RU2441072C1 - FUSION PROTEIN, ESCHERICHIA COLI STRAIN BEING FUSION PROTEIN PRODUCER AND METHOD FOR PRODUCING METHIONINE-FREE HUMAN INTERFERON ALPHA-2b OF SUCH FUSION PROTEIN - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: construction of recombinant plasmid DNAs containing a structured gene of human interferon alpha-2b under control of a sensitive promoter enables producing Escherichia coli strain to enable synthesis in the form of an insoluble precursor protein of mature methionine-free human interferon alpha-2b. In the precursor protein, a sequence of mature methionine-free human interferon alpha-2b is fused with a sequence of SUMO (SMT3) Saccharomyces cerevisiae yeast protein. What is produced is the Escherichia coli strain providing biosynthesis of ULP275 proteinase for enzymatic processing of the precursor protein of methionine-free interferon. What is presented is a method for producing methionine-free interferon which provides carrying out the coupled processes of renaturation, disulphide link formation and enzymatic segregation of methionine-free human interferon alpha-2b from the precursor protein under ULP275 proteinase.

EFFECT: invention provides the range of products for preparing human methionine-free IFN-α2.

3 cl, 14 ex

Description

The invention relates to the field of biotechnology and relates to a method for producing a methionine-free (not containing N-terminal methionine) human interferon alpha-2b.

Interferon alpha-2b is a variant of human interferon alpha-2 (IFN-α2), characterized by the presence of a guanine residue (G) at position 137 of the coding region [Kaluz et al., 1993 Acta Virol. 37: 97-100; Kaluz et al., 1994, Acta Virol. 38: 101-4; Lee et al., 1995, J Interferon Cytokine Res. 15: 341-9], which leads to the appearance of an arginine residue (Arg) in the protein sequence.

IFN-α2 belongs to the class of cytokines with antiviral activity and is a member of the alpha interferon family secreted by almost all types of virus-infected human cells [Pfeffer et al., 1998, Cancer Research 58: 2489-2499].

Recombinant IFN-α2 is used to treat viral and tumor diseases [Samuel, 2001, Clinical Microbiology Reviews, 14: 778-809; Schadendorf et al., 2009, Annals of Oncology, 20 (Supplement 6): vi41-vi50; Pfeffer et al., 1998, Cancer Research 58: 2489-2499], including for the treatment of solid tumors such as bladder cancer, kidney cancer, HIV-induced Kaposi's sarcoma and others [Torti, 1988, J. Clin. Oncol., 6: 476-483; Vugrin et al., 1985, Cancer Treat. Rep., 69: 817-820; Rios et al., 1985, J. Clin. Oncol., 3: 506-512]. IFN-α2 are the main therapeutic agents used to treat chronic forms of hepatitis B and C [Clark V., Nelson D.R., 2009, Clin Liver Dis, 13: 351-363].

The N-terminal amino acid residue of natural IFN-α2 is cysteine linked by a disulfide bond to 98 protein cysteine [Bodo G., Fogy I., 1985, The Interferon System, pp.23-27; Wetzel et al., 1981, J. Interfer. Res., 1: 381-90]. At the same time, in some of the molecules of recombinant IFN-α2 isolated from Escherichia coli (E. coli) cells, an additional methionine (formylmethionine) residue remains at the N-terminus, which makes recombinant IFN-α2 a modified protein.

Excess N-terminal methionine can affect the stability and immunogenicity of proteins [Ben-Bassat A., Bauer K., 1987, Nature 326, 315], and also in some cases leads to the loss of their biological activity [Rabbani et al., 1988, J Biol Chem, 263: 1307-1313]. Due to the fact that since 2005, the European Pharmacopoeia has limited the production and use of preparations containing modified IFN-a2 in European countries [Eur. Pharm., 5 ^th ed .: 2004], the problem of removing the N-terminal methionine from the composition of IFN-α2 of bacterial origin has become even more important.

In E. coli cells, which remain one of the main producers of recombinant proteins, the removal (processing) of the N-terminal methionine is determined by the radius of the side radical of the amino acid residue of the synthesized protein following methionine [Hirel et al., 1989, Proc Natl Acad Sci USA, 86 (21 ): 8247-51; Dalbøge et al., FEBS Lett. 1990; 266 (1-2): 1-3]. However, such processing is often incomplete in the case of protein overexpression [Yasueda et al., 1991, Appl Microbiol Biotechnol, 36: 211-215; Hwang et al., 1999, Biochem J, 338: 335-342].

Among the enzymatic methods for removing the N-terminal methionine from the composition of recombinant proteins include:

- removal of methionine using methionine aminopeptidase [Shapiro et al., 1988, Anal. Biochem 175: 450-461; Solbiati et al., 1999, J Mol Biol, 290: 607-14; Liao et al., 2004, Protein Science, 13: 1802-1810];

- methods based on the biosynthesis of an elongated protein, between the N-terminal methionine and the mature part of which a short sequence of a proteinase recognition site is introduced. Subsequent proteinase treatment of the elongated protein removes the introduced sequence along with the N-terminal methionine [US5665566; Belagaje et al., 1997, Protein Sci, 6: 1953-1962; Hosfield, T., Lu Q., 1999, Anal Biochem, 269: 10-6; Jenny R.J. et al., 2003, Protein Express Purif, 31: 1-11].

The inventive method is based on the biosynthesis in E. coli cells of the precursor of methionine-free IFN-α2 containing the sequence of mature interferon fused to the sequence of the yeast protein SUMO (Small Ubiquitine-like protein Modifier) [Johnson et al., 1997, EMBO J, 16 : 5509-5519; Muller et al., 1998, EMBO J, 17: 61-70], belonging to the ubiquitin-like protein family (UPB).

