RU2451076C1 - METHOD FOR PREPARING PROTEINASE Ulp275 - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: strain Escherichia coli Russian National Collection of Industrial Microorganisms B-10996 is cultivated on a nutrient conditioned medium containing: peptone 2-4 wt %, yeast extract 1 - 2 wt % and water the rest in the presence of a selective antibiotic to stationary growth phase at temperature 20 °C to 30°C. The prepared is dissolved in a fresh portion of the same medium in the ratio 1:1 to 1:3. Simultaneously an inducer is added, and the cultivation is continued to for at least 4 hours. Synthesised proteinase is purified.

EFFECT: ensured preparation of enzymatic active proteinase U1p275 - a version of SUMO-proteinase U1p1 of yeast Saccharomyces cerevisiae which contains a catalytic domain of proteinase U1p1 and comprises a sequence of 6 histidine residues on the C-terminal.

9 ex

Description

The invention relates to the field of biotechnology and relates to a method for producing a biologically active recombinant proteinase, an integral part of which is the sequence of Ulp1 proteinase of the yeast Saccharomyces cerevisiae.

The need for recombinant proteins produced biotechnologically in some cases requires the use of non-standard approaches. The method for producing the target protein in the form of a hybrid with a helper protein is sometimes more effective than the traditional method of expressing the target protein itself. (Shatzman and Rosenberg, 1987, Methods Enzynol., 152, 661-673); [Murby et al., 1991, Biotechnol. Appl. Biochem., 14, 336-346; Martinez et al., 1995, Biochem. J., 306, 589-597; Murby et al., 1996, Protein Express. Purif., 7, 129-136]; Chopra et al., 1994, Gene, 144, 81-85; Fox et al., 2001, Protein Sci., 10, 622-630]; [Belagaje et al., 1997, Protein Sci, 6, 1953-1962; Hosfield & Lu, 1999, Anal Biochem, 269, 10-6; Jenny et al., 2003, Protein Express Purif, 31, 1-11 [DiGuan et al., 1988, Gene, 67, 21-30; Sharma et al., 1991, Biotechnol. Appl. Biochem., 14, 69-81].

In most cases, obtaining the target protein by the hybrid protein method involves the use of the processing (processing) stage of the hybrid protein (consisting of the helper protein and the target protein) to extract a part of it that is a mature target protein from its composition. Processing is usually carried out with the help of proteinases, allowing to cleave the target protein from the composition of the hybrid protein. In order to ensure processing, a special sequence (site) recognized by the proteinase is introduced into the docking area of the helper protein and the target protein.

SUMO-system for obtaining the target protein by the method of hybrid proteins. involves the use of SUMO helper protein and S. cerevisiae yeast Ulp1 proteinase [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86].

The yeast proteinase Ulp1 of S. cerevisiae belongs to the cysteine proteinase family and is a 621 amino acid residue protein consisting of at least two domains, a conserved C-terminal proteinase proper (432-621) and a less conserved regulatory N-terminal domain (1- 432). In yeast cells, Ulp1 processes the C-terminal sequence of the SUMO protein encoded by the Smt3 gene (-GGATY) with the formation of the mature form (-GG), and also deconjugates SUMO from the ε-amino groups of the target protein lysine. That is, the proteinase is capable of processing both peptide and isopeptide bonds connecting the SUMO protein and the target protein. For yeast cells, these Ulp1 functions are vital [Li & Hochstrasser, 1999, Nature, 398, 246-51].

The main variant of SUMO proteinase, widely used for processing hybrid proteins, is the variant Ulp1 (403-621) p [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86; Butt et al., 2005, Protein Expr. Purif., 43, 1-9; Lee et al., 2008, Protein Sci., 17, 1241-1248].

In addition to the ability to process SUMO proteins, Ulp1 (403-621) p proteinase has additional technological advantages, namely: high specific activity (1: 10000), manifested in a wide range of conditions, including pH (from 5.5 to 10.5), temperature (from 4 ° C to 37 ° C), ionic strength (over 0.15 M NaCl), in the presence of 2 M urea or 0.1 M guanidine chloride, etc. [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86 ; Butt et al., 2005, Protein Expr. Purif., 43, 1-9].

Distinctive features of most SUMO systems, including SUMO proteinase (Ulp1 (403-621) p) and a hybrid protein, which includes the SUMO protein sequence, are: a high level of expression and solubility of the hybrid protein, the presence of biological activity in the hybrid protein, high processing efficiency and specificity, the possibility of arbitrary changes in the N-terminal sequence of the target protein, a significant simplification and cheapening of the purification process of the target protein [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86; Butt et al., 2005, Protein Expr. Purif., 43, 1-9].

