KR102088811B1 - Novel alkaline lipase/esterase gene Lip-1447 derived from soil metagenome and use thereof - Google Patents

Abstract

The present invention relates to a novel alkaline lipase/esterase gene Lip-1447 derived from soil metagenome, and a use of the same. According to the present invention, a transformant having introduced therein the gene Lip-1447-sub-ORF2 recombined from novel lipase/esterase clone Lip-1447 derived from soil metagenome exhibits potent lipase and esterase activity with respect to tributyrin, and a novel lipase/esterase protein isolated and purified from the transformant also exhibits potent lipase and esterase activities, wherein the novel lipase/esterase protein can be mass-produced from the transformant. Accordingly, the novel lipase/esterase gene, a vector comprising the same, and a transformant having the same introduced therein may be usefully used in the industrial mass-production of a novel lipase/esterase protein with potent activities.

Description

Novel alkaline lipase / esterase gene Lip-1447 derived from soil metagenome and use thereof}

The present invention relates to a novel alkaline lipase / esterase gene Lip-1447 derived from soil metagenome and its use.

Most of the known lipolytic enzymes (lipases, lipases) are derived from bacteria, but more than 99% of the bacterial DNA remains unknown, since only 0.1 to 1% of all environmental microorganisms can be cultured using standard techniques. (Torsvik et al. , Appl. Environ. Microbiol. 56: 782-787, 1990). Accordingly, it is the metagenome that enables the discovery of new enzymes through genetic recombination expression of most microorganisms that have never been identified in culture.

Metagenome is defined as a generic term for the genomes of all microorganisms present in nature, and can be analyzed through the process of separating metagenomes without culturing microorganisms from natural samples and preparing them into libraries to introduce them into cultureable E. coli. have. This is a method for securing useful products from microorganisms that could not be cultivated, and it is difficult to obtain information on microorganisms from which genes are derived, but there is an advantage of simultaneously obtaining products and genes of microorganisms. The University of Wisconsin research team for the first time successfully isolated a large metagenome and cloned it into a bacterial artificial chromosome (BAC) vector to build a metagenome library from which it isolated a wide range of antibiotics and genes related to their biosynthesis (Gillespie et al., 2002, Appl. Environ. Microbiol. 68: 4301-4306; Rondon et al., 2000, Appl. Environ. Microbiol. 66: 2541-2547). The TIGR (The Institute for Genomic Research) team is also attempting to explore the genetic resources of microorganisms that are not cultivated from marine ecosystems by building a total microbial metagenome library of marine microorganisms in the BAC vector. Recently, studies have been conducted to produce and purify lipase from various metagenomes and to understand its properties (Gupta et al., 2004, Appl. Microbiol. Biotechnol., 64: 763-781).

Lipase is an enzyme that hydrolyzes the ester bond of triglyceride, and is known to be produced by many kinds of animals and plants, and biochemical properties and genes have been actively researched. In addition, since it has unique properties such as high substrate specificity, optical activity specificity and position specificity, various fine chemicals and detergents through conversion of fats and oils in aqueous solution and (trans) esterification reaction in an organic solvent It is very useful in food, chemical, and pharmaceutical industries, and is known as an enzyme that is particularly useful in the production of optically active medicines. In recent years, lipase, which is also used to produce biodiesel, can be produced relatively inexpensively compared to other enzymes, and since it does not require a coenzyme, it has a great industrial advantage, so it is widely used as a biocatalyst in the biopharmaceutical field. It is becoming more prominent. In particular, alkaline lipase is widely used in detergents, and requires high activity and stability at a wide range of temperatures and pHs, and is required to be compatible with other components of detergents, including metal ions, surfactants, and oxidizing agents.

Accordingly, the present inventors completed the present invention by confirming that the protein produced therefrom exhibits excellent lipase and esterase activity after separating the novel lipase / esterase gene from the domestic soil metagenome.

The object of the present invention is a novel lipase / esterase gene and protein derived from soil metagenome, a vector containing the new lipase / esterase gene, a transformant introducing the same, and preparation of a lipase / esterase protein using the same Is to provide a way.

To achieve the above object, the present invention provides a lipase / esterase protein composed of the amino acid sequence of SEQ ID NO: 1.

In addition, the present invention provides a gene encoding the lipase / esterase protein.

In addition, the present invention provides a recombinant vector containing the gene.

In addition, the present invention provides a transformant in which the recombinant vector is introduced into a host cell.

In addition, the present invention 1) culturing the transformant; 2) It provides a method for producing a lipase / esterase protein, comprising recovering the lipase / esterase protein from the cultured transformant or the culture supernatant thereof.

A transformant introduced with the recombinant gene Lip-1447-sub-ORF2 from a new lipase / esterase clone Lip-1447 derived from soil metagenome according to the present invention is a strong lipase and esterase against tributyrin. The new lipase / esterase protein showing activity, isolated and purified from the transformant also shows strong lipase and esterase activity, and a new lipase / esterase protein can be mass produced from the transformant. Therefore, the novel lipase / esterase gene of the present invention, a vector containing the same, and a transformant introduced therein can be usefully used for industrial mass production of a novel lipase / esterase protein having strong activity.

