RU2728611C1 - Recombinant plasmid dna pf265 coding hybrid polypeptide containing human proinsulin, and bacterial strain escherichia coli - producer of hybrid polypeptide containing human proinsulin - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, specifically to recombinant production of therapeutic proteins, and can be used to produce recombinant human proinsulin. Recombinant proinsulin is obtained in a hybrid polypeptide, in which the human HGS protein fragment sequence, substrate of tyrosine kinase is connected through peptide linker with sequence GlyHis6GlySerArg with amino acid sequence of human proinsulin, with arginine as site of proteolysis between C-peptide and chain A. For this purpose, recombinant plasmid DNA pF265 and strain-producer Escherichia coli BL21/pF265 is used.

EFFECT: invention provides synthesis of a hybrid polypeptide with an expression level of not less than 4_5 % of the crude weight of the cell biomass, increases the portion of insulin in the hybrid protein to 49_5 % and increases efficiency of purifying the end product by eliminating the closely related Arg0-A-insulin admixture.

3 cl, 5 dwg, 4 ex

Description

Technology area

The invention relates to the field of biotechnology, in particular to genetic engineering. The invention provides a recombinant plasmid DNA for the production of recombinant human insulin and can be used for the preparation of drugs, in particular, insulins and their analogues for the treatment of diabetes mellitus.

Brief description of the invention

The invention relates to biotechnology. This invention can be used to obtain recombinant human proinsulin, which contains the B chain, C-peptide and A chain. The proposed recombinant plasmid DNA containing the hybrid tac-promoter, the terminator of the ribosomal operon E. coli , an artificial gene encoding the hybrid polypeptide, consisting of a short leader sequence of a human HGS protein fragment, a tyrosine kinase substrate, a peptide linker GlyHis6GlySerArg, an Arg proteolysis site, chain B, an Arg proteolysis site, a C-peptide, an Arg proteolysis site, and chain A. More details , proposed recombinant plasmid DNA pF265, encoding a hybrid polypeptide, in which the sequence of a fragment of the human HGS protein, a substrate of tyrosine kinase, is connected via a peptide linker with the sequence GlyHis6GlySerArg with the amino acid sequence of human proinsulin, with arginine as a peptidomolysis site between the C-A chain , with a molecular weight of 1.4 MDa (4537 bp), with holding:

- BglII / XhoI fragment of plasmid pBR322, including the β-lactamase gene (bla), which determines the resistance of bacterial cells to ampicillin; replication initiation site (ori);

- ROP gene regulating the copy number of the plasmid;

- XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter;

- EcoRI / HindIII fragment containing an artificial gene, in which the sequence of the short leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp is connected via a peptide linker with the sequence GlyHis6GlySerArg, with the amino acid sequence of proinsulin;

- HindIII / BglII fragment containing the ribosomal RNA operon terminator rrnB, the LacI transcriptional repressor, which regulates the transcription of the Tac promoter,

- unique recognition sites by restriction endonucleases with the following coordinates: EcoRI - 115, BamHI - 176, SpeI - 438, HindIII - 444, BglII - 1872, NdeI - 2476, AatII - 4468.

Also proposed is the Escherichia coli strain BL21 / pF265, a producer of a hybrid polypeptide with a human proinsulin sequence, transformed with a recombinant plasmid DNA according to the invention, and a hybrid polypeptide in which the sequence of a fragment of the human HGS protein, a substrate of tyrosine kinase, is linked through a peptide linker with the amino acid sequence GlySergis human proinsulin, with arginine as a proteolysis site between the C-peptide and the A chain, with a molecular weight of 1.4 MDa (4537 bp), obtained using the recombinant plasmid DNA according to the invention. The biosynthesis of a hybrid polypeptide is induced by isopropylthiogalactopyranoside, while the level of biosynthesis is not less than 4.5% of the mass of the wet sediment of the cell biomass.

The present invention makes it possible to increase the proportion of insulin in the hybrid polypeptide to 49.5% and increase the effectiveness of the desired product purification due to the elimination of the closely related impurity Arg ₀ -A insulin. The invention is aimed at obtaining highly productive bacterial strains - producers, the use of which can significantly reduce the cost of production of insulin and insulin analogues.

