RU2729381C1 - Recombinant plasmid dna pf644 coding hybrid polypeptide containing proinsulin glargine, and bacterial strain escherichia coli - producer of hybrid polypeptide containing proinsulin glargine - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, specifically to recombinant production of therapeutic proteins, and can be used to produce recombinant proinsulin human glargine. Recombinant proinsulin is obtained in a hybrid polypeptide, in which the human HGS protein fragment, the tyrosine kinase substrate, is linked through peptide linker with sequence GlyHis6GlySerArg with amino acid sequence proinsulin of human glargines, with arginine as site of proteolysis between C-peptide and chain A. For this purpose, recombinant plasmid DNA pF644 and strain-producer Escherichia coli BL21/pF644 are used.EFFECT: invention provides synthesis of a hybrid polypeptide with an expression level of not less than 4 % of the crude weight of the cell biomass, enables increasing the percentage of insulin glargine in the hybrid protein to 49_5 % and improving the purification efficiency of the end product by eliminating the closely related Arg0-A-glargine.3 cl, 6 dwg, 6 ex

Description

Technology area

The invention relates to the field of biotechnology, namely to the production of a recombinant insulin analogue of glargine and can be used for the preparation of drugs for the treatment of diabetes mellitus.

Brief description of the invention

The invention relates to biotechnology, in particular to genetic engineering. This invention can be used to obtain recombinant proinsulin glargine, which contains the B chain, C-peptide and A chain. The proposed recombinant plasmid DNA containing a hybrid tac-promoter, ribosomal operon terminator
E. coli, an artificial gene encoding a hybrid polypeptide consisting of a short leader sequence of a human HGS protein fragment, a tyrosine kinase substrate, a GlyHis6GlySerArg peptide linker, an Arg proteolysis site, chain B, an Arg Arg proteolysis site, a C-peptide, a site proteolysis "Arg" and chain A.

Also proposed is a strain of Escherichia coli, a producer of a hybrid polypeptide with a proinsulin glargine sequence, transformed with a recombinant plasmid DNA according to the invention, and a hybrid polypeptide consisting of a short leader sequence of a fragment of the human protein HGS, a substrate of tyrosine kinase, connected through a peptide sequence linker His6Gly with the sequence GlySerg proinsulin glargine, with arginine as a proteolysis site between the C-peptide and the A chain. In this case, the biosynthesis of the hybrid polypeptide is induced by isopropylthiogalactopyranoside, the level of its biosynthesis is at least 4% of the mass of