1 is a schematic diagram showing a process of producing a new lipase / esterase protein by deriving a new lipase / esterase gene Lip-1447 from a soil metagenome.
2 is a view showing the results of deriving 15 active clones with lipase and esterase activity from the soil metagenome library.
Figure 3 is a diagram confirming the cleavage pattern for restriction enzymes Bam HI, Pst I, Eco RI, Xba I Sph I, Hind III, and Sma I of plasmid DNA isolated from E. coli introduced with the subclone of Lip-1447 (A ), And a colon (B) showing colonies showing lipase and esterase activity in E. coli, which introduced the subclone of Lip-1447.
4 is a view showing ORF1 to ORF6 of Lip-1447-sub.
5 is a diagram schematically showing the structure of a plasmid (pET21a (+)-ORF2-6H) containing the Lip-1447-sub-ORF2 sequence.
FIG. 6 is a diagram showing the results of electrophoresis and staining of a novel lipase / esterase protein isolated from E. coli introduced with Lip-1447-sub-ORF2.
7 is a chromatogram (A) for purifying a new lipase / esterase protein isolated from E. coli introduced with Lip-1447-sub-ORF2 by FPLC, a new lipase / esterase protein in each fraction obtained through FPLC. Figure (B) showing the expression confirmed, and a photograph (C) of the container containing the new lipase / esterase protein isolated and purified.
8 is a view showing the results of electrophoresis and staining of lipase / esterase protein purified using a metal ion attached column.
9 is a diagram confirming the lipase and esterase activity of a novel lipase / esterase protein isolated from E. coli with the introduction of Lip-1447-sub-ORF2.
Figure 10 is a graph (B) of the results of confirming the optimal pH for the lipase and esterase activity of the novel lipase / esterase protein and the result of confirming the optimal temperature.
11 is a graph of the reaction rate of lipase and esterase activity of a novel lipase / esterase protein ([S]: substrate concentration; v: reaction rate; V _max : maximum reaction rate; and K _m : substrate specificity index) .

Hereinafter, the present invention will be described in detail.

The present invention provides a lipase / esterase protein composed of the amino acid sequence of SEQ ID NO: 1.

The lipase / esterase protein, variant or fragment thereof may be isolated from nature, including soil metagenome, or by conventional chemical synthesis methods (WH Freeman and Co., Proteins; structures and molecular principles, 1983). Can be synthesized. Specifically, it may be synthesized by liquid phase peptide synthesis, solid-phase peptide syntheses, fragment condensation and F-moc or T-BOC chemistry, and more specifically solid phase peptide synthesis It can be synthesized as.

The lipase / esterase protein may be a variant of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues, within a range that does not affect the function of the protein. Amino acid exchanges in proteins or peptides that do not entirely alter the activity of the molecule are known in the art. In some cases, phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation can be modified. Accordingly, the present invention may include a protein, a variant or fragment thereof having an amino acid sequence substantially identical to a protein consisting of the amino acid sequence of SEQ ID NO: 1. The protein having the substantially identical amino acid sequence may have homology to the protein of the present invention by 80% or more, specifically 90% or more, and more specifically 95% or more.

In addition, the present invention provides a gene encoding the lipase / esterase protein.

The gene may be composed of the nucleotide sequence of SEQ ID NO: 2, specifically Lip-1447-sub-ORF2. In one embodiment of the present invention, the Lip-1447-sub-ORF2 gene was derived and registered in GenBank (MH628530).

The gene encoding the lipase / esterase protein may be derived from soil metagenome.

The gene encoding the lipase / esterase protein is within the range of encoding a protein having activity equivalent to the lipase / esterase protein of the present invention, by deletion, insertion, substitution, or a combination thereof. It may be a variant having a different sequence. Accordingly, the present invention may include a polynucleotide having a substantially identical nucleotide sequence to a gene consisting of the nucleotide sequence of SEQ ID NO: 2, a variant or fragment thereof. The polynucleotide having the substantially identical nucleotide sequence may have homology to the gene of the present invention at 80% or more, specifically 90% or more, and more specifically 95% or more.

In addition, the present invention provides a recombinant vector containing the gene.

As used herein, the term "vector" refers to DNA fragment (s), nucleic acid molecules that are delivered into a cell, and the vector replicates DNA and can be independently reproduced in a host cell.

As used herein, the term “recombinant vector” refers to a gene construct comprising essential regulatory elements operably linked to express a gene insert as a vector capable of expressing a target protein or a target RNA in a specific host cell.

As used herein, the term "operably linked (operably linked)" means that the sequence that regulates the expression of the nucleic acid and the nucleic acid sequence that encodes the desired protein or RNA are functionally linked (functional linkage). For example, a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to influence the expression of the encoding nucleic acid sequence. Arbitrary linkage with recombinant vectors can be made using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage uses enzymes, etc., generally known in the art.

The recombinant vector may be a plasmid vector, a cosmid vector, a fosmid vector, a bacteriophage vector, or a viral vector, but is not limited thereto.

In one embodiment of the present invention, the recombinant vector may be a phosmid vector having a schematic structure of FIG. 5.

The recombinant vector may include an expression control sequence such as a promoter, an operator, an initiation codon, a termination codon, a polyadenylation signal and an enhancer, and a signal sequence or leader for membrane targeting or secretion It may include a sequence, it may be prepared in various ways depending on the purpose.

The signal sequence is a host cell is Escherichia (Escherichia) bacteria, PhoA signal sequence or OmpA signal sequence, etc., when the host cell is Bacillus (Bacillus) bacteria α- amylase signal sequence or subtilicin (subtilicin) signal sequence For example, when the host cell is yeast, MFα signal sequence or SUC2 signal sequence, etc., when the host cell is animal cell, insulin signal sequence, α-interferon signal sequence, or antibody molecular signal sequence may be used. It is not limited.

In addition, the recombinant vector may include a selection marker for selecting a host cell containing the recombinant vector, and in the case of a replicable recombinant vector, may include an origin of replication.

In one embodiment of the present invention, a transformant that introduces a recombinant vector containing a gene encoding a lipase / esterase protein according to the present invention into a host cell is expressed when the lipase / esterase protein is expressed in the host cell. Since it exhibits activity, it is possible to select transformed host cells without a selection marker by adding a lipase / esterase substrate such as tributyrin to the culture medium of the host cell.

In addition, the recombinant vector may include a sequence for facilitating purification of the expression material, and in one embodiment of the present invention, the histidine-tag (His-taq) is located at the C-terminus to lipase / esterase protein. The purification of the was facilitated.