Prior art

Diabetes mellitus is currently the most serious medical and socio-economic problem around the world. The number of patients with type 1 diabetes mellitus is constantly growing, and effective insulin replacement therapy, as the main method of therapy for insulin-dependent diabetes mellitus, is of particular importance in this regard (1).

Insulin is a pancreatic hormone that regulates carbohydrate metabolism and maintains normal blood sugar levels. The needs for this drug cannot be met by animal insulin due to the limited raw material base. In addition, there is a need for the use in the treatment of diabetes of various insulin analogs that demonstrate a better therapeutic effect than natural insulin, a longer duration of action and an earlier onset of action in the body.

In this connection, the development of methods for producing genetically engineered insulins is an urgent medical problem.

Currently, the most promising technology is the production of insulin using the methodology of human proinsulin gene expression in Escherichia coli cells as part of hybrid polypeptides in the form of insoluble inclusion bodies (2). The structure of a single-chain precursor (hybrid polypeptide) expressed in known human insulin-producing strains is a leader peptide, Arg or Lys or Lys Arg proteolysis site, B chain, Arg Arg proteolysis site, C-peptide , "Lys Arg" proteolysis site, chain A (Fig. 1).

The need to include leader peptides in the hybrid polypeptide is associated with the low stability of human proinsulin in Escherichia coli cells , the half-life of which is 2 minutes (4). Glutathione transferase (3), immunoglobulin (IgG), the binding domain of protein A from S. aureus (4), interleukin-2 (5), etc. are used as leader sequences that protect proinsulin from proteolytic degradation.

The technological scheme for obtaining human insulin from a hybrid polypeptide is characterized by the following stages: increasing the biomass of cells of the producer strain, isolating inclusion bodies, denaturation of the hybrid polypeptide, renaturation of the hybrid polypeptide. The next stage of the technological process is enzymatic hydrolysis using a mixture of two enzymes: trypsin and carboxypeptidase B. Under the action of trypsin, the peptide bond is hydrolyzed mainly after arginine, while under the action of carboxypeptidase B, positively charged amino acids from the C-terminus of insulin (lysine and arginine) are cleaved. As a result of joint hydrolysis with trypsin and carboxypeptidase B, native insulin is formed.

The closest in technical essence to the proposed invention are recombinant DNA plasmids pPINS07 and pHINS11, which provide the synthesis of hybrid polypeptides containing the IgG-binding domain of staphylococcal protein A (6) and the N-terminal fragment of human interferon gamma (7), respectively.

RF patent No. 2144957 describes the E. coli JM109 / pPINS07 strain, providing the synthesis of a hybrid polypeptide with an expression level of at least 25-30%. The recombinant plasmid DNA pPINS07 described herein determines the synthesis of a hybrid polypeptide in which a single IgG-binding domain of staphylococcal protein A is linked via a His ₆ GlySerArg peptide linker to the amino acid sequence of human proinsulin. The advantages of the proposed construct are the high level of expression of the hybrid polypeptide and its efficient renaturation (refolding) and, as a consequence, the high yield of the correctly folded polypeptide. A significant drawback of this recombinant plasmid DNA pPINS07 is that it encodes a protein with a low insulin content of about 33% (6).

RF patent No. 2354702 describes the recombinant plasmid DNA pHINS11 and the E. coli strain JM109 / pHINS11, transformed with it. This plasmid DNA determines the synthesis of a hybrid polypeptide, in which the N-terminal fragment of human interferon gamma is connected through a peptide linker HisProGlySerHisHisHisHisGlySerArg with the amino acid sequence of human proinsulin and ensures its high expression. The use of these structures in the technological process makes it possible to obtain highly purified human insulin with a purity of at least 98% and an activity of at least 27.5 IU / mg. This producer strain is characterized by a high level of biosynthesis of the hybrid polypeptide and a higher proportion of insulin in the hybrid polypeptide (38%) in comparison with the recombinant plasmid DNA pPINS07 (33%), but the stage of renaturation of the produced hybrid polypeptide was insufficiently effective (7).

In general, the disadvantages of previously used genetic constructs for the expression of a hybrid polypeptide include:

Low yield of the final product - insulin. This is due to the fact that leader peptides are rather extended amino acid sequences and make up from 40 to 60% of the mass of the hybrid polypeptide.