UPB are labels of a protein nature that are used in the eukaryotic cells to label other proteins, as a result of which the latter change their functional activity [Hochstrasser M., 2000, Science, 289: 563-564]. In addition to ubiquitin, the UPB family includes SUMO, Rub1, Hub1, ISG15, Apg12, Apg8, Urm1, Ana 1a and Ana 1b proteins. During labeling, the C-terminal UPB residues are conjugated to the lysine B-amino groups on the surface of the modified proteins [Jentsch S., Pyrowolakis G., 2000, Trends Cell Biol, 10: 335-342; Muller et al., 2001, Nat Rev Mol Cell Biol 2: 202-210]. The majority of biotechnological methods for using proteins of the UPB family, with the exception of APG12 and URMI, are based on their natural ability to be synthesized in the form of elongated precursors undergoing post-translational processing leading to the release of the universal G-Gly C-terminal sequence [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86].

The yeast genome Saccharomyces cerevisiae (S. cerevisiae) contains the SMT3 gene located between the nucleotide positions 1469403-1469708 of chromosome IV [NCBI database]. The SMT3 gene encodes a protein SMT3 - yeast SUMO. Yeast SUMO is synthesized as a 101-amino acid precursor, of which 98 are mature proteins, of which residues 13-98 are important for the formation of its native structure [Mossessova E., Lima C. D., 2000, Mol Cell, 5: 865-876 ]. Eukaryotic SUMOs, including yeast SMT3, have a similar three-dimensional structure, which is similar to that of ubiquitin and is characterized by tightly laid beta layers wrapped around a single alpha helix [Bayer et al., 1998, J Mol Biol, 280: 275-286]. Like other members of the UPB family, SUMO proteins from various organisms are synthesized as precursors containing C-terminal extensions of 2 to 12 amino acid residues, which are a continuation of the conservative C-terminal Gly-Gly motif [Müller et al., 2001, Nature, 2: 202-210]. Despite various C-terminal extensions and a rather low degree of homology of amino acid sequences, for example, human yeast SUMO and SUMO-1 (47%), S. cerevisiae yeast proteinase Ulp1 is able to process both protein precursors [Mossessova E., Lima C. D., 2000, Mol. Cell, 5: 865-876].

Proteinase Ulp1 belongs to the ULP cysteine proteinase family. The catalytic domain of Ulp1 proteinase is localized in the C-terminal region of the protein; in particular, its C-terminal fragment of 275 amino acid residues has full enzymatic activity [Li S.-J., Hochstrasser M., 2003, J Cell Biol, 160: 1069-1081 ; Butt et al., 2005, Protein Express Purif, 43: 1-9] (hereinafter, ULP275 proteinase). Like other members of this family in vivo, Ulp1 proteinase deconjugates SUMO and labeled target proteins, and is also responsible for processing the native SUMO precursor. The main best-known features of Ulp1 proteinase are two: 1) the action of Ulp1 proteinase is directed to the hydrolysis of peptide or isopeptide bonds connecting the conserved C-terminal Gly-Gly dipeptide of mature SUMO and the amino acid residue of the target protein; 2) by binding to the target protein, the ULP family proteinases recognize not a separate site, but the three-dimensional structure of SUMO proteins [Butt et al., 2005, Protein Express Purif, 43: 1-9; Wilkinson, 1997, FASEB J, 11: 1245-1256; Chang C. H., Back S. H., 1999, Biochem Biophys Res Commun, 266: 633-640].

The property of the native Ulp1 proteinase and its C-terminal fragment to recognize the SUMO protein and its derivatives as part of conjugates and precursors and to carry out their highly specific and efficient processing, almost independently of the nature of the amino acid residue (excluding proline), coupled to the conserved C-terminal Gly-Gly dipeptide , is the basis for the use of artificially created expression SUMO systems. Their distinguishing feature is the biosynthesis of target proteins in the form of hybrid precursors containing in the N-terminal region the sequence of the SUMO protein or its derivatives, deleted, for example, during proteolytic processing in vitro [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86; Marblestone et al., 2006, Protein Science, 15: 182-189]. SUMO systems are used to: 1) increase the expression of proteins in the cells of eukaryotic and prokaryotic organisms; 2) increasing the solubility of expressed proteins; 3) facilitating the process of protein purification due to the inclusion of affinity N-terminal polypeptides in their composition; 4) obtaining proteins with altered N-terminal residues [Malakhov et al., 2004, J Struct Funct Genom, 5: 75-86].

A fusion protein is known consisting of yeast SUMO protein and human IkB protein [US6872551], which is a recombinant product, it is purified from E. coli cell lysates and digested with Ulp1 proteinase. However, unlike IFN-α2, the IkB protein at the junction with SUMO does not have a cysteine residue forming a disulfide bond. Thus, Ulp1-processing of the SUMO-IkB hybrid results in the release of the usual amino-terminal amino acid residue of the IkB protein, rather than a strong structural element containing a disulfide bond, as is required in the case of the native non-methionine IFN-α2. For this reason, the data on the processing efficiency of hybrid proteins like SUMO-IkB could not guarantee that Ulp1 processing will be effective with respect to the SUMO hybrid and native non-methionine IFN-α2. Information on the biosynthesis of the fused protein IFN-α2 with the SUMO protein was not found in the information sources.