In addition, the present invention provides a transformant in which the recombinant vector is introduced into a host cell.

As used herein, the term “transformation” is used in the same sense as “introduction”, and refers to the delivery of a foreign polynucleotide to a host cell regardless of the method used.

The host cell is a cell having the ability to express the trait of a foreign gene by introducing a foreign gene, and may be a prokaryotic cell or a eukaryotic cell. Specifically, the prokaryotic cell may be E. coli.

In one embodiment of the present invention, the transformant may be a BL21 (DE3) / pET21a + ORF2-6H strain.

The method for transforming the recombinant vector into a host cell is not particularly limited as long as the recombinant vector is inserted into the host cell, and for example, any of CaCl ₂ method, electroporation method, and microinjection method is possible.

In addition, the present invention 1) culturing the transformant; 2) It provides a method for producing a lipase / esterase protein, comprising recovering the lipase / esterase protein from the cultured transformant or the culture supernatant thereof.

The step of culturing the transformant in step 1) may be cultured in LB (Luria broth) medium, and specifically, in LB medium containing an antibiotic capable of selectively proliferating the transformant. In one embodiment of the present invention, the transformant can be cultured in LB medium containing ampicillin.

In addition, the step of culturing the transformant in step 1) can be cultured by treating an inducer such as isopropyl-α-D-thiogalacto pyranoside (IPTG) that induces lipase / esterase protein expression. IPTG can be cultured by treating the final concentration to be 0.01 to 1 mM, or 0.05 to 0.5 mM.

The step of recovering the lipase / esterase protein in step 2) may be performed in a conventional manner in the art. For example, salt or salt (ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (protein fraction precipitation using acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, chromatography, and ultrafiltration techniques alone or in combination It may be performed by applying as, but is not limited thereto.

The method of preparing the lipase / esterase protein may further include the step of purifying the recovered lipase / esterase protein of step 2).

The step of purifying the lipase / esterase protein may be performed by a conventional protein purification method in the art, for example, ion exchange chromatography, gel-permeation chromatography, reverse phase-high performance liquid chromatography (high performance liquid) chromatography, HPLC), preparation for SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and affinity column chromatography, but are not limited thereto. In one embodiment of the invention, purification of the lipase / esterase protein can be performed using a Ni-NTA column.

In a specific embodiment of the present invention, the present inventors prepared a soil metagenome library, from which 15 active clones having lipase and esterase activity were selected, and among them, the Lip-1447 gene having the best activity was selected. The subclones were produced using this, and the subclone Lip-1447-sub having a small lipase / esterase activity while having a small inserted DNA was selected (see FIGS. 1 to 3). The base sequence of Lip-1447-sub was analyzed to derive ORF2 having lipase and esterase activity, and an E. coli transformant was prepared by introducing a recombinant vector containing the Lip-1447-sub-ORF2 gene ( 4 and 5). In addition, lipase / esterase protein expression was confirmed from E. coli transformants introduced with Lip-1447-sub-ORF2, the protein was isolated and purified, and the new lipase / esterase protein was used for tributyrin. It was confirmed that it exhibits hydrolysis activity (see FIGS. 6 to 9). In addition, the novel lipase / esterase protein showed lipase and esterase activity, and the optimum pH was 8.0 and the optimum temperature was 40 to 50 ° C. The maximum reaction rate (V _max ) was 0.721 units (Units), The substrate specificity index (K _m ) was confirmed to be 0.038 mM (see FIGS. 10 and 11).

Therefore, the novel lipase / esterase gene of the present invention, a vector containing the same, and a transformant introduced therein can be useful for industrial mass production of a novel alkaline lipase / esterase protein having strong activity.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Soil metagenome DNA isolation and size determination

The soil collected from the reed wetland in Sinseong-ri, Chungcheongnam-do was filtered through a sieve having a mesh diameter of 1.4 mm to remove particles with a diameter of more than 1.5 mm and plant remnants. 5 g of the soil sample is a 15 ml buffer solution (100 mM Tris-HCl, pH 8.0; 100 mM Ethylenediaminetetraacetic acid (EDTA), pH 8.0; 100 mM sodium phosphate, pH 8.0; 1.5 M sodium chloride; and 1 % CTAB (cetyl trimethylammonium bromide). After adding 100 µl of the protease K (proteinase K, Sigma) at a concentration of 100 mg / ml to the suspension, shake it for 30 minutes at a speed of 150 rpm in a 37 ° C shake incubator, and add 1.5 ml of 20% SDS. Shake and mix. The mixture was maintained for 2 hours while mixing once every 30 minutes in a 65 ° C. constant temperature water bath. Subsequently, the supernatant was separated by centrifugation at 7,000 rpm for 10 minutes, and the same volume of chloroform / isoamyl alcohol (24: 1) was added and mixed, followed by centrifugation at 8,000 rpm for 10 minutes. Only the supernatant containing DNA was transferred to a new tube. After adding and mixing isopropanol corresponding to 0.6 times the volume of the supernatant, the DNA precipitate was obtained by centrifugation at 11,000 rpm for 10 minutes. The DNA precipitate was washed with 70% ethanol and then centrifuged to remove ethanol. The precipitate obtained therefrom was dried, dissolved in 0.5 ml of TE buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at 4 ° C.

Determination of the amount and size of the separated DNA was confirmed by PFGE (pulsed field gel electrophoresis). PFGE was performed for 6 hours at a switch time of 1 to 6 seconds at a fixed angle of 120 ° at 6 V / cm, and as a result, about 1 to 1.5 μg per 1 g of the soil sample It was confirmed that the metagenome DNA was isolated, and the size of the isolated DNA was about 20 to 100 kb (FIG. 1).