Formation of closely related impurities ₀ -A-Arg insulin by hydrolysis with trypsin the peptide bond after lysine in position between C-peptide and A-chain (Fig. 1).

The essence of the present invention is to significantly reduce the size of the fusion protein by using a short leader sequence of 31 amino acids and changing the proteolysis site between the C-peptide and the A-chain to "Arg".

The present invention makes it possible to increase the proportion of insulin in the fusion protein to 49.5% and increase the effectiveness of the desired product purification due to the elimination of the closely related impurity Arg ₀ -A insulin. The invention is aimed at obtaining highly productive bacterial strains - producers, the use of which can significantly reduce the cost of production of insulin and insulin analogues.

The problem is solved by constructing the recombinant plasmid DNA pF265 and the Escherichia coli BL21 / pF265 strain transformed with it, providing the synthesis of a hybrid polypeptide with an expression level of at least 4.5% of the wet weight of the cell biomass.

Description of figures

FIG. 1 shows the structure of a single chain precursor (hybrid polypeptide) expressed in known human insulin-producing strains.

FIG. 2 shows the structure of a DNA sequence obtained by chemical synthesis.

FIG. 3 shows the arrangement of primers on plasmid pF173 for site-directed mutagenesis of the proteolysis site between the C-peptide and the A-chain.

FIG. 4 primary structure of the EcoRI / HindIII fragment of plasmid pF265 encoding a fusion protein. Start and stop codons are underlined, and restriction endonuclease recognition sites are indicated.

Fusion protein proteolysis sites are indicated in bold.

FIG. 5 shows a physical map of plasmid pF265. Restriction endonuclease sites are indicated, pBR322 ori - plasmid replication initiation site, Ptac - hybrid transcription promoter, rrnB - transcription terminator of E. coli ribosomal operon, leader peptide - MetLeuTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyLeuGlnAsp, peptide linose TGS, a fragment of the human protein HArglyS , Proinsulin is human proinsulin, LacI is a transcriptional repressor that regulates transcription of the Tac promoter, and primers Pr033 and Pr039.

Detailed description of the invention

Proposed is a recombinant plasmid DNA pF265 encoding a hybrid polypeptide in which the sequence of a fragment of the human HGS protein, a substrate of tyrosine kinase, is linked through a peptide linker with the sequence GlyHis6GlySerArg with the amino acid sequence of human proinsulin, with arginine as a proteolysis site between the C-peptide with a molecular weight of 1.4 MDa (4537 bp), containing:

- BglII / XhoI fragment of plasmid pBR322, including the β-lactamase gene (bla), which determines the resistance of bacterial cells to ampicillin; replication initiation site (ori);

- ROP gene regulating the copy number of the plasmid;

- XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter;

- EcoRI / HindIII fragment containing an artificial gene, in which the sequence of the short leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp is connected via a peptide linker with the sequence GlyHis6GlySerArg, with the amino acid sequence of proinsulin;

- HindIII / BglII fragment containing the ribosomal RNA operon terminator rrnB, the LacI transcriptional repressor, which regulates the transcription of the Tac promoter,

- unique recognition sites by restriction endonucleases with the following coordinates: EcoRI - 115, BamHI - 176, SpeI - 438, HindIII - 444, BglII - 1872, NdeI - 2476, AatII - 4468.

Moreover, in one of the variants, this recombinant plasmid DNA has a size of 4537 bp.

In addition, the proposed Escherichia coli strain BL21 / pF265, which is a producer of a hybrid polypeptide with a human proinsulin sequence, transformed with the recombinant plasmid DNA according to the invention.

A common drawback of hybrid polypeptides in the patents described in the prior art is the low proportion of insulin in the hybrid polypeptide and the presence of a Lys Arg proteolysis site between the C-peptide and the A-chain, allowing for the formation of a closely related Arg0-A-insulin impurity.

The authors of the present invention have found that by significantly reducing the size of the hybrid polypeptide by using a short leader sequence of 31 amino acids and changing the proteolysis site between the C-peptide and the A-chain to "Arg", high yields of the target product can be achieved. Additionally, a hybrid polypeptide is proposed, in which the sequence of a fragment of the human HGS protein, a substrate of tyrosine kinase, is linked via a peptide linker to the sequence GlyHis6GlySerArg with the amino acid sequence of human proinsulin, with arginine as a proteolysis site between the C-peptide and the A chain, obtained using a recombinant plasmid DNA according to the invention.