Thus, the properties of the Ulp1 SUMO proteinase system described above can be summarized as follows: 1) it is known that Ulp1 proteinase is capable of hydrolyzing the peptide bond connecting the conserved C-terminal Gly-Gly dipeptide of mature SUMO with any subsequent amino acid residue (except proline), which in turn, may be linked by a single peptide bond to the following amino acid residue; 2) it is known that Ulp1 proteinase is able to hydrolyze an isopeptide bond connecting the conserved C-terminal Gly-Gly dipeptide of mature SUMO with an amino acid residue of a protein (lysine), which, in turn, can be linked by two peptide bonds to neighboring amino acid residues of the protein; 3) it was not known whether Ulp1 proteinase is able to hydrolyze a peptide bond connecting the conserved C-terminal Gly-Gly dipeptide of mature SUMO with the amino acid residue of the protein (cysteine), which is bound to other amino acid residues of the protein by both peptide and disulfide bonds, i.e. is part of an unusual structural element of the protein. However, it was precisely this Ulp1 proteinase activity that was necessary for the hydrolysis of the peptide bond between the C-terminal dipeptide of SUMO and the N-terminal cysteine of native human IFN-α2.

The closest analogue of the claimed strains is a recombinant strain of E. coli KCCM 10053 - producer of human interferon alpha-2b containing N-terminal methionine [KR20000065580].

The closest analogue of the proposed method is the method [KR20000065580] for the preparation of human bezmethionine-interferon alpha-2b by digestion with methionine aminopeptidase from the composition of the precursor protein methionine-containing interferon synthesized in cells of E. coli strain KCCM 10053. The main disadvantage of this method is the need for a long (12-20 hours) enzymatic treatment of the protein precursor. Further difficulties may be caused by the subsequent conversion of the methionine-free protein to a biologically active state under the conditions necessary for the formation of disulfide bonds [Morehead et al., 1984, Biochemistry, 23: 2500-7], as well as the process of separating the target methionine-free interferon from the methionine-containing precursor, due to their insignificant physico-chemical differences.

The task of the claimed group of inventions is to expand the arsenal of methods for producing human methionine-free IFN-α2.

The problem is solved by constructing:

- the gene encoding the hybrid protein SUMO-2b is the precursor of methionine-free interferon alpha-2b, an integral part of which is the sequence of human methionine-free interferon alpha-2b fused to the sequence of the SUMO yeast SUMcharomyces cerevisiae protein;

- the bacterial strain Escherichia coli VKPM B-10879 - the producer of the hybrid protein SUMO-2b - the precursor of methionine-free interferon alpha-2b person;

and development

- a method for producing human methionine-free interferon alpha-2b by microbiological synthesis and isolation of the hybrid protein SUMO-2b, the precursor of methionine-free interferon alpha-2b, a component of which is a human sequence of methionine-free interferon alpha-2b, fused to the sequence of SACcharomyces cerevisiae yeast SUMO protein, enzymatic cleavage of its composition of methionine-free interferon by treatment with proteinase from the ULP family under conditions conducive to the formation of interferon properly closed disulfide bonds.

An essential part of the SUMO-2b fusion protein is the SUMIN fusion protein, which comprises the sequence of methionine-free interferon alpha-2b fused to the amino acid sequence of the yeast SUMO protein from 13 to 98 amino acid residues. However, in the composition of the hybrid protein containing the sequence of the SUMIN fusion protein, an additional N-terminal extension of the fusion protein may be present, which is not essential for the implementation of the proposed method.

The inventive method is based on the biosynthesis of the hybrid protein SUMO-2b, the precursor of methionine-free interferon alpha-2b, containing the sequence of the fused protein SUMIN, and the subsequent release of methionine-free interferon alpha-2b from the composition of the precursor during proteolytic processing using ULP275 proteinase.

The basis of the proposed method is based on the fact that we have established that, in contrast to proteinases, the activity of which is inhibited in the vicinity of the structural element of the protein containing the disulfide bond [Hubbard et al., 1994, Protein Sci, 3: 757-768; Hubbard et al., 1998, Protein Engineering, 11: 349-359], ULP275 proteinase is able to efficiently hydrolyze a peptide bond near such a structural element. This ULP275 proteinase activity, which we have never previously described, allows us to efficiently and correctly process the SUMO-2b fusion protein, in which the SUMO sequence is connected by a peptide bond to the first amino acid residue of methionine-free interferon, which is connected to other amino acid residues of the protein by both peptide and disulfide bonds. As a result, the enzymatic treatment of the SUMO-2b fusion protein with ULP275 proteinase does not release the usual amino-terminal sequence, but the whole N-terminal structure of the methionine-free IFN-α2 containing a correctly closed disulfide bond.

This is the first discovered property of the SUMO system, consisting of the inventive SUMIN fusion protein and ULP275 proteinase, supplements the list of previously known properties of SUMO systems and expands the possibilities of their application.

The property of the SUMO system that we found is used in the claimed method by subjecting the SUMO-2b hybrid protein containing correctly established disulfide bonds to the enzymatic treatment, which allows enzymatic cleavage of the precursor of methionine-free IFN-α2 simultaneously with its renaturation and leads to a significant reduction in the duration of the process of obtaining methomethine-free IFN-γ α2.

The enzyme ULP275 proteinase for the implementation of the proposed method is obtained using the engineered E. coli strain ECR-ULP275 (example 9). The biosynthesis, isolation and purification of ULP275 proteinase is carried out as described in example 12.

For the implementation of the proposed method, E. coli strains are constructed: the inventive VKPM B-10879 and laboratory Origami-SUMO-2b are producers of the hybrid protein SUMO-2b - the precursor of methionine-free interferon alpha-2b.

The process of obtaining the inventive strain-producer of the hybrid protein SUMO-2b consists of several stages.

Step 1. Construction of recombinant plasmids.

The construction of recombinant plasmid DNA for the expression of the gene for the SUMO-2b fusion protein is based on the laboratory vector pET-22-15, which is a derivative of the vectors pET-22b (+) and pET-15b (+) (Novagen), which provides inducible gene expression in E cells .coli under the control of the T7 RNA polymerase promoter. The constructed plasmid pET-SUMO-2b, in addition to the vector part, contains a DNA fragment of 800 base pairs in size that encodes the structural gene of the hybrid protein SUMO-2b, the precursor of human methionine-free interferon alpha-2b.

