enzyme, and supplementing water to 40 muL; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 20s, 35 cycles; 72 ℃ for 5 min.

6. Amplifying the right arm of the shuttle plasmid pS5E1 by using pAd5 plasmid as a template and puc-Ad5-right arm-F and Ad5-right arm-CMV-R as primers;

an amplification system: pAd5 plasmid 50ng, 10. mu.M puc-Ad5-right arm-F primer 1. mu.L, 10. mu.M Ad5-right arm-CMV-R primer 1. mu.L, Q5 Hi-Fi enzyme 20. mu.L, water make up to 40. mu.L; the PCR procedure was: 10s at 98 ℃; at 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 15s, 35 cycles; 72 ℃ for 5 min.

7. The CMV-MCS of the gel recovery product is taken as a template, CMV-F and SV40-R are taken as primers, and a CMV-MCS-SV40 earlyplolyA fragment of the pS5E1 shuttle plasmid is amplified;

an amplification system: 50ng of pAd5 plasmid, 1 muL of 10 muM CMV-F primer, 1 muL of 10 muM SV40-R primer, 20 muL of Q5 high fidelity enzyme and water supplement to 40 muL; the PCR procedure was: 10s at 98 ℃; 35 cycles of 98 deg.C, 5s, 60 deg.C, 30s, 72 deg.C, 40 s; 72 ℃ for 5 min;

the agarose gel electrophoresis results of the CMV-MCS fragment and SV40 earlylyLYA fragment are shown in FIG. 13A; the results of agarose gel electrophoresis of CMV-MCS-SV40 earlyploA fusion fragment, PUC fragment, Ad5 right arm and Ad5 left arm are shown in FIG. 13B.

(IV) connecting and transforming fragments: purifying the fragments by using an Axygen gel recovery kit, then connecting the four fragments of pS5E1 framework PUC fragment, Ad5 left arm, Ad5 right arm and CMV-MCS-SV40 earlyploya by using a seamless Cloning kit of Bomeide company, wherein a connector system is 50ng of 2 x Smaless Cloning Mix 10 mu L, pS5E1 framework PUC fragment, 50ng of Ad5 left arm, 50ng of Ad5 right arm, 50ng of CMV-MCS-SV40 polyA, replenishing water to 20 mu L, and keeping the temperature at 50 ℃ for 40 minutes; the ligation products were transformed into DH 5. alpha. competent cells, plated on plates containing ampicillin, and cultured at 37 ℃ for 12 to 16 hours.

(V) plasmid verification:

1. and (3) colony PCR verification: the PCR amplification of CMV-MCS-SV40 polyA and Ad5 left arm is carried out by taking CMV-F, Ad5-left arm-puc-R as a primer, the agarose gel electrophoresis result of the PCR amplification of CMV-MCS-SV40 polyA and Ad5 left arm is shown in figure 13C, the result shows that the size of the segment is basically consistent with the expected theoretical molecular weight, the plasmid construction success is preliminarily shown, and the plasmid is extracted and enzyme digestion is carried out after positive clone is selected, so that further verification is carried out.

2. Enzyme digestion verification: the positive clone is picked and placed in 5mL LB liquid culture medium containing ampicillin resistance for 12-15 hours, plasmid is extracted for enzyme digestion verification, the experimental result is shown in FIG. 13D, wherein M is 15000bp marker, lanes 1-6 at the left side of the figure are NcoI single enzyme digestion, lanes 1-6 at the right side of the figure are PacI single enzyme digestion, and the shuttle plasmid pS5E1 can be seen to be constructed accurately.

The construction method of the adenovirus backbone vector pAd5 of one embodiment is as follows:

in A549 cells (

Amplification of wild type human adenovirus type 5 (CCL-185)

VR-5), gene sequence AC _000008.1), collecting and concentrating virus liquid, extracting adenovirus genome by adopting a HirtVireal DNA Extract method, constructing linear hAD5 genome into circular supercos-Ad5 carrier plasmid by using a cosmid method, and cutting an hAD5 adenovirus E1 region by using CRISPR/cas9 to design gRNA as follows:

hAd5-E1 upstream gRNA:

GGCGGGAAAACUGAAUAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E1 downstream gRNA:

GAGAUGAUCCAGUCGUAGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

designing gRNA sites at the upstream and downstream of an hAD 5E1 region, recovering a large fragment vector after cutting, designing a primer, respectively inserting ITR and PIX sequences into the upstream and downstream by fusion PCR, introducing a SwaI enzyme cutting site, then carrying out seamless cloning on the fused fragment and the vector to obtain an E1 knockout supercos-Ad5 delta E1 adenovirus vector, and then carrying out excision of an E3 region on the supercos-Ad5 delta E1 plasmid, and designing gRNAs as follows:

hAd5-E3 upstream gRNA:

GCGGGACAUUUCAGAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

hAd5-E3 downstream gRNA:

GUAAGGGUACUGCUAUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

designing gRNA sites at the upstream and downstream of an hAD 5E 3 region, recovering a large fragment vector after cutting, designing primers, carrying out fusion PCR on Fiber excessively cut at the upstream and downstream of E3 and a pVIII sequence, connecting in a seamless cloning mode to obtain an E3 knockout vector, and naming the vector as pAd 5.

It is understood that the recombinant adenovirus vector pAd5-p34 can be prepared by methods commonly used in the art, and the application is not limited thereto.

The foregoing is directed to the preferred embodiment of the present invention and is not intended to be exhaustive or to limit the invention to the precise form disclosed. The above-described embodiments are not intended to limit the present invention, and various modifications and variations may occur to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> camming (Gu' an) Biotech Co., Ltd

<120> hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody, monoclonal antibody and application

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cccaagctta tggggaatcg cgggtcttct a 31

<210>2

<211>51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atttgcggcc gcgctgccgc gcggcaccag gccctttttg gcgcagctgt t 51

<210>3

<211>1131

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atggggaatc gcgggtcttc tacctcctct cgccccctgc cctcctccga agccaatatc 60

tatgccaagc tgcaggacca tatccagcgc cagacccgcc ccttctccgg aggaggatac 120

tttaacggag gcggcgacaa aaaccccgtg cagcacatca aggactacca catcgacagc 180

gtgagctcca aagccaagct cagaatcatc gaaggaatta tccgcgccat cgccaagatc 240

ggctttaagg tggacacaaa acagcccatc gaagacatcc tcaaggacat caagaaacag 300

ctgcccgacc cccgcgccgg ctctaccttt gtgaagaacg ccgaaaaaca ggaaaccgtc 360

tgcaagatga ttgccgacgc catcaaccag gaattcatcg acctgggcca ggacaagctg 420

atcgacacca ccgaaggggc cgcctccatc tgccgccaga tcgtcctcta tatcaatagc 480

ctgacccacg gactgcgggc cgaatacctg gacgtgcacg gcagcatcga gaacaccctg 540

gaaaacatca aactgctgaa cgacgccatc aaacagctgc acgaacggat ggtgaccgaa 600

gtgaccaagg ccgcccccaa cgaggaagtg attaacgctg tgacaatgat cgaagccgtg 660

taccgccgcc tgctcaacga gcagaacctc cagatcaaca tcctcaccaa cttcatcgac 720

aacatcctga cccccaccca gaaagaactg gacaagctcc agaccgacga agtcgacatc 780

atcaaactcc tcaacgacac caacagcgtc ctcggcacca aaaacttcgg caaagtgctg 840

agctacaccc tctgcaacct gggcatcgcc gccagcgtcg ccaacaagat caacaaggcc 900

ctccagaaag tgggactgaa ggtggagcag tatctccaga gcaagaactg ggccgaattc 960

gacaaagaac tcgacctgaa acgcttctcc ggcctggtga gcgccgagaa catcgccgaa 1020

ttcgagaagg ctgtgaacct gctgaggcag accttcaacg aaaggcacaa gatcctggag 1080

aacagctgcg ccaaaaaggg ctacccctac gacgtgcccg actatgcctg a 1131

<210>4

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgcggatccg ccaccatggg gaatcgcggg tcttctac 38