The leader peptide contains a short sequence of a fragment of the human protein HGS, a substrate of tyrosine kinase, which forms a pronounced spatial structure of the "alpha-helix" type. The presence of an N-terminal alpha-helical region in the leader peptide has a positive effect on the level of renaturation of the fusion protein.

According to the invention, when using the described recombinant plasmid DNA can be significantly increased proportion of insulin in the hybrid polypeptide, in this case to 49.5% and increase the effectiveness of the desired product purification due to the elimination of the closely related impurity Arg ₀ -A insulin. The present invention is aimed at obtaining highly productive bacterial producer strains, the use of which can significantly simplify the production process of insulin and insulin analogs and reduce the cost of purifying the target product.

The initial plasmid for the creation of the pF265 expression vector was the pF019 plasmid, which is a recombinant vector pBR322 (8), in which the tetracycline resistance gene was completely removed by molecular cloning methods (example 1).

At the next stage, a 1.6 kb DNA fragment was synthesized containing the following elements and restriction sites (Fig. 2):

- Tac promoter and Lac operator to control the expression of a hybrid polypeptide (9), flanked by XhoI and EcoRI restriction sites.

- The transcription terminator of the rnnB operon of the strain K-12 ER3413 (REGION: 4143199..4143361), in front of which is a HindIII restriction site.

- LacI gene of strain K-12 ER3413 (REGION: 365804 to 367006) with a BglII restriction site at the 3 'end.

The introduction of the LacI gene into an expression construct solves the problem of controlling the expression of a hybrid polypeptide using a wide range of host strains, including BL21, which is characterized by increased stability of recombinant polypeptides due to the removal of cellular proteases lon and ompT.

The synthesized DNA fragment and plasmid pF019 were incubated with restriction endonucleases XhoI and BglII for 3 hours at 37 ° C. The corresponding DNA fragments were isolated from the agarose gel using the Quiagen kit and ligated with T4 DNA ligase. After electroporation of the XL1-Blue strain of E. coli, the recombinant plasmid DNA isolated from the grown colonies was analyzed using PCR and sequencing methods.

Thus, an expression vector pF20 based on plasmid pBR322 was obtained, containing the Tac promoter, the rnnB terminator and the LacI gene encoding the transcriptional repressor of the Tac promoter, as well as the EcoRI and HindIII restriction sites for subsequent insertion of the gene encoding the hybrid half-peptide.

The DNA sequence of the hybrid polypeptide containing the IgG-binding domain of protein A from Staphylococcus aureus as the leader peptide, the peptide linker His6GlySerArg with the amino acid sequence of human proinsulin was excised from the plasmid pPIN07 (6) using EcoRI / HindIII restriction endonucleases and inserted into the corresponding sites expression vector pF20 in the manner described above, while in the resulting vector appeared a BamHI restriction site formed by the coding sequence of two amino acids of the peptide linker GlySer (GGATCC). As a result, a recombinant plasmid DNA pF100 was obtained.

At the next stage, a recombinant plasmid DNA pF173 was obtained after replacing the DNA sequence of the IgG-binding domain of protein A from Staphylococcus aureus with a DNA sequence encoding the shorter leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp, which is a fragment of the human protein HGS, a substrate of tyrosine kinte hepatic growth factor (example 2). The amino acid sequence LeuTyrTyrGluGlyLeuGlnAsp was localized in the alpha-helical region of the TKS protein (no. 3D structure in the PDB database: 3F1I). The presence of an alpha-helical region in the leader peptide facilitates efficient renaturation of the resulting hybrid polypeptide.

By the method of site-directed mutagenesis in the plasmid pF173, the codon "aag" at position 373-375 corresponding to the amino acid lysine of the proteolysis site "Lys Arg" between the C-peptide and the A-chain of proinsulin was removed (example 3).