Another variant of SUMO proteinase, GST-Ulp1C275, is a fusion protein comprising a GST protein sequence and a sequence of 275 C-terminal amino acid residues of Ulp1 proteinase [Li et al., 2005, eth Enzymol, 398, 457-467]. This variant of Ulp1 proteinase has catalytic activity in vivo and in vitro [Li & Hochstrasser, 2003, J. Cell Biol., 160, 1069-1081; Mossessova & Lima, 2000, Mol Cell, 5, 865-876]. Unlike the Ulp1 (403-621) p variant (calculated pI = 6.49), the Ulp1C275 variant has an isoelectric point in the alkaline region (calculated pI = 9.06), which allows proteinase purification using the CM-Sephadex sorbent (Amersham). A method for biosynthesis and purification of GST-Ulp1C275 proteinase has been developed, which allows one to obtain about 600 μg of purified protein from 1 L of a culture of a strain of bacteria expressing this protein [Li et al., 2005, Meth Enzymol, 398, 457-467].

The task of the invention is to expand the arsenal of methods for producing catalytically active variants of Ulp1 proteinase.

The problem is solved by:

- design of the strain Escherichia coli VKPM B-10996 - producer of Ulp275 proteinase - a variant of SUMO proteinase that includes the catalytic domain of Ulp1 proteinase and contains at the C-terminus a sequence of 6 histidine residues;

- development of a method for producing Ulp275 proteinase, including culturing the Escherichia coli strain VKPM B-10996 at a temperature of from 20 ° C to 30 ° C in a nutrient medium KS containing (wt.%): peptone - from 2 to 4, yeast extract - from 1 up to 2, water is the rest, in the presence of a selective antibiotic to a stationary phase of growth, followed by dilution of the resulting culture with a fresh portion of the same medium in a ratio of 1: 1 to 1: 3 while introducing the inductor and continuing cultivation in the presence of the inductor for at least 4 hours followed by cleaning synthesized proteinase by metal chelate chromatography.

The method in General

Seed, which is a cell of the bacterial strain Escherichia coli VKPM B-10996, grown at a temperature of 20 ° -30 ° C for 8 to 18 hours on a KC medium containing (wt.%): Peptone - from 2 to 4, yeast extract - from 1 to 2, water - the rest, in the presence of a selective antibiotic in the required concentration, is inoculated into the medium of the same composition in an amount of 1 / 200-1 / 500 of the volume of the medium and cultivated for 16-20 hours. Then the grown culture is bred a fresh portion of the same medium in a ratio of 1: 1 to 1: 3, while at the same time introducing isopropyl-β-D-1 as an inductor -thiogalactopyranoside (IPTG) to a final concentration of 0.1-1.0 mM or lactose to a final concentration of 0.5-1.5 wt.% and cultured for at least 4 hours. The result is not less than 100 mg of Ulp275 proteinase with 1 l of a culture of cells of the strain Escherichia coli VKPM B-10996.

The grown cells are separated from the culture medium and destroyed using a suitable disintegrator. Isolation and purification of Ulp275 proteinase from the cell lysate is performed by metal chelate chromatography using a Ni-NTA agarose sorbent [Porath et al., 1975, Nature, 258: 598-599].

The resulting preparation of Ulp275 proteinase has a purity of at least 92% and, when incubated for 1 hour at a temperature of 30 ° C, provides the processing efficiency of the control HSG protein of at least 93% at a ratio of 1: 100, at least 90% at a ratio of 1: 200 and not less than 87% at a ratio of 1: 500.

Example 1. Construction of plasmids pUC18-ULP275

The DNA sequence encoding Ulp275 proteinase is amplified by PCR using the laboratory strain S. cerevisiae Y618 as a chromosomal DNA template [Kartasheva et al., 1996, Yeast, 12, 1297-1300]. The amplification primers are N447 (5'-atatggatcctctttggaaaggaaacataagga) and N448 (5'-attagaattctttaatgcatcggttaaaatcaaatgggcaat). An amplified DNA fragment of 842 bp elute from agarose gel using a Qiagen kit (cat. No. 28706), digest with BamHI and EcoRI restriction enzymes and clone in the laboratory plasmid pUC18-His, a derivative of plasmid pUC18 containing a sequence of unique restriction sites NcoI, BamHI, EcoRI Xhol in the modified polylinker as well as a DNA sequence flanked by EcoRI and Xhol sites encoding the amino acid sequence of 6 histidine residues.