Stage 2. Transformation of recipient strains.

As recipient strains, E. coli BL21 (DE3) and Origami 2 (DE3) (Novagen) strains using the T7 phage polymerase RNA gene on the chromosome are used. Plasmid pET-SUMO-2b is introduced into the cells of these strains using a transformation process. Cells of both strains are prepared for transformation using CaCl ₂ treatment [Maniatis et al., 1984, Moscow, Mir]. Transformed strains are selected on a selective medium containing the antibiotic ampicillin-sulfate [Maniatis et al., 1984, Moscow, Mir]. As a result of the transformation, E. coli strains are obtained: the inventive one, constructed on the basis of the recipient strain BL21 (DE3), and laboratory - based on Origami 2 (DE3). The obtained strains in response to introducing an IPTG inducer into the culture medium [Maniatis et al., 1984, Moscow, Mir] are able to synthesize the hybrid protein SUMO-2b, the precursor of human methionine-free interferon alpha-2b.

The inventive strain was deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) as a strain of Escherichia coli VKPM B-10879 - producer of the precursor of methionine-free interferon alpha-2b person (hybrid protein SUMO-2b).

The properties of the claimed strain VKPM B-10879.

Morphological.

Gram-negative, slightly mobile sticks with rounded ends 1.5-2.0 μm in length.

After 12 hours of growth at 37 ° C on agar Luria [Maniatis et al., 1984, Moscow, Mir] forms whitish translucent colonies with a diameter of 1.5-2.5 mm; the surface of the colonies is smooth, the edges are even, the structure is homogeneous, the consistency is pasty, easily suspended in water.

After 40-48 hours of growth at a temperature of 37 ° C on M9 medium [Maniatis et al., 1984, Moscow, Mir] forms grayish-whitish translucent, slightly convex with a shiny surface colony with a diameter of 0.5-1.5 mm.

Physiological and biochemical.

Aerob, gelatin does not thin, indole does not form.

As a carbon source, it metabolizes glucose, sucrose and various organic acids, in some cases alcohols: ethanol, glycerin.

As a source of nitrogen, both mineral salts in ammonium and nitrate forms and organic compounds in the form of amino acids, peptone, tryptone, yeast extract, etc. are used.

As mineral salts, potassium phosphates, magnesium sulfate, sodium chloride, iron and manganese sulfates, chalk are used.

Resistant to the antibiotic ampicillin at a concentration of 100 μg / ml.

Grows at a temperature of 20-40 ° C. PH 5.0-9.0.

The inventive strain VKPM B-10879 and laboratory Origami-SUMO-2b in response to induction using IPTG or lactose synthesize the hybrid protein SUMO-2b - the precursor of non-methionine interferon alpha-2b person.

Storage conditions.

In a lyophilized state at a temperature of -70 ° C.

For the implementation of the method, bacterial strains of E. coli are used that carry DNA fragments in the plasmid DNA that encode the synthesis of the hybrid protein SUMO-2b, the precursor of human methionine-free interferon alpha-2b.

The strains are cultured in a suitable nutrient medium, including sources of carbon, nitrogen and mineral salts, usually used to grow E. coli cells at temperatures from 24 to 37 ° C [Maniatis et al., 1984, Moscow, Mir]. Upon reaching the cultures of the strains of the early logarithmic growth phase, the IPTG inducer in a concentration of 0.1 to 2 mM or lactose in a concentration of 0.5 to 3% is introduced into the culture medium. After 0.5-10 hours of growth, the cells of producer strains accumulate the target SUMO-2b protein in the form of insoluble inclusion bodies in an amount of 5 to 30% of the total cell protein. Insoluble inclusion bodies are isolated and purified, and the synthesized SUMO-2b fusion protein contained in them is subjected to dissolution [RU2319502].

SUMO-2b protein renaturation is carried out as described [RU2319502], except that ULP275 proteinase enzyme is introduced into the renaturation mixture.

At this stage, three processes are simultaneously carried out in the total renaturation mixture, namely: the end of renaturation and the formation of disulfide bonds in the target protein SUMO-2b, as well as the enzymatic removal of SUMO from its composition under the action of the added ULP275 proteinase. The obtained target product — renatured human methionine-free interferon alpha-2b containing correctly closed disulfide bonds, is subjected to final purification.

Purified human methionine-free interferon alpha-2b has the following characteristics: a purity of at least 96%, the sequence of the first five N-terminal amino acids is identical to the sequence of the native human methionine-free IFN-α2, specific activity is 2.0 × 10 ⁸ IU / mg.

Example 1. Cloning of the gene for human interferon alpha-2b.

The human interferon alpha-2b gene is amplified in a PCR reaction using primers N466 (ataccatggaaaagagatgtgatctgcctcaaacccacagagctctggtagccgt) and N467 (atctcgagtcattctttacttctcttatatagg1 of site 5 of the 50 changes in the amino acid sequence of the encoded protein. The amplified DNA fragment with a size of 510 base pairs (bp) was eluted from the agarose gel using a Qiagen whale (Qiagen, cat. No. 28706), digested with restriction enzymes NcoI and XhoI, and cloned into the vector pUC18-NX containing the modified polylinker plasmids pUC18 sites NcoI and XhoI.

The result is the plasmid pUC18-IFN2b, in which the primary structure of the cloned human interferon alpha-2b gene is confirmed by determining its nucleotide sequence according to standard methods [Zimmermann J, Voss H, Schwager C, Stegemann J, Ansorge W. FEBS Lett. 1988; 233: 432-436] using standard pUC primers.