Creation of metagenome library

After electrophoresis on a low melting point agarose gel using the metagenome isolated in Example 1, only an agarose gel block containing 20 kb or more of DNA was recovered. The recovered gel block was treated with gelase (GeLase, Epicentre, USA) to purify DNA, and to remove humic acid and the like. Both ends of the purified DNA fragment were treated with a DNA end-repair enzyme to obtain 20 kb or more of metagenome DNA having a blunt end, which was treated with the restriction enzyme Eco 72I (fosmid). ) Ligated to the vector pEpiFOS-5 (Epicentre). After introducing the vector into a Escherichia coli using a commercial packaging system (packaging extract, Epicentre), transformants growing in LB (Luria broth) agar medium to which 50 μg / ml chloramphenicol was added were selected. Did. After plasmid DNA separated from the selected transformants by SDS-alkali lysis method was digested with restriction enzyme Bam HI, electrophoresis was performed, and all of the selected 50 transformants contained recombinant plasmid. It was confirmed that the library was well written, and the average size of the inserted metagenomic DNA was 35 to 40 kb. The selected transformants were diluted in the medium and stored at -80 ° C.

Experimental Example 1. Selection of lipase and esterase active clones from the metagenome library

In order to select clones showing lipase and esterase activity from the metagenome library prepared in Example 2, after homogenization by adding 50 μg / ml chloramphenicol and 1% tributyrin to LB agar medium, The mixture was hardened by dispensing, and the library stored as a pool at -80 ° C was appropriately diluted to streak a certain amount so that about 300 to 400 colonies could be cultured in the medium. This was cultured at 37 ° C for 2 days to select colonies showing a transparent halo around the colonies. Lipase and esterase activities of the selected active clones were re-assayed by the above method to finally isolate 15 species (FIG. 2) and store them at -80 ° C.

Construction of subclones from lipase and esterase active clones (Lip-1447)

Among the 15 kinds of clones showing lipase and esterase activity isolated in Experimental Example 1, subcloning was performed second from the clone having the best lipase and esterase activity (Lip-1447).

3-1. Derivation of optimal restriction enzymes for the production of subclones

The plasmid DNA of Lip-1447 was separated in bulk using a plasmid separation kit (Bionia, Korea), and then cut with restriction enzymes Bam HI, Pst I, Eco RI, Xba I, Sph I, Hind III or Sma I , The cut pattern was confirmed by electrophoresis of the cut DNA on an agarose gel.

As a result, when Pst I was used, it was confirmed that the DNA was cleaved many times, and Pst I was derived as an optimal restriction enzyme (FIG. 3A).

3-2. Production of subclone from Lip-1447

The plasmid DNA of Lip-1447 isolated in Example 3-1 was digested with a restriction enzyme Pst I to make a reaction of the inserted DNA Lip-1447 and reacted at 37 ° C for 2 hours to purify the inserted DNA. After 250 ng / µl of the vector DNA (pUC119) was digested with the restriction enzyme Pst I to make a reaction and reacted, the vector DNA was purified by treating with an alkaline phosphatase (SAP) to prevent the vector from sticking to itself. The purified Lip-1447 DNA and vector DNA (pUC119, Vieira and Messing, Methods Enzymol. 153: 3-11, 1987) were mixed with a ligation buffer, ATP and ligase for 2 hours at room temperature. After reacting for a while, it was reacted overnight at 4 ° C to produce a subclone.

Experimental Example 2. Derivation of Lip-1447-sub among Lip-1447 subclones

2-1. Preparation of transformants introduced with subclones of Lip-1447, and selection of transformants having lipase and esterase activity

The subclones prepared in Example 3 were mixed with 100 μl of commercially available E. coli cells JM109 and left on ice for 20 minutes, and heat treated at 42 ° C. for 45 seconds to introduce the subclones into the cells, followed by the addition of antibiotics. 400 µl of unused LB medium was added and incubated at 37 ° C. for 45 minutes. To select transformants therefrom, the culture was spread on LB plates containing 1% of tributyrin and 100 μg / ml of ampicillin and cultured at 37 ° C. for 16 hours. From the cultured plate, tributyrin was hydrolyzed to select colonies showing strong halo (FIG. 3B).

2-2. Verification of the introduction of selected clones into subclones

After plasmid DNA was separated from the colonies selected in Experimental Example 2-1 using a plasmid separation kit (Bionia) and treated with restriction enzyme Pst I, the cut DNA was confirmed by electrophoresis. As a result, a DNA fragment of the same size as the DNA fragment of Lip-1447 was identified, confirming that the subclones of Lip-1447 were well introduced into the DNA of the transformant.

2-3. Derivation of Lip-1447-sub among subclones

From the results of Experimental Examples 2-1 and 2-2, the subclone having the smallest inserted DNA size of the subclone introduced into the transformant and having strong lipase and esterase activity was selected, and the base sequence was analyzed, and the size was analyzed. It was confirmed that is 4,380 bp. The selected subclones were named Lip-1447-sub (SEQ ID NO: 3).

Experimental Example 3. Identification of ORF having lipase and esterase activity in the ORF of Lip-1447-sub

3-1. OR-14 analysis of Lip-1447-sub and derivation of ORF2

The open reading frame (ORF) was analyzed from the base sequence of Lip-1447-sub analyzed in Experimental Example 2-3, and it was confirmed that there were 4 ORFs of 500 bp or more among various ORFs (FIG. 4). . Of the four ORFs analyzed, ORF1 was a sikimate kinase ( Chlorobium phaeobacteroides DSM 266, 50%), ORF2 was an acetyl hydrolase Streptomyces hygroscopicus , 49%), ORF3 was a beta-glucosidase ( Oryza sativa Japonica Group, 32%), ORF4 was identified as a methyltransferase ( Lactobacillus johnsonii , 55%), so ORF2 was derived as the most potent lipase / esterase and candidate.