As a result, a recombinant plasmid DNA pF265 encoding a hybrid polypeptide with the amino acid sequence of human proinsulin was obtained, characterized by the following features: it has a molecular weight of 1.4 MDa (4537 bp); consists of the following structural elements (Fig. 5): BglII / XhoI fragment of plasmid pBR322, including the β-lactamase gene (bla), which determines the resistance of bacterial cells to ampicillin; replication initiation site (ori); ROP gene regulating the copy number of the plasmid; XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter; EcoRI / HindIII fragment containing an artificial gene, in which the sequence of the short leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp is connected via a peptide linker GlyHis6GlySerArg to the amino acid sequence of human proinsulin; HindIII / BglII fragment containing the terminator of the ribosomal RNA operon rrnB, as well as the transcriptional repressor LacI, which regulates the transcription of the Tac promoter; contains unique recognition sites by restriction endonucleases with the following coordinates: EcoRI - 115, BamHI - 176, SpeI - 438, HindIII - 444, BglII - 1872, NdeI - 2476, AatII - 4468.

The advantages of the proposed recombinant plasmid DNA construct are the high proportion of insulin in the hybrid polypeptide (49.5%), the presence in the leader peptide of a sequence that forms a spatial structure of the "alpha-helix" type to improve the efficiency of renaturation of the hybrid polypeptide, modification of the proteolysis site between the C-peptide and A-chain, eliminating the formation of a closely related impurity Arg0-A-insulin during enzymatic hydrolysis of the resulting hybrid polypeptide.

To obtain a producer strain of a hybrid polypeptide with human proinsulin, electrocompetent cells of the recipient strain Escherichia coli BL21 were transformed with recombinant plasmid DNA pF265 by electroporation according to the described method (10) and plated on LB agar containing 100 μg / ml ampicillin.

The resulting Escherichia coli BL21 / pF265 producing strain after transformation with recombinant plasmid DNA according to the invention is characterized by the following features:

- Morphological features: cells are small, rod-shaped, gram-negative, non-spore-bearing, 1x3.5 microns in size, mobile, with well-distinguishable inclusion bodies after induction of hybrid polypeptide synthesis.

- Cultural features: when growing on agar medium LB, colonies are round, smooth, translucent, shiny, gray. The edge is even, the diameter of the colonies is 1-3 mm, the consistency is pasty. Growth in liquid media (LB, glucose minimal media) is characterized by even haze.

- Physiological and biochemical signs: cells grow at a temperature
4-42 ° C, optimum pH 6.8-7.6. As a source of nitrogen, both mineral ammonium salts and organic compounds are used: amino acids, peptone, tryptone, yeast extract. Glycerin, carbohydrates, amino acids are used as a carbon source for growth on a minimal medium.

- Antibiotic resistance: cells of the producer strain show resistance to ampicillin (up to 300 mg / ml) due to the presence of the β-lactamase (bla) gene in the plasmid.

The invention is illustrated by the following examples.

Example 1. Construction of an intermediate genetic construct pF019.

PCR product of 2.8 kb, obtained as a result of amplification of plasmid pBR322 with primers Pr033 (5 '- ccaacgtaacagatct (BglII) aacagctcgaactcgag (XhoI) ttgaagacgaaagggcctcg - 3') and Pr039 (5 '- ccaacgtaacagatct (BglII) from the gel, purified using the Qiagen kit. After incubation with restriction endonuclease Bgl II for 3 hours at 37 ° C, the purified DNA fragment was ligated with T4 DNA ligase and used to transform XL1-Blue E. coli strain (Agilent Technology, 200249) by electroporation. The correctness of plasmid DNA isolated from colonies grown on LB medium with ampicillin (100 μg / ml) was confirmed by sequencing. As described above, plasmid pF019 was obtained, which is a fragment of plasmid pBR322 with complete deletion of the tetracycline resistance gene.

Example 2. Construction of intermediate recombinant plasmid DNA pF173.

Primers pr096 (tcaacgtaacgaattct atg ctg tat tat gaa ggc ctg cag gac ggc agc agc cac cac catcatcatcatcatggatcccg ) and pr130 (tgcctggcggcagtagcgcg) were synthesized for the introduction of a short leader peptide into proinsulin. Primer pr096 contains an EcoRI restriction endonuclease recognition site; the region coding for the amino acid sequence of the leader peptide; sequence corresponding to the peptide linker His6GlySerArg construct pF100.