Plasmid pUC18-IFN2b carries the human interferon alpha-2b gene, the sequence of which contains a unique restriction enzyme site, XmaJ1.

Example 2. Cloning of the S.cerevisiae yeast SMT3 gene and construction of the SUMO-2b fusion protein gene.

The SMT3 gene is amplified by PCR using the S. cerevisiae Y618 strain as a chromosomal DNA template [Kartasheva et al., 1996, Yeast 12: 1297-1300]. Amplification is carried out in two stages. First, two overlapping DNA fragments are amplified, for which the following pairs of primers are used:

Fragment 1 with a size of 129 bp:

N450 (5'-atatccatggaaaagagatctgactcagaagtcaatcaagaa)

N454 (5'-cttgaagaaaatctctgaa)

Fragment 2, size 230 bp:

N453 (5'-ttcagagattttctttcaag)

N468 (5'-tacctaggctgtgggtttgaggcagatcacatccaccaatctgttctctgtga).

Amplified DNA fragments are eluted from an agarose gel as in Example 1, and their mixture is used for PCR ligation. To do this, PCR amplification is carried out on a mixture of fragments 1 and 2 as a matrix. The amplification primers are N450 and N468. The resulting 400 bp DNA fragment from PCR elute from agarose gel, digest with restriction enzymes NcoI and XmaJI and clone in plasmid pUC18-IFN2b (Example 1) containing the interferon alpha-2b gene and digested at the same sites. Cloning yields the plasmid pUC18-SUMO-IFN2b, in which the nucleotide sequence of the cloned SMT3 gene is confirmed by sequencing.

The resulting plasmid pUC18-SUMO-IFN2b contains a unique 803 bp NcoI / XhoI DNA fragment encoding the SUMO-2b fusion protein gene (SEQ ID NO: 1), of which the SUMIN fusion protein (SEQ ID NO: 2) is an integral part , which is a sequence of non-methionine interferon alpha-2b person, precision fused to the sequence of the SUMO protein of the yeast Saccharomyces cerevisiae.

Example 3. Construction of the vector pET-22-15.

The DNA of the vector pET-15b (+) (Novagen) is cleaved at the unique MluI and NcoI sites, the resulting DNA fragment 827 bp in size. elute from agarose gel, and clone in plasmid pET-22b (+) (Novagen), cleaved at the same sites.

Cloning yields the vector pET-22-15, which is used to clone the SUMO-2b fusion protein gene.

Example 4. Cloning of a DNA sequence encoding a proteinase ULP275.

The DNA sequence encoding the ULP275 proteinase is amplified by PCR using the laboratory strain S. cerevisiae Y618 as a chromosomal DNA template. The amplification primers are N447 (5'-atatggatcctctttggaaaggaaacataagga) and N448 (5'-attagaattctttaatgcatcggttaaaatcaaatgggcaat). An amplified DNA fragment of 842 bp elute from agarose gel as in Example 1, digest with BamHI and EcoRI restriction enzymes and clone into pUC18-His vector containing a DNA sequence in the polylinker flanked by EcoRI and XhoI sites and encoding a polypeptide consisting of 6 histidine residues.

The result is the plasmid pUC18-ULP275, which confirms the structure of the ULP275 gene by determining its nucleotide sequence by standard methods.

Plasmid pUC18-ULP275 contains a unique BamHI / XhoI DNA fragment encoding the ULP275 proteinase that carries a sequence of 6 histidine residues at the C-terminus that is responsible for the binding of the protein to the Ni-NTA sorbent under conditions of metal chelate chromatographic purification.

Example 5. Obtaining the plasmid pET-SUMO-2b.

The recombinant plasmid pET-SUMO-2b is a set of SalI / NcoI DNA fragment of the vector plasmid pET-22-15 (example 3) with a size of 5420 bp and NcoI / XhoI of the DNA fragment of the plasmid pUC18-SUMO-IFN2b (Example 2) of 803 bp containing the SUMO-2b gene, a hybrid precursor of bezmethionine interferon alpha 2b.

To obtain plasmid pET-SUMO-2b, plasmid pUC18-SUMO-IFN2b (Example 2) was digested with restriction enzymes NcoI and XhoI, resulting in a 803 bp DNA fragment. elute from the gel and ligate with the DNA of the pET-22-15 vector digested with restriction enzymes NcoI and SalI. Ligation is carried out using T4 phage DNA ligase. The result is the plasmid pET-SUMO-2b size 6223 p.

Plasmid pET-SUMO-2b is expression, it is used for the biosynthesis of the hybrid protein SUMO-2b, which is necessary for the production of recombinant human methionine-free interferon alpha-2b. In the plasmid pET-SUMO-2b, the gene for the SUMO-2b fusion protein is under the control of the T7 phage promoter.

Example 6. Obtaining the plasmid pET28-ULP275.

Plasmid pET28-ULP275 is obtained on the basis of the vector pET28b (+) (Novagen) in several stages. First, a DNA fragment located between the NcoI and BamHI restriction sites is removed from the vector. For this, the plasmid pET28b (+) DNA is digested with restriction enzymes Ncol and BamHI, the sticky ends formed are blunt using the enzyme of the Klenow fragment of E. coli DNA polymerase I and ligated with T4 phage DNA ligase. As a result, plasmid pET28-NB1 is obtained, in the composition of which both used restriction sites are restored. The next step is to change the reading frame of the polypeptide initiated from the ATG codon, which is part of the NcoI site. For this, the plasmid pET28-NB1 DNA is digested with the restriction enzyme NcoI, the sticky ends formed are blunt using the enzyme of the Klenow fragment of E. coli DNA polymerase I and ligated with T4 phage DNA ligase. The result is the plasmid pET28-NB2, which is used to clone the proteinase gene ULP275.