3-2. Lip-1447-sub ORF2 introduced E. coli lipase and esterase activity confirmation

By separating the DNA of Lip-1447-sub subclones selected in Experimental Example 2 as a template, and preparing primers for ORF2 derived from Experimental Example 3-1 (Table 1), polymerase chain reaction ( polymerase chain reaction (PCR) was performed. The PCR reaction consisted of mixing 20 μl of 5 × PCR buffer solution, 10 μl of N-solution, 2 μl of each primer of 100 pM, 1 μl of template DNA, 1 μl of pfu DNA polymerase, and 64 μl of sterile distilled water to make a total volume of 100 μl As a result, 30 cycles at 95 ° C, 30 seconds at 58 ° C, and 40 seconds at 72 ° C were repeated 30 times (Thermal Cycler, Bio-Rad, USA). The pET21a (+) vector was digested with restriction enzymes corresponding to the primers listed in Table 1 below, and then each PCR product was ligated and introduced into commercial water-soluble E. coli cell JM109 in the same manner as described in Experimental Example 2-1. The E. coli was spread on LB medium containing 1% tributyrin and cultured at 37 ° C for 2 days to investigate lipase and esterase activity.

Primer name Sequence (5 '→ 3) Restriction enzymes Sequence number ORF2 F GCGTCACGACATATGGCGAGTCCGCAACTGCA NdeI 4 ORF2 R GCGTCAGGTCTCGAGCGCCGTGTGCTCGCGGATAA XhoI 5

As a result, it was confirmed that E. coli introduced with ORF2 exhibits lipase and esterase activity.

Construction of Lip-1447-sub-ORF2 plasmid

The DNA of Lip-1447-sub subclones selected in Experimental Example 2 was isolated and used as a template, and PCR was performed using primer pairs (SEQ ID NOs: 4 and 5) corresponding to ORF2 in Table 1 to perform Lip-1447. A plasmid (pET21a (+)-ORF2-6H) was prepared comprising -sub ORF2 site and restriction sites ( NdeI and XhoI ).

Specifically, using the DNA of Lip-1447-sub as a template, PCR was performed in the same manner as described in Experimental Example 3-2 using primer pairs (SEQ ID NOs: 4 and 5) corresponding to ORF2 in Table 1. . The amplified PCR product was analyzed by 1.5% (w / v) agarose gel electrophoresis and purified using a PCR purification kit (Bionia). The sequence of the purified DNA was analyzed and ligated to pET21a (+) digested with restriction enzymes Nde I and Xho I, and the resulting plasmid was named pET21a (+)-Lip1447-6H (FIG. 5).

Mass production of novel lipase / esterase proteins with lipase and esterase activity

5-1. Induction of expression of new lipase / esterase protein

Using the plasmid prepared in Example 4, the expression of novel lipase / esterase protein having lipase and esterase activity in E. coli was induced.

Specifically, the plasmid was introduced into an expression host, E. coli BL21 (DE3) [F-omp T hsdS _B (r _B- m _B- ) gal dcm (DE3)] (Stratagen, USA), and plated on LB plates. . A single colony grown in a new medium was collected, inoculated into 100 mL of LB medium containing 100 μg / mL ampicillin, and cultured at 37 ° C. until the absorbance at 600 nm was 0.6. This was again inoculated into 5,000 ml of LB medium containing ampicillin and incubated with shaking at 37 ° C, and grown until absorbance at 600 nm was 0.6. Then, 1 mM IPTG (isopropyl-α-D-thiogalacto pyranoside, GibcoBRL, USA) was added to induce protein overexpression, and further cultured at 20 ° C. for 16 hours.

5-2. Isolation of the expressed new lipase / esterase protein

The culture solution was centrifuged at 6,000 × g, 4 ° C. for 10 minutes to remove the supernatant, and the precipitate was washed three times with 10 ml of cold buffer solution (50 mM Tris-HCl, 1 mM EDTA, pH 8.0). This was resuspended in lysis buffer solution (pH 7.0, 50 mM Tris-HCl, 200 mM sodium chloride) and then crushed with an ultrasonic grinder (CosmoBio Co., LTD, Japan). The crushed cells were centrifuged at 12,000 × g at 4 ° C for 30 minutes to remove the supernatant to obtain a precipitated protein. After mixing the protein with Laemmli sample buffer, SDS-PAGE was performed and stained with Coomassie Brilliant Blue R250 to find that 34 kDa lipase / esterase protein was present. It was confirmed (Fig. 6A).

5-3. Purification of isolated new lipase / esterase protein

The lipase / esterase protein isolated in Example 5-1 was purified using a metal ion attachment column.

Specifically, Ni-NTA (nickel-nitrilotriacetic acid, QIAGEN, Germany) was added to a chromatography column (bed volume, 15 mL, Millipore, USA) to saturate the column with nickel ions, and a 50 mM nickel solution in the form of sulfate was added. Was added to remove unbound metal ions. A solution containing the separated lipase / esterase protein was added to the column, and the column was washed with a buffer solution (50 mM Tris-HCl, 0.15 M sodium chloride, pH 7.4), followed by a continuous imidazole gradient. After passing through the buffer solution, it was purified by fast protein liquid chromatography (FPLC) (FIG. 7A), and purified lipase / esterase protein was obtained in each fraction. Electrophoresis was performed in the same manner as described in Example 7-2 above using each fraction to confirm the presence of a 34 kDa lipase / esterase protein (FIG. 7B). After combining the fractions (fractions 13, 14, 15, 17 and 19) confirming the presence of the lipase / esterase protein as described above, 1 mg with a buffer solution (50 mM Tris-HCl, 0.15 M sodium chloride, pH 7.4) Diluted to a concentration of / ml, placed in a container and stored at -70 ° C (Figure 7C). In addition, SDS-PAGE and Coomassie Brilliant Blue staining were performed in the same manner as described in Example 5-2 using the combined fractions to confirm the 34 kD lipase / esterase protein (FIG. 8).