<210>5

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

cggatatctc aggcatagtc gggcacgtcg t 31

<210>6

<211>2796

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gaattccgtg tattctatag tgtcacctaa atcgtatgtg tatgatacat aaggttatgt 60

attaattgta gccgcgttct aacgacaata tgtacaagcc taattgtgta gcatctggct 120

tactgaagca gaccctatca tctctctcgt aaactgccgt cagagtcggt ttggttggac 180

gaaccttctg agtttctggt aacgccgttc cgcaccccgg aaatggtcag cgaaccaatc 240

agcagggtca tcgctagcca gatcctctac gccggacgca tcgtggccgg catcaccggc 300

gccacaggtg cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct 360

cgccacttcg ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc 420

gggggactgt tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac 480

ggcctcaacc tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga 540

tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc 600

cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac 660

aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcattcacc gtcatcaccg 720

aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 780

ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 840

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 900

atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 960

attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 1020

gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 1080

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 1140

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 1200

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 1260

cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg 1320

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca 1380

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 1440

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 1500

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 1560

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 1620

aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 1680

agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa 1740

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 1800

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 1860

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 1920

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 1980

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 2040

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 2100

ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 2160

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 2220

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 2280

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 2340

agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 2400

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt 2460

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 2520

cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 2580

ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 2640

accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 2700

gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 2760

gttggccgat tcattaatgc agctggctta tcgaaa 2796

<210>7

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

taatgcagct ggcttatcga aacgtggaat gcgagaccgt ct 42

<210>8

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

acacacaagc agggagcaga tacaagggtg ggaaagaata tataag 46

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gtatctgctc cctgcttgtg 20

<210>10

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

taaacaagtt ggggtgggcg aagtgatcag cgggtttaaa cggg 44

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cttcgcccac cccaacttgt 20

<210>12

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

agaggtcgac ggtatacaga c 21

<210>13

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tgtctgtata ccgtcgacct ctccgggccc tagacaaata tta 43

<210>14

<211>56

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

acactataga atacacggaa ttcttaatta aatcatcaat aatatacctt attttg 56

<210>15

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gaattccgtg tattctatag tgt 23

<210>16

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

tttcgataag ccagctgcat ta 22

Claims

1. A hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody is characterized in that the preservation number of the hybridoma cell strain is CCTCC NO: C202042.

2. A preparation method of a hybridoma cell strain secreting African swine fever virus p34 protein monoclonal antibody is characterized by comprising the following steps:

1) expressing to obtain African swine fever virus p34 protein;

2) immunizing animals to obtain immune spleen cells;

3) cell fusion and screening of positive hybridoma cell strains;

screening the positive hybridoma cell strain obtained in the step 3) by taking the African swine fever virus p34 protein as an antigen to obtain a hybridoma cell strain stably secreting the monoclonal antibody, performing subcloning, taking the positive subclone to establish a strain, and storing to obtain the hybridoma cell strain secreting the African swine fever virus p34 protein monoclonal antibody.

3. The method as claimed in claim 2, wherein in the step 4), the positive hybridoma cell strain is screened by using African swine fever virus p34 protein expressed by CHO-S cells, African swine fever virus p34 protein expressed by SF9 insect cells and African swine fever virus p34 protein expressed by HEK293 cells transfected by recombinant adenovirus vectors, respectively, and monoclonal antibodies generated by the screened hybridoma cell strains can be simultaneously recognized by African swine fever virus p34 antigen expressed by CHO-S cells, SF9 insect cells and HEK293 cells transfected by recombinant adenovirus vectors.

4. The method according to claim 3, wherein the African swine fever virus p34 protein expressed and prepared by CHO-S cells is prepared by the method comprising: connecting a gene sequence for expressing the African swine fever virus p34 protein to pSecTag-2B to obtain an expression vector pSecTag-2B-p34, transfecting CHO-S cells by using the expression vector pSecTag-2B-p34, and obtaining the African swine fever virus p34 protein after induced expression and purification;

5. The African swine fever virus p34 protein monoclonal antibody is characterized in that the monoclonal antibody is secreted by a hybridoma cell strain with the preservation number of CCTCC NO: C202042.

6. The African swine fever virus p34 protein monoclonal antibody of claim 5, for use in detecting African swine fever virus or for use in preparing an immunoassay tool for detecting African swine fever virus.

7. The use of claim 6, wherein the immunoassay means is a reagent, a kit, a test strip or a biochip.

8. A kit for detecting the presence and/or level of african swine fever virus in a sample, comprising the monoclonal antibody to p34 protein of african swine fever virus according to claim 5.

9. The kit according to claim 9, further comprising an African swine fever virus cell culture or an African swine fever virus p34 protein-coated microplate, a goat anti-mouse secondary antibody labeled with HPR, a washing solution, a blocking solution, an antibody diluent, a developing solution and a stop solution.