The result is the plasmid pUC18-ULP275, in which the nucleotide sequence of the ULP275 gene is confirmed by sequencing [Zimmermann et al., 1988, FEBS Lett., 233, 432-436].

Plasmid pUC18-ULP275 contains a unique BamHI / XhoI DNA fragment encoding Ulp275 proteinase, which includes the catalytic domain of Ulp1 proteinase and a C-terminal amino acid sequence containing 6 histidine residues that allows the purification of Ulp275 proteinase using metal chelate chromatography.

Example 2. Construction of the plasmid pET-ULP275

The design is carried out in several stages:

1) DNA of the vector pET-15b (+) (Novagen) is cleaved at the unique MluI and NcoI sites, the resulting 827 bp DNA fragment. elute from agarose gel and clone in plasmid pET-22b (+) (Novagen), cleaved at the same sites. As a result of cloning, plasmid pET-22-15 is obtained.

2) The DNA fragment located between the restriction sites NcoI and BamHI is removed from the composition of plasmid pET-22-15. For this, the plasmid pET-22-15 DNA is digested with restriction enzymes NcoI and BamHI, the sticky ends formed are blunt using the E. coli Klenow DNA polymerase I fragment and ligated using T4 phage DNA ligase. The result is the plasmid pET-NBl, in the composition of which both of the aforementioned restriction sites are restored.

3) In the pET-NBl plasmid, the reading frame of the polypeptide initiated from the ATG codon in the sequence of the NcoI site is changed. For this, the plasmid pET-NBl DNA is cleaved with the restriction enzyme NcoI, the sticky ends formed are blunt using the Klenow fragment of E. coli DNA polymerase I and ligated with T4 phage DNA ligase. The result is the plasmid pET-NB2, which is then used to clone the Ulp275 proteinase gene.

4) Plasmid pUC18-ULP275 (Example 1) was digested with restriction enzymes BamHI and XhoI, resulting in a 855 bp DNA fragment. elute from the gel as in Example 1 and ligate with the DNA of plasmid pET-NB2 digested with restriction enzymes BamHI and XhoI. The result is the plasmid pET-ULP275 with a size of 6262 bp containing the nucleotide sequence encoding the proteinase Ulp275.

Plasmid pET-ULP275 is used for the biosynthesis of Ulp275 proteinase.

Example 3. Construction of E. coli strain B-10996

As the recipient strain, the E. coli strain BL21 (DE3) - VKPM B-6954 is used. Plasmid pET28-ULP275 (Example 2) was introduced into the cells of the recipient strain using a transformation process using CaCl ₂ reagent [Maniatis et al., 1984, Moscow, Mir]. The transformant was selected on a selective medium containing the antibiotic ampicillin at a concentration of 100 μg / ml.

As a result of transformation, a strain is obtained that is deposited in the All-Russian Collection of Industrial Microorganisms as Escherichia coli VKPM B-10996.

The cells of this strain contain the expression plasmid pET-ULP275 and synthesize Ulp275 proteinase in response to introducing an IPTG inducer into the culture medium.

Example 4. Cloning of the SMT3 gene of S. cerevisiae yeast

The SMT3 gene encoding S.cerevisiae yeast SUMO protein is amplified by PCR using the S.cerevisiae strain as a chromosomal DNA template as in Example 1. Amplification is carried out in two stages. First, two overlapping DNA fragments are amplified, for which the following pairs of primers are used:

Fragment 1, size 130 bp:

N450 (5'-atatccatggaaaagagatct gactcagaagtcaatcaagaa )

N454 (5'-cttgaagaaaatctctgaa)

Fragment 2 of 210 bp in size:

N453 (5'-ttcagagattttctttcaag)

N452 (5'-atatcaattggatccaccaatctgttctctctgtga)

Amplified DNA fragments are eluted from an agarose gel, as in Example 1, and their mixture is used for PCR ligation. To do this, PCR amplification is carried out on a mixture of fragments 1 and 2 as a matrix. The amplification primers are N450 and N452. The resulting 400 bp DNA fragment from PCR elute from agarose gel, digest with restriction enzymes NcoI and MunI, and clone in the laboratory plasmid pUC18-His (Example 1), digested at the NcoI and EcoRI sites. Cloning yields the pUC18-SUMO plasmid containing the DNA sequence encoding S.cerevisiae yeast SUMO protein.