The reaction mixture (100 μl) for polymerase chain reaction (PCR) consisted of the following components:

10 μl 10x Pfu DNA Polymerase Buffer,

0.1 ng pF100 plasmid DNA,

1 L of 10 mM dNTP mixture,

0.5 l of each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (30 sec ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. The PCR product corresponding to 600 bp was excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit. Electrophoresis was performed in standard TBE (Tris-borate-EDTA) buffer using 1% agarose. DNA was visualized using the Fusion-SL2-400 gel documenting system.

The PCR product cut from the gel and plasmid pF100 were incubated with restriction endonucleases EcoRI and HindIII for 3 hours at 37 ° C. The corresponding DNA fragments (330 bp and 4.2 kbp) were isolated from agarose gel using the Quiagen kit and ligated with T4 DNA ligase. After electroporation of the XL1-Blue E. coli strain, the plasmid DNA isolated from the grown colonies was analyzed using PCR and sequencing methods.

Example 3. Construction of recombinant plasmid DNA pF265 by site-directed mutagenesis of plasmid pF173.

To modify the Lys Arg proteolysis site between the C-peptide and the A-chain of human proinsulin, oligonucleotides Pr237 (cgtggtatcgttgaacagtg) and Pr238 (ctgcagagaaccttccagag) containing a phosphate group from the 5'-end were synthesized (Fig. 3).

The reaction mixture (100 μl) for polymerase chain reaction (PCR) consisted of the following components:

10 l of 10x buffer for Pfu DNA polymerase,

0.1 ng plasmid DNA pF173,

1 l. mixtures of 10 mM dNTP,

0.5 l. each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (3 min ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. The PCR product corresponding in size to the plasmid pF173 (4.5 kb) was excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit. Electrophoresis was performed in standard TBE buffer using 1% agarose. DNA was visualized using the Fusion-SL2-400 gel documenting system.

To obtain the recombinant plasmid DNA pF265, the ends of the PCR product isolated from the gel were ligated using T4 DNA ligase (NEB). The ligation mixture (10 μl) was used to transform the BL21 strain by electroporation. After transformation, the colonies grown on a medium with ampicillin were selected, plasmids were isolated from them and analyzed by sequencing the hybrid polypeptide sequence. As a result, a recombinant plasmid DNA pF265 was obtained expressing human proinsulin as part of a hybrid polypeptide.

Example 4. Determination of the productivity of the hybrid polypeptide-producing strain.

An individual colony of E. coli BL21 cells containing the pF265 plasmid was inoculated with 2 ml of LB medium containing ampicillin at a concentration of 100 μg / ml, and grown in a thermal shaker at 37 ° C for 22 hours with stirring (170 rpm). After measuring the optical density OD _{600 of the} overnight culture, 40 ml of liquid LB medium containing 100 μg / ml ampicillin (OD starting ₆₀₀ = 0.1) were inoculated and grown for 1-2 hours at 37 ° C on an incubator shaker with stirring (180 rpm ) until the optical density reaches OD ₆₀₀ = (0.8 ± 0.2). 20 ml of culture was transferred to another flask (control without induction), 10 μl of 1M IPTG was added to the remaining 20 ml (final concentration of IPTG - 0.5 mM). After 4 hours of incubation on an incubator shaker with stirring (180 rpm), the cell cultures were centrifuged (15 min, 3000 rpm), the mass of the wet cell pellet was determined, and frozen. The content of the hybrid polypeptide in% of the wet sediment weight was measured by capillary electrophoresis. It was not less than 4.5% of the mass of the wet sediment of the cell biomass.

Sources of information:

1. King H, Aubert RE, Herman WH. Global burden of diabetes, 1995-2025: prevalence, numerical estimates, and projections. Diabetes care. 1998 Sep; 21 (9): 1414-31. PubMed PMID: 9727886.

2. Bairamashvili DI. Genetically engineered human insulin: successes and prospects. Ros chem (Zh Ros about-va im DI Mendeleev). 2005; XLIX (1): 34-45.