To obtain plasmid pET28-ULP275, plasmid pUC18-ULP275 (Example 4) was digested with restriction enzymes BamHI and XhoI, resulting in a 855 bp DNA fragment. elute from the gel as in Example 1 and ligate with the DNA of the vector pET28-NB2 digested with restriction enzymes BamHI and XhoI. The result is the plasmid pET28-ULP275 size 6091 bp

Plasmid pET28-ULP275 is used for biosynthesis of ULP275 proteinase. In the plasmid pET28-ULP275, the ULP275 proteinase gene is under the control of the T7 phage promoter.

Example 7. Construction of the inventive strain of E. coli VKPM B-10879.

As the recipient strain, the E. coli strain BL21 (DE3) - VKPM B-6954 is used. Plasmid pET-SUMO-2b (Example 5) was introduced into the cells of the recipient strain using a transformation process using the CaCl ₂ reagent [Maniatis et al., 1984, Moscow, Mir]. The transformant is selected on a selective medium containing the antibiotic ampicillin sulfate.

As a result of the transformation, the claimed strain is obtained, which is deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) as Escherichia coli VKPM B-10879.

Strain VKPM B-10879 carries the expression plasmid pET-SUMO-2b and, in response to introducing an IPTG inducer into the culture medium, is able to synthesize the SUMO-2b fusion protein, which is used to produce methionine-free interferon alpha-2b.

Example 8. Construction of a laboratory strain of E. coli Origami-SUMO-2b.

To construct a laboratory E. coli strain, the E. coli Origami 2 (DE3) strain (Novagen), VKPM B-10187, carrying the T7 phage R7 polymerase gene on the chromosome, is used as the recipient strain. The construction of the strain of E. coli Origami-SUMO-2b is carried out as in example 7.

The result is a laboratory strain of E. coli Origami-SUMO-2b, which carries the expression plasmid pET-SUMO-2b and, in response to introducing IPTG inducer into the culture medium, is able to synthesize the SUMO-2b fusion protein.

Example 9. Construction of E. coli strain ECR-ULP275.

The E. coli strain ECR-ULP275 was obtained by the method as in example 8, except that the plasmid pET28-ULP275 was used to transform the E. coli BL21 (DE3) recipient strain - VKPM B-6954 (example 7).

As a result of the transformation, E. coli strain ECR-ULP275 is obtained. This strain carries the expression plasmid pET28-ULP275 and, in response to introducing an IPTG inducer into the culture medium, is able to synthesize ULP275 proteinase, which is used to obtain methionine-free interferon.

Example 10. Biosynthesis and isolation of the hybrid protein SUMO-2b from cells of the inventive strain VKPM B-10879.

The strain is grown in flasks containing 50 ml of 2xYT medium each (in wt.%): Tryptone - 1.6, yeast extract - 1, NaCI - 0.5, water - the rest, containing antibiotic kanamycin at a concentration of 40 μg / ml for 16-18 hours on an orbital rocking chair at a speed of 200-300 rpm at a temperature of 37 ° C. Then, 50 ml of fresh 2xYT medium containing the antibiotic ampicillin sulfate at a concentration of 100 μg / ml and an IPTG inducer at a concentration of 80 μM were added to the flasks. After this, cultivation is continued for 3 hours.

Cellular biomass is separated from the medium by centrifugation (15000g).

From the obtained biomass, inclusion bodies containing an insoluble form of the SUMO-2b protein, the precursor of methionine-free interferon, are isolated and washed. Isolation and washing of inclusion bodies is carried out in the same way as the isolation and purification of an insoluble form of interferon [RU2319502]. The result is a coarse fraction of insoluble inclusion bodies containing the precursor of methionine-free interferon with a yield of at least 10% of the wet weight of cell biomass.

Example 11. The biosynthesis of a hybrid protein SUMO-2B cells of a laboratory strain of Origami-SUMO-2B.

The biosynthesis of the SUMO-2b fusion protein by the cells of the laboratory strain Origami-SUMO-2b is carried out as in Example 10, except that the producer strain is the laboratory strain Origami-SUMO-2b. Under the conditions of induction, the cells of the laboratory strain Origami-SUMO-2b accumulate the target protein SUMO-2b in an amount of at least 10% of the total protein of the cells.

Example 12. Biosynthesis, isolation and purification of ULP275 proteinase.

2-3 individual colonies of transformed cells of the ECR-ULP275 strain are seeded in test tubes in 5 ml of 2xYT medium containing the antibiotic kanamycin at a concentration of 40 μg / ml and glucose at a concentration of 20 g / l and grown for 16-18 hours on an orbital shaker at a speed 200-300 rpm at a temperature of 37 ° C. Cells are harvested by centrifugation and suspended in 100 ml of fresh 2xYT medium containing kanamycin antibiotic at a concentration of 40 μg / ml. The cell suspension was transferred to flasks and cultured under previous conditions for 1 hour, after which an IPTG inducer was added to the growing culture to a concentration of 40 μM. Induction is carried out for 3 hours, culturing the cells under the same conditions.

Cells were collected by centrifugation (15000g) and suspended in 5 ml of cell lysis buffer (LB buffer) of 50 mM Na _x H _3-x PO ₄ , pH 8.0; 300 mM NaCl; 20 mM Imidazole pH 8.0; water is the rest. Lysozyme is added to the cell suspension to a concentration of 1 mg / ml and the mixture is kept for 30 minutes in ice. The suspension is voiced in ice 6 times for 30 seconds with 0.5-1.0 'breaks for cooling at an ultrasonic device power of 200-300 watts. The lysate is clarified by centrifuging it for 30 minutes at 10,000 g at a temperature of 4 ° C.