The cloned SMT3 gene is then amplified by PCR using the plasmid pUC18-SUMO as the DNA template. PCR primers are N452 and N533 (5'-aaaagagatctcatcatcatcatcatcatcatcatcatcatggatccgactcagaagtcaatcaa). The resulting 400 bp DNA fragment from PCR elute from the agarose gel as in Example 1, digest with BglII and EcoRI restriction enzymes, and clone in the pUC18-SUMO plasmid cleaved at the NcoI and EcoRI sites. The resulting plasmid pUC18-HIS10-SUMO contains a DNA sequence encoding a S.cerevisiae yeast SUMO protein, the N-terminal of which is connected to a sequence of 10 histidine residues.

Example 5. Construction of plasmids pET28-HSG

The design is carried out in several stages:

1) pEGFP plasmid DNA (CLONTECH Laboratories, Inc. GenBank Accession #: U76561) was digested with NotI restriction enzyme, the sticky ends formed were blunt using the enzyme of the Klenow fragment of E. coli DNA polymerase I and ligated with phage T4 DNA ligase in the presence of the XhoI linker (5'-gctcgagc). The result is the plasmid pEGFP-XhoI, in which the structural gene of the EGFP protein is located inside the DNA fragment bounded by restriction sites BamHI and XhoI.

2) DNA of plasmid pEGFP-XhoI was digested at unique NcoI and XhoI sites, the resulting DNA fragment containing the nucleotide sequence of the structural gene of the EGFP protein was eluted from the agarose gel and cloned into the pUC18-SUMO plasmid (Example 4), which was digested at the same sites. Cloning yields the vector pUC18-SUMO-EGFP.

3) DNA of plasmid pUC18-HIS10-SUMO was digested at unique NcoI and XhoI sites, the resulting DNA fragment was cloned into plasmid pET28b (+) (Novagen), which was digested at the same sites. Cloning yields the plasmid pET28-HIS10-SUMO.

4) pUC18-SUMO-EGFP plasmid DNA is digested at unique EcoRI and XhoI sites, the resulting DNA fragment containing the nucleotide sequence of the structural gene of the EGFP protein is eluted from the agarose gel and cloned into the pET28-HIS10-SUMO plasmid, which is cleaved at the same sites. Cloning yields the plasmid pET28-HSG.

Plasmid pET28-HSG is used to obtain the Escherichia coli strain for biosynthesis of the control HSG fusion protein, which is used to determine the enzymatic activity of Ulp275 proteinase.

Example 6. Construction of E. coli strain ECR-HSG

The construction of the E. coli strain ECR-HSG is carried out as described in example 3, except that the cells of the recipient strain E. coli BL21 (DE3) are transformed with the plasmid pET28-HSG (example 5), and transformants are selected on selective medium containing the antibiotic kanamycin sulfate at a concentration of 40 μg / ml. As a result of transformation, E. coli strain ECR-HSG is obtained, the cells of which contain the plasmid pET28-HSG and, in response to introducing an IPTG inducer into the culture medium, a hybrid HSG protein is synthesized, which includes the N-terminal sequence of 10 histidine residues fused to the sequence S.cerevisiae yeast SUMO protein fused to the EGFP protein sequence.

Example 7. Biosynthesis, Isolation, Purification and Storage of Ulp275 Proteinase

Three individual colonies of the strain Escherichia coli VKPM B-10996 are inoculated into a 750 ml flask containing 50 ml of KS medium and 100 μg / ml ampicillin and grown for 18 hours on a shaker at a speed of 250 rpm at a temperature of 25 ° C. Then, a fresh portion of KS medium (100 ml) and an IPTG inducer (final concentration of 0.3 mM) were added to the flask and incubated under the same conditions for 6 hours.

Cells are harvested by centrifugation (15,000 g) and suspended in 5 ml of cell lysis buffer (LB buffer) composition: 50 mM Na _x H _{3 x} PO ₄ , pH 8.0; 300 mM NaCl; 20 mM imidazole, pH 8.0. Lysozyme is added to the cell suspension to a concentration of 1 mg / ml and the mixture is kept for 30 minutes in ice. The suspension is voiced in ice 6 times for 30 seconds with interruptions of 0.5-1.0 minutes at an ultrasonic device power of 200-300 watts. The lysate is clarified by centrifugation for 30 minutes at 10,000 g at a temperature of 4 ° C.