3. Berg H, Walter M, Mauch L, Seissler J, Northemann W. Recombinant human preproinsulin. Expression, purification and reaction with insulin autoantibodies in sera from patients with insulin-dependent diabetes mellitus. Journal of immunological methods. 1993 Sep 15; 164 (2): 221-31. PubMed PMID: 8370928.

4. Jonasson P, Nilsson J, Samuelsson E, Moks T, Stahl S, Uhlen M. Single-step trypsin cleavage of a fusion protein to obtain human insulin and its C peptide. European journal of biochemistry / FEBS. 1996 Mar 1; 236 (2): 656-61. PubMed PMID: 8612642.

5. Castellanos-Serra LR, Hardy E, Ubieta R, Vispo NS, Fernandez C, Besada V, et al. Expression and folding of an interleukin-2-proinsulin fusion protein and its conversion into insulin by a single step enzymatic removal of the C-peptide and the N-terminal fused sequence. FEBS letters. 1996 Jan 8; 378 (2): 171-6. PubMed PMID: 8549827.

6. Korobko VG, Boldyreva EF, Shingarova LN. Recombinant plasmid DNA pPINS07, encoding a hybrid polypeptide containing human proinsulin, and a bacterial strain Escherichia coli, a producer of a hybrid polypeptide containing human proinsulin: RF Patent No. 2144957; 1999.

7. Shmatchenko VV, Shmatchenko NA, Baidus AN. Recombinant plasmid DNA pHINS11 encoding fusion protein - human insulin precursor, Escherichia coli cell transformed with recombinant plasmid DNA pPHINS11, bacterial strain Escherichia coli JM109 / pHINS11 - producer of fusion polypeptide - human insulin precursor2006. http://bd.patent.su/2263000-2263999/pat/servl/servletc85e.html.

8. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, Boyer HW, et al. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene. 1977; 2 (2): 95-113. PubMed PMID: 344137. Epub 1977/01/01.

9.de Boer HA, Comstock LJ, Vasser M. The tac promoter: a functional hybrid derived from the trp and lac promoters. Proceedings of the National Academy of Sciences of the United States of America. 1983 Jan; 80 (1): 21-5. PubMed PMID: 6337371.

10. Lessard JC. Transformation of E. coli via electroporation. Methods in enzymology. 2013; 529: 321-7. PubMed PMID: 24011058. Epub 2013/09/10.

--->

LIST OF SEQUENCES

<110> Zakrytoe Aktsionernoe Obshchestvo "FARM-Kholding"

<120> Recombinant Plasmid DNA pF265 encoding Hybrid polypeptide comprising a human proinsulin, and human proinsulin- comprising hybrid polypeptide producer bacterial strain Escherichia coli