A column containing 1 ml of Ni-NTA agarose (Qiagen) is washed with 5 ml of LB buffer, after which a clarified lysate is applied to the column at a flow rate of 1 ml / min. The column is washed successively with 10 ml of LB buffer, 10 ml of washing buffer with a composition of 50 mM Na _x H _3-x PO ₄ , pH 6.0; 300 mM NaCl; 10% glycerin; water - the rest, containing Imidazole pH 6.0 at a concentration of 20 mm; and 5 ml of wash buffer containing Imidazole pH 6.0 at a concentration of 150 mm. After this, the protein is eluted from the column using 2 ml of washing buffer containing Imidazole pH 6.0 at a concentration of 450 mM. Tween-20 is added to the resulting eluate to a concentration of 0.1%.

The resulting eluate is dialyzed against a buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM dithiothreitol and 0.1% Tween-20.

The concentration of the eluted protein is measured spectrophotometrically at a wavelength of 280 nm. To calculate the protein concentration, the extinction coefficient Kex = 0.94 is used.

After measuring the concentration, the dialyzed preparation of the proteinase protein ULP275_ is diluted 2 times with glycerol and stored at -18 ° C.

Example 13. The preparation and purification of bezmethionine interferon alpha-2b person.

The preparation and purification of human interferon alpha-2b without the N-terminal methionine using the SUMO-2b fusion protein is carried out in several stages.

Step 1. Dissolution, renaturation and processing of the hybrid protein SUMO-2b

To the obtained suspension of inclusion bodies containing an insoluble form of the SUMO-2b protein (Example 10), dry guanidine hydrochloride (final concentration is 6 M) or urea (final concentration - 8 M), Tris-HCl solution, pH8.0 (final concentration) are added - 20 mm), EDTA (final concentration - 5 mm), dithiothreitol (final concentration - 50 mm). The resulting mixture was incubated at room temperature for 2 hours. The undissolved material is removed by centrifugation (15000 g), and the solution is subjected to sterilizing filtration through a membrane with a pore diameter of 0.22 μm.

SUMO-2b protein renaturation is carried out by diluting the resulting solution 100 times with a composition buffer: 20 mM Tris-HCl (pH 8.0), 35 mM NaCI, 0.8 M urea, 0.1% Triton X-114, 1 mM oxidized glutathione, 1 mM reduced glutathione, water - the rest. Renaturation is carried out for 18 hours at a temperature of + 5 ÷ 12 ° C and constant stirring at a speed of 80 rpm

After this time, a solution containing ULP-275 proteinase at the rate of 4 mg proteinase per 12 g of inclusion bodies is added to the renaturation mixture with stirring at a speed of 120 rpm. The resulting mixture was incubated for 3 hours at a temperature of + 12 ° C with constant stirring at a speed of 80 rpm

Enzymatic cleavage of SUMO-2b protein by ULP-275 proteinase is stopped by dilution and acidification of the reaction mixture. For this, the following components are added to the reaction mixture with stirring at a speed of 120 rpm in the indicated sequence:

- 0.25 M EDTA solution, pH 8.0 to a final concentration of 1 mm;

- purified water, cooled to a temperature of + 5 ° C, up to 25% of the volume of the renaturation mixture;

- 2.5 M sodium acetate solution, pH 4.5, to a final concentration of 12.5 mm.

The resulting mixture was filtered using a filter with a nominal pore size of 0.45 μm. The resulting solution of the target protein is called solution R.

Stage 2. Capture of the target protein

All subsequent stages of purification of non-methionine interferon alpha-2b person is carried out using an Akta Purifier (GE Healthcare) liquid chromatography system at a temperature of + 2 ÷ 8 ° C.

The target protein capture procedure was carried out using an XK 50/20 column (GE Healthcare) with a working volume of 250 ml containing Fast Flow carboxymethyl sepharose sorbent (GE Healthcare). The working flow rate is 30 ml / min. The column is equilibrated with 650 ml of B-8 buffer of 50 mM sodium acetate pH 5.0, 1 mM EDTA, water - the rest, after which a solution of the renatured and processed target protein is solution P. Solution. After applying the protein, the column is washed with 4 L of B-8 buffer . The target protein is eluted using a simple linear gradient of 0-100% B-9 buffer with 50 mM sodium acetate, 0.5 M sodium chloride, 1 mM EDTA, pH 5.5, water - the rest, a gradient volume of 1200 ml. The elution of methionine-free interferon alpha-2b is monitored by optical density at a wavelength of 280 nm. Obtained at this stage, the solution of methionine-free interferon alpha-2b is called - solution SM-1.

Step 3. Reverse phase chromatography

The procedure is carried out using a column with a working volume of 400 ml containing sorbent C 18. The working flow rate is 50 ml / min. The column is balanced with 700 ml of buffer A composition: 30% acetonitrile, 0.2% trifluoroacetic acid, water - the rest. After that, the solution CM-1 is applied to the column and the column is washed with 700 ml of buffer A.

Elution of non-methionine interferon alpha-2b is carried out with a complex linear gradient of 0-100% buffer. Composition: 80% acetonitrile, 0.2% trifluoroacetic acid, water - the rest. For elution use 3 l of buffer B. Elution is carried out sequentially according to the following scheme (buffer B in buffer A):

- 0-20% - 300 ml;

- 20-28% - 500 ml;

- 28-40% - 1.5 l;

- 40-60% - 600 ml;

- 60-100% - 100 ml.

The elution of the methionine-free interferon alpha-2b is monitored by measuring the optical density of the eluate solution at a wavelength of 280 nm. Upon reaching 50 mUE, 8 ml fractions are collected in glass tubes containing 4 ml of B-11 buffer. After elution, the column is washed with 700 ml of buffer B.