Experimental Example 4. Lip-1447-sub-ORF2 introduced E. coli cell intralipase / esterase protein expression and extracellular secretion confirmation

It was confirmed by SDS-PAGE analysis whether a new lipase / esterase protein was expressed in cells of E. coli introduced with Lip-1447-sub-ORF2 prepared in Example 5-1 and secreted out of the cells.

Specifically, the E. coli introduced with Lip-1447-sub-ORF2 was suspended and cultured in LB liquid medium for 2 days. The culture solution was centrifuged at 14,000 rpm to separate the supernatant, followed by membrane filtration to obtain filtered cells and cultures from which cells were removed. The cells were concentrated 10 times, and the culture was not concentrated, and the expression of the protein was confirmed through 12% SDS-PAGE analysis.

As a result, it was confirmed that the 34 kDa protein of the expected size was strongly expressed compared to E. coli with only the pUC119 vector and secreted well into the medium.

Experimental Example 5. Confirmation of new lipase / esterase protein lipase and esterase activity

Lipase and esterase activity of the novel lipase / esterase protein expressed in E. coli introduced with Lip-1447-sub-ORF2 prepared in Example 5-1 was investigated.

Specifically, after homogenization by adding 1% tributyrin to LB agar medium, 40 μl of the new lipase / esterase protein purified in Example 5-3 was injected onto a paper disc having a diameter of 3 mm, It was incubated at 37 ° C for 5 days.

As a result, it was confirmed that a transparent halo was shown around the colony above the space (FIG. 9), suggesting that the novel lipase / esterase protein strongly shows the activity of hydrolyzing tributyrin.

Experimental Example 6. Confirmation of biochemical properties of novel lipase / esterase protein

The biochemical properties of the novel lipase / esterase protein expressed in E. coli introduced with Lip-1447-sub-ORF2 prepared in Example 5-1 were examined.

Specifically, the enzyme activity of the novel lipase / esterase protein is 25 μl of 3 μM of para-nitrophenyl palmitate (p-NPP), a substrate dissolved in 2-propanol. 5 μg of purified enzyme and 200 μl of 50 mM Glycine-NaOH buffer (pH 8.0) were mixed and reacted on a heating plate at 40 ° C. for 10 minutes. The amount of p-NPP produced after the completion of the reaction was measured with a spectrophotometer at an absorbance of 410 nm. Enzyme activity was calculated by applying the measured values to the para-nitrophenol (p-nitrophenol) standard curve. One unit of lipase / esterase activity (Unit, U) was defined as the amount of p-NP produced by mg protein per minute (μmole). Optimum temperature and pH conditions for the lipase / esterase activity of the recombinant protein were investigated in 96-well microplates using various temperatures (range 20 to 70 ° C) and pH conditions (range pH 2 to 12). Kinetic parameters (Hanes-Woolf constant K _m and maximum reaction rate V _max ) were estimated by linear regression from double reciprocal plots.

As a result, it was confirmed that the novel lipase / esterase protein was an alkaline enzyme showing optimal activity at pH 8.0 (FIG. 10A), and the temperature showing optimal activity was 40-50 ° C (FIG. 10B). The maximum reaction rate (V _max ) of lipase and esterase activity was 0.721 Units, and the substrate specificity index (Hanes-Woolf constant, K _m ) was 0.038 mM (FIG. 11).