A column containing 1 ml of Ni-NTA agarose (Qiagen) is washed with 5 ml of LB buffer, after which a clarified lysate is applied to the column at a rate of 1 ml / min. The column is then washed sequentially with 10 ml LB buffer, 10 ml wash buffer (50 mM Na _x H _{3 x} PO ₄ , pH 6.0, 300 mM NaCl, 10% glycerol, imidazole at a concentration of 20 mM), and 5 ml wash buffer containing imidazole at a concentration of 150 mM, pH 6.0. After this, the protein is eluted from the column using 2 ml of washing buffer, pH 6.0, containing imidazole at a concentration of 450 mM.

Tween-20 was added to the resulting eluate to a concentration of 0.1% and dialyzed against a buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM dithiothreitol and 0.1% Tween-20.

The concentration of the purified protein is determined spectrophotometrically by measuring the absorption of the protein solution at a wavelength of 280 nm. For the calculations, the extinction coefficient K _ex = 0.94 calculated based on the amino acid composition of the protein is used.

The result is 100 mg of Ulp275 proteinase with 1 l of cell culture of a strain of Escherichia coli VKPM B-10996. To determine the purity of the obtained preparation of proteinase Ulp275 using the method of denaturing electrophoresis in polyacrylamide gel (PAGE-DDS-Na) [Laemmli, 1970, Nature 227: 680-685]. To analyze the obtained electrophoregram, the Sorbfil 1.0 Video Densitometer program is used, for which the stained gels are scanned after electrophoresis, the resulting image is entered into a computer, and the amount of protein in the spot is determined on each track using the specified program. As comparison standards, highly purified preparations of the studied proteins are used, a known amount of which is applied to adjacent tracks in the same gel. The purity of the Ulp275 proteinase preparation evaluated in this way is at least 92%.

The dialyzed preparation of proteinase Ulp275 is diluted 2 times with glycerol and stored at -18 ° C.

Example 8. Biosynthesis, Isolation and Purification of the HSG Hybrid Protein

The biosynthesis, isolation and purification of the HSG fusion protein is carried out as in Example 7, except that the ECR-HSG strain is cultured and the culture medium contains an antibiotic kanamycin sulfate at a concentration of 40 μg / ml. Under the conditions of induction, cells of the laboratory strain ECR-HSG accumulate HSG fusion protein in an amount of at least 10% of the total cell protein. As a result of isolation and purification, an HSG fusion protein preparation with a concentration of 5 mg / ml and a purity of at least 95% is obtained.

Example 9. Determination of the catalytic characteristics of the proteinase Ulp275

The catalytic characteristics of the Ulp275 proteinase preparation are determined by enzymatically treating the HSG fusion protein preparation with proteinase at various proteinase / protein ratios. For this, aliquots of the Ulp275 proteinase solution are added to the preparation of the renatured HSG fusion protein at a concentration of 0.8 mg / ml so that the ratio of the concentration of the enzyme and the substrate is 1: 100, 1: 200, 1: 500. The reaction is carried out at 30 ° C for 1 hour at a pH of 8.0-9.0. The reaction is stopped by introducing ¼ volume of distilled water, 1/200 volume of 0.25 M EDTA, pH 8.0 and 1/160 volume of a solution of 2.5 M sodium acetate, pH 4.5.

The effectiveness of proteolytic processing of HSG protein is evaluated by the results of electrophoresis of HSG protein in SDS page-SDS-Na, for the analysis of electrophoregrams use the Sorbfil 1.0 Video Densitometer program. The efficiency of proteolytic processing of HSG protein is at least 93% at a ratio of 1: 100, at least 90% at a ratio of 1: 200, and at least 87% at a ratio of 1: 500.

Thus, a method has been developed for the production of Ulp275 proteinase, the level of production of which is at least 100 mg / l, which significantly exceeds the level of production of GST-Ulp1C275 proteinase (600 μg / l). Ulp275 proteinase, in addition to the catalytic domain of Ulp1 proteinase, contains in its composition an amino acid sequence of 6 histidine residues, which allows it to be purified by metal chelate chromatography using a Ni-NTA agarose sorbent and to obtain a Ulp275 proteinase preparation with a purity of at least 92%.

Claims (1)

A method of producing proteinase Ulp275, comprising cultivating the strain of Escherichia coli VKPM B-10996 at a temperature of from 20 ° C to 30 ° C in a nutrient medium KS containing, wt.%: Peptone from 2 to 4, yeast extract from 1 to 2, the rest of the water , in the presence of a selective antibiotic to a stationary growth phase, followed by dilution of the resulting culture with a fresh portion of the same medium in a ratio of 1: 1 to 1: 3 with simultaneous introduction of the inductor and continued cultivation in the presence of the inductor for at least 4 hours, followed by purification of the synthesized prot einases.