The collected eluate fractions were analyzed by HPLC. Fractions containing methionine-free interferon alfa-2b with a purity of at least 90% are combined and diluted 3 times with buffer B-11 of the composition: 12.5 mM sodium acetate, 1 mM EDTA, pH 4.5. The resulting solution is called - OF-1 solution.

Stage 4. Concentration

The procedure is carried out using an XK 50/20 column (GE Healthcare) with a working volume of 250 ml containing Fast Flow carboxymethyl sepharose sorbent (GE Healthcare). The working flow rate is 30 ml / min. The column was equilibrated with 650 ml of B-8 buffer, after which the OF-1 solution was applied and the column was washed with 650 ml of B-8 buffer. Elution is carried out at a flow rate of 15 ml / min with a simple linear gradient of 0-100% buffer B-9 with a length of 400 ml. The elution of the methionine-free interferon alpha-2b is monitored by measuring the optical density of the eluate solution at a wavelength of 280 nm. When a value of 50 mUE is reached, 10 ml fractions are collected in glass tubes. After elution, the column is washed with 350 ml of B-9 buffer.

The collected eluate fractions were analyzed by HPLC. Fractions containing the target protein with a purity of at least 96 are passed through a filter with a pore diameter of 0.22 μm, after which the resulting solution of methionine-free interferon alpha-2b is called - solution SM-2.

Step 5. Gel Filtration

The procedure is carried out using a column (GE Healthcare) with a working volume of 1700 ml containing Superdex-75 sorbent (GE Healthcare). The working flow rate is 5 ml / min. The column is balanced with 1.7 L of B-10 buffer of the composition: 25 mM sodium acetate, 150 mM sodium chloride, 0.5 mM EDTA, pH 5.1, water - the rest, after which a solution of SM-2 is applied and the column is washed 1.7 l of buffer B-10. The elution of the methionine-free interferon alpha-2b is monitored by measuring the optical density of the eluate solution at a wavelength of 280 nm. When a value of 30 mUE is reached, fractions are collected in glass tubes.

The collected eluate fractions were analyzed by HPLC. Fractions containing methionine-free interferon alpha-2b with a purity of not less than 96% are combined and passed through a filter with a pore diameter of 0.22 μm.

The result is a highly purified (with a purity of not less than 96%) preparation of human methionine-free interferon alpha-2b.

The authenticity, concentration and purity of the protein in the resulting preparation is analyzed by vertical polyacrylamide gel electrophoresis with / without the addition of DTT, with silver staining, as well as by HPLC [Eur. Pharm., 5 ^th ed .: 2004]. The described method allows to obtain at least 500 mg of methionine-free interferon alpha-2b from 10 g of the coarse fraction of inclusion bodies containing the protein SUMO-2b, the precursor of methionine-free interferon alpha-2b.

Example 14. Determination of the N-terminal sequence and the specific biological activity of interferon alpha-2b.

The sequence of the five N-terminal amino acids of the isolated and purified interferon alpha-2b is determined (Example 13). The analysis is carried out by the Edman method [Edman, 1950] on a Procise Sequencing System sequencer, model 492 (Applied Biosystems). The sequence determined by the analysis exactly coincides with the sequence of the first five amino acid residues of mature natural human interferon alpha-2.

The specific biological activity of the isolated and purified interferon alpha-2b was determined by the method of La Bonnardiere & Laude [1981] in a culture of transplantable MDBK cell lines (ATCC No. CCL-22) sensitive to alpha-type interferon in comparison with the international standard sample (MCO) ( WHO International Standard INTERFERON ALPHA 2b, (Human rDNA derived) NIBSC code 95/566) against the indicator virus. As an indicator virus, use the virus of vesicular stomatitis (BBC) strain "Indiana" GKV GU Research Institute of Virology named. D.I. Ivanovsky RAMS (deposit No. 600) with an infectious titer of at least 10 ^-5 TCD ₅₀ / ml or mouse encephalomyocarditis virus (EMC) STB GU Research Institute of Virology named after D.I. Ivanovsky RAMS (deposit No. 787) with an infectious titer of at least 10 ^-5 TCD ₅₀ in 1 ml.

The specific activity of the resulting interferon alpha-2b is 2.0 × 10 ⁸ ME / mg.

Thus, the claimed group of inventions allows:

- to simplify the process of obtaining biologically active non-methionine IFN-α2 through the use of an effective system for the enzymatic removal of N-terminal methionine;

- reduce labor costs, time and expense of reagents to obtain it due to the lack of the need for separate stages of renaturation of IFN-α2, the formation of disulfide bonds in it and the enzymatic removal of the N-terminal methionine;

- to facilitate the solution of the task of purification of native IFN-α2 from other reaction products due to the use of the highly efficient and specific proteinase ULP275 in the process of enzymatic cleavage, as well as due to a significant difference in the physicochemical properties of the methionine-free IFN-α2 and its hybrid precursor.

The claimed group of inventions includes descriptions of the engineered strain ECR-ULP275 - producing ULP275 proteinase, the conditions for its cultivation, as well as methods for the isolation and purification of the synthesized proteinase.

Claims (3)

1. The hybrid protein precursor of non-methionine interferon alpha-2b human, an integral part of which is the sequence of non-methionine interferon alpha-2b human, fused with the SUMO protein sequence of the yeast Saccharomyces cerevisiae. 2. The bacterial strain Escherichia coli VKPM B-10879 - producer of the protein precursor of methionine-free interferon alpha-2b person according to claim 1. 3. A method of producing a methionine-free interferon alpha-2b human by microbiological synthesis of the precursor protein of methionine-free interferon alpha-2b human followed by enzymatic cleavage of its composition methionine-free interferon, characterized in that the bacterial strain according to claim 2 is used as a producer of the protein precursor and for enzymatic cleavage of methionine-free interferon use proteinase ULP275.

Images