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY <120> Novel alkaline lipase / esterase gene Lip-1447 derived from soil          metagenome and use thereof <130> 2018P-09-040 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 304 <212> PRT <213> Artificial Sequence <220> <223> lipase_esterase <400> 1 Met Ala Ser Pro Gln Leu Gln Thr Ala Ile Gln Ala Phe Lys Thr Val   1 5 10 15 Gly Glu Glu Met Ala Lys Ala Thr Asp Met Arg Ser Met Arg Ala Val              20 25 30 Met Glu Lys Ile Ala Val Pro Ala Pro Pro Asp Val Lys Cys Thr Pro          35 40 45 Val Asn Ala Gly Gly Val Pro Ala Glu Trp Ile Val Ala Pro Gly Ala      50 55 60 Ala Glu Asp Arg Phe Leu Leu Tyr Leu His Gly Gly Gly Tyr Val Leu  65 70 75 80 Gly Ser Ile Asn Thr His Arg Glu Met Ile Ser Arg Met Ser Arg Ala                  85 90 95 Ala Gly Val Arg Ala Leu Ala Leu Glu Tyr Arg Leu Ala Pro Glu Ser             100 105 110 Pro Phe Pro Ala Ala Val Asp Asp Ala Thr Ala Ala Tyr Arg Trp Leu         115 120 125 Leu Ser Gln Gly Ala Lys Pro Ala Arg Thr Val Ile Ala Gly Asp Ser     130 135 140 Ala Gly Gly Gly Leu Ala Leu Ala Thr Leu Val Ala Leu Arg Asp Ala 145 150 155 160 Lys Leu Pro Leu Pro Ala Ala Gly Val Cys Leu Ser Pro Trp Ala Asp                 165 170 175 Met Glu Gly Val Gly Ala Ser Met Thr Ser Lys Ala Lys Glu Asp Pro             180 185 190 Val Val Gln Lys Glu Gly Leu Leu Gly Met Ala Lys Leu Tyr Leu Gly         195 200 205 Gly Ala Asp Pro Lys Thr Pro Leu Ala Ala Pro Leu His Ala Asp Leu     210 215 220 Arg Gly Leu Pro Pro Leu Leu Ile Gln Val Gly Ser Ala Glu Thr Leu 225 230 235 240 Leu Asp Asp Ser Thr Arg Val Ala Glu Arg Ala Lys Ala Ala Gly Val                 245 250 255 Lys Val Asp Leu Glu Val Trp Asn Glu Met Ile His Val Trp Gln Leu             260 265 270 Phe Ala Pro Phe Leu Pro Glu Gly Gln Glu Ala Ile Ala Lys Ile Gly         275 280 285 Lys Phe Ile Arg Glu His Thr Ala Leu Glu His His His His His His     290 295 300 <210> 2 <211> 915 <212> DNA <213> Artificial Sequence <220> <223> Lip-1447-sub-ORF2 <400> 2 atggcgagtc cgcaactgca aacggcaatt caggcattca aaacggtcgg ggaggaaatg 60 gcgaaagcca cggacatgag gagtatgcgc gcggtgatgg aaaagatcgc ggttccagcc 120 ccgccagacg tcaagtgtac cccggtcaat gcgggcggtg tgccggctga atggattgtt 180 gcccccggcg cggctgagga tcgcttcctc ctgtacctgc atggtggtgg ctacgtcctc 240 ggctcgatta acactcatcg tgagatgatc tctcgcatgt cgcgggcagc gggcgtgcga 300 gcgcttgctc tggagtatcg gcttgccccg gagagcccat tcccggccgc agtcgacgac 360 gcgacggcgg cctaccgctg gttgctgtcc cagggggcca agcctgcgcg cacagtgatt 420 gccggcgact ccgccggggg agggctagcg cttgccacct tagtggctct gcgagatgcc 480 aagctgcctc tccctgcggc aggggtttgt ctctcgcctt gggccgacat ggaaggagtt 540 ggcgcgtcca tgacgagcaa agcgaaagag gatccggtcg tgcaaaaaga aggactctta 600 ggcatggcca agctatatct gggtggggcc gatcccaaga caccccttgc cgcgccgctg 660 cacgccgatt tgcgcgggct gccgccgttg cttattcagg tcggttccgc cgagaccctg 720 ctcgatgatt ctacccgtgt ggctgagcgg gccaaagccg ctggagtcaa agtggacctg 780 gaggtgtgga acgagatgat ccacgtctgg cagctcttcg ccccgttcct gccggaagga 840 caagaggcaa ttgccaagat cggcaagttt atccgcgagc acacggcgct cgagcaccac 900 caccaccacc actga 915 <210> 3 <211> 4379 <212> DNA <213> Artificial Sequence <220> <223> Lip-1447-sub <400> 3 ggactggacc gggggttact ctagagtccg acctgcagat atggcgctcg cggcattgtt 60 gggcgactat cccgcgccag aagcggcgca aatgctagtc gcctgggaca ataagaccga 120 caataagggc ctgcgacggg agattcatcg ctccttatat aagctgtcac agaaaggggt 180 gcaggttgaa cgccccgtcc aagcaccggt acgcccggtg ctggctccgg ttgagcctga 240 agggcatctg tcagcgatgg atggccacgg agaccggtta gtgtggctga tcaaaccgaa 300 ggttggcggc gggttacact atctctcggc tttagtgaat gaaccagaag gaatgcgtta 360 cgttgaaggc gctgagatca cccgtaaggg cttccgcctg atgcgtcagg acttgagtga 420 ccggcatcag atcaccatgc tcgaagtacc ctggcgctac agtgacgctc ttatgtatga 480 ggggtacgaa cgagctcaag cgcgcgatgg caaagaaatc gagtcctatt tagccctccg 540 ttcgcacgta atttcctccc cggctcagcc cgtggaggtg ccacttcccg ctgccctgga 600 cccacaggcc attgccgcgg acgagaattt attagctacc tcggcgcaac tctttgaaga 660 gccgcagttt cagcgctggt tactcgacca cgatcaagcg cacgtttaca tcgatcagat 720 ctcccaggcg caggaaagtc cgttggtctt gaaccgctat caacaacaag accggatcca 780 gaccattatc gataaagcga tctccgagat tttttcggca gagagtggtc agtcgtacgc 840 ccgccgcctg gaagaggcga cctccacctg gtcgctggcg ggcggctgga ggcggctaag 900 cgtgctttag ccgtggccct ggcgctcaaa ggcagtgagc gtggcggcaa gggaattccg 960 ttctgcgaag acttggtgcg ccaaagtatc gccatgcact accacgagga taagcagcaa 1020 gagcaagaag agtcccacgg gtcgttgatt atgaaaccgg cagagttcgc tgcgcgggtg 1080 caggcagcgc aacgccggcg gatgggataa agagctttca gcgattagta agatcaagca 1140 aggaacctgg catcaatccg ctttcggatt gcatcctgaa gcatttctga tatctcttca 1200 ttttgctgat cgctaatcgc tgactgctaa ctgtggaggg agcaatgtct tacccctcat 1260 ccgatcgtat tactttgtca ccctcgttga attctggcac aattctgtcg tgtccggagt 