<140> RU 2019116103

<141> 2019-05-23

<160> 1

<210> 1

<211> 9

<212> PRT

<213> E. coli

<400> 1

MetLeuTyrTyrGluGlyLeuGlnAsp

<210> 2

<211> 10

<212> PRT

<213> E. coli

<400> 2

GlyHisHisHisHisHisHisGlySerArg

<210> 3

<211> 9

<212> PRT

<213> E. coli

<400> 3

HisHisHisHisHisHisGlySerArg

<210> 4

<211> 11

<212> PRT

<213> E. coli

<400> 4

HisProGlySerHisHisHisHisGlySerArg

<210> 5

<211> 8

<212> PRT

<213> E. coli

<400> 5

LeuTyrTyrGluGlyLeuGlnAsp

<210> 6

<211> 53

<212> DNA

<213> E. coli

<400> 6

ccaacgtaacagatct 16

aacagctcgaactcgag 17

ttgaagacgaaagggcctcg 20

<210> 7

<211> 37

<212> DNA

<213> E. coli

<400> 7

ccaaccgtaacagatct 17

ctgtggaacacctacatctg 20

<210> 8

<211> 79

<212> DNA

<213> E. coli

<400> 8

tcaacgtaacgaattct 17

atgctgtattatgaaggcctgcaggacggcagcagccaccac 42

catcatcatcatggatcccg 20

<210> 9

<211> 20

<212> DNA

<213> E. coli

<400> 9

tgcctggcggcagtagcgcg 20

<210> 10

<211> 20

<212> DNA

<213> E. coli

<400> 10

cgtggtatcgttgaacagtg 20

<210> 11

<211> 20

<212> DNA

<213> E. coli

<400> 11

ctgcagagaaccttccagag 20

<210> 12

<211> 720

<212> DNA

<213> E. coli

<400> 12

tttgtttaactttaagaaggagagaattctatgctgtattatgaa 45

aaacaaattgaaattcttcctctcttaagatacgacataatactt 45

ggcctgcaggacggcagcagccaccaccatcatcatcatggatcc 45

ccggacgtcctgccgtcgtcggtggtggtagtagtagtacctagg 45

cgttttgttaaccaacacctgtgcggttctcacctggttgaagct 45

gcaaaacaattggttgtggacacgccaagagtggaccaacttcga45

ctgtacctggtttgcggtgaacgtggtttcttctacaccccgaag45

gacatggaccaaacgccacttgcaccaaagaagatgtggggcttc45

acccgtcgtgaagctgaagacctgcaggttggtcaggttgaactg45

tgggcagcacttcgacttctggacgtccaaccagtccaacttgac 45

ggtggtggtccgggtgctggtagcctgcaaccgctggctctggaa 45

ccaccaccaggcccacgaccatcggacgttggcgaccgagacctt45

ggttctctgcagcgtggtatcgttgaacagtgctgcacctctatc 45

ccaagagacgtcgcaccatagcaacttgtcacgacgtggagatag 45

tgctctctgtaccagctggaaaactactgcaactagtaagcttag45

acgagagacatggtcgaccttttgatgacgttgatcattcgaatc45

<210> 13

<211> 106

<212> PRT

<213> E. coli

<400> 13

MetLeuTyrTyrGlu5

GlyLeuGlnAspGlySerSerHisHisHisHisHisHisGlySer15

ArgPheValAsnGlnHisLeuCysGlySerHisLeuValGluAla15

LeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrProLys 15

ThrArgArgGluAlaGluAspLeuGlnValGlyGlnValGluLeu 15

GlyGlyGlyProGlyAlaGlySerLeuGlnProLeuAlaLeuGlu 15

GlySerLeuGlnArgGlyIleValGluGlnCysCysThrSerIle 15

CysSerLeuTyrGlnLeuGluAsnTyrCysAsn11

<---

Claims (11)

1. Recombinant plasmid DNA pF265 for expression in Escherichia coli of human proinsulin as part of a hybrid polypeptide, having a plasmid map as shown in FIG. 5, with a molecular weight of 1.4 MDa (4537 bp), encoding a hybrid polypeptide, in which the sequence of a fragment of the human protein HGS, a substrate of tyrosine kinase, is linked via a peptide linker with the sequence GlyHis6GlySerArg with the amino acid sequence of human proinsulin, with arginine as a proteolysis site between the C-peptide and chain A, including the amino acid sequence SEQ ID NO :13, while plasmid DNA pF265 contains: - BglII / XhoI fragment of plasmid pBR322, including the β-lactamase gene (bla), which determines the resistance of bacterial cells to ampicillin; replication initiation site (ori); - ROP gene regulating the copy number of the plasmid; - XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter; - EcoRI / HindIII fragment containing an artificial gene, in which the nucleotide sequence corresponds to SEQ ID NO: 12; - HindIII / BglII fragment containing the ribosomal RNA operon terminator rrnB, the LacI transcriptional repressor, which regulates the transcription of the Tac promoter, - unique recognition sites by restriction endonucleases with the following coordinates: EcoRI - 115, BamHI - 176, SpeI - 438, HindIII - 444, BglII - 1872, NdeI - 2476, AatII - 4468. 2. The Escherichiacoli BL21 / pF265 strain is a producer of a hybrid polypeptide with a human proinsulin sequence, the strain obtained by transforming the cells of the E. coli BL21 strain with the recombinant plasmid DNA pF265 according to claim 1. 3. Hybrid polypeptide of human proinsulin, in which the sequence MetLeuTyrTyrGluGlyLeuGlnAsp of a fragment of the human protein HGS, a substrate of tyrosine kinase, is connected through a peptide linker GlyHis6GlySerArg with the sequence of human proinsulin, with an amino acid sequence between the amino acid C-protein and the amino acid sequence between the peptide ID and SEQ as a site NO: 13.

Images