1320 gcgggatggg cttgtatatg ctgatcaaga aagtcactcg ggatggaact tttgaaggat 1380 cggtcaagcc cttggtcggg gtaccagagt atacccgtgg ctccatgccc aaaaagtgcc 1440 cgctgtgtaa ggtaggggag tggtggtatc cacctggtac cgttcacacc ttgcaatatg 1500 gttgggtggc ctagcacgtc gtgggtcgag tctttttggt ctgttcagtt ttgtgattgg 1560 cgtcgaggct gaacctgcca atctgttccc aagaggagct gagtacaatg aacgacgaca 1620 ctgccaagat caaaaatttt cacgcccatg tttactacga tcccgacact cgggaagtgg 1680 ctacgcgggt gcgcgatgac ttagccgaac gattcgatgt ggagctgggg cgctggcatg 1740 acaaacccat cggtcctcat ccgcagtcga tgtatcaagt caaattctcg ccggaagagt 1800 ttggcaagct cgttccgtgg ctgatgctcc atcaccaagg actggatgtg ctgatccatc 1860 cttcgaccgg cgatgacgtc ggagaccaca ccgaccaggc cttgtggcta ggagagaagc 1920 tggcattgaa tattgagttc ctacggcggg taagtactgc gagcccagga gacaaagcgg 1980 cgtgaatcac atataccatt ctgtcgtatt cactattagc tacgttgccg tctgtctggt 2040 cttcctcatt actttcccgg tccaggctga tcagccacca gtagatggga agacggtaac 2100 cgcccttaaa gacattctcg ccggcaccca ccgggcggag tctgataaag ttcgcgatca 2160 ataccgccat ccgctggaga ccctcatgtg gttcgggatc agagacgata tgaccgtggt 2220 ggaaatctgg ccagggggtg gctggtacac cgatatcctg gcgccatttc tcaaagagcg 2280 gggggtgtat tacgctgcgg ctcctgaaac tgcgcaaccg ttcaaagaaa agctggtagc 2340 aagtcccctc ttgtatggta aggtcattgt gaccgaattg gccccaccga caaaactggc 2400 ggttgcgcct gaggggtctg ccgatatggt actgactttc cgtaacgtcc ataactggat 2460 gaatcgcgga tatgccgatg aggtgttcaa ggcgatgtac cgagccttga agccgggagg 2520 agttttggga gtcgttgaac accgcgggaa tcttgctctg ccacaagatc cccaagccgt 2580 gtccgggtat gtaactgagg accatgtgat taagcttgct gaagcggcga attttcagtt 2640 tgtggcccgc tccgaaatca acgcgaaccc aaaagatacc aaggattatc cccaaggcgt 2700 gtggtcttta cccccagtgc tgcggctgaa ggacgtggac cgggagaaat atctggccat 2760 tggtgaaagt gatcgtatga ccctaaaatt cgtcaagccg gtcaccaaat aaagcgatag 2820 ttggctgagc aacacgccgt gggtgtgatg atgggtgctg cccacggaaa taaaccagaa 2880 ggaggatatc tgtatggcga gtccgcaact gcaaacggca attcaggcat tcaaaacggt 2940 cggggaggaa atggcgaaag ccacggacat gaggagtatg cgcgcggtga tggaaaagat 3000 cgcggttcca gccccgccag acgtcaagtg taccccggtc aatgcgggcg gtgtgccggc 3060 tgaatggatt gttgcccccg gcgcggctga ggatcgcttc ctcctgtacc tgcatggtgg 3120 tggctacgtc ctcggctcga ttaacactca tcgtgagatg atctctcgca tgtcgcgggc 3180 agcgggcgtg cgagcgcttg ctctggagta tcggcttgcc ccggagagcc cattcccggc 3240 cgcagtcgac gacgcgacgg cggcctaccg ctggttgctg tcccaggggg ccaagcctgc 3300 gcgcacagtg attgccggcg actccgccgg gggagggcta gcgcttgcca ccttagtggc 3360 tctgcgagat gccaagctgc ctctccctgc ggcaggggtt tgtctctcgc cttgggccga 3420 catggaagga gttggcgcgt ccatgacgag caaagcgaaa gaggatccgg tcgtgcaaaa 3480 agaaggactc ttaggcatgg ccaagctata tctgggtggg gccgatccca agacacccct 3540 tgccgcgccg ctgcacgccg atttgcgcgg gctgccgccg ttgcttattc aggtcggttc 3600 cgccgagacc ctgctcgatg attctacccg tgtggctgag cgggccaaag ccgctggagt 3660 caaagtggac ctggaggtgt ggaacgagat gatccacgtc tggcagctct tcgccccgtt 3720 cctgccggaa ggacaagagg caattgccaa gatcggcaag tttatccgcg agcacacggc 3780 gtagccccaa caatcggtga aattggtacg cgagaggacg ccggaaatta tccacctccc 3840 gtagtttgcg cttgcatgct tcctgggagc gcgcccatct tgggcgctgt tcgggcgggc 3900 gggacgcccg cgctcccggc gagggaggtt acgcctcact gcgactgctg tacgctagtg 3960 gaccctcggc gtcctacgtg ttctcaggct tggtaaactt gcgcaagaaa ttcttcagat 4020 gagtgactaa tgaggcactg tgcgcttctc ctgggtgcga ctcgctctca gggtcagaag 4080 gtccttgcgg gcgagcttcc caccacgaca cctccccgat gtgcacgggc aagattttct 4140 gcaggtagaa cgacaccatg tgatcattgg tgtgccggcc caggctgcga gcaatgggaa 4200 taccttgatc ctgacacaag tagtaggtag cgccgacatc gtcgagcgac ttcatctgca 4260 gatacaaaaa accccgccgg agcggggttt tttacaactt attcagcaaa ttaaggcggc 4320 ggaaacggaa aggtcggaat gtgctgcagg catgcaagct ggcggaatca gtcattgcg 4379 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ORF2 F <400> 4 gcgtcacgac atatggcgag tccgcaactg ca 32 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ORF2 R <400> 5 gcgtcaggtc tcgagcgccg tgtgctcgcg gataa 35

Claims (9)

Esterase protein consisting of the amino acid sequence of SEQ ID NO: 1.
A gene encoding the esterase protein of claim 1.
The gene of claim 2, wherein the gene is composed of the nucleotide sequence of SEQ ID NO: 2.
A recombinant vector comprising the gene of claim 2 or 3.
A transformant incorporating the recombinant vector of claim 4 into a host cell.
The transformant according to claim 5, wherein the host cell is a prokaryotic or eukaryotic cell.
The transformant according to claim 6, wherein the prokaryotic cell is E. coli.
1) culturing the transformant of claim 5;
2) A method for producing an esterase protein, comprising recovering the esterase protein from the cultured transformant or the culture supernatant thereof.
The method of claim 8, further comprising purifying the recovered esterase protein of step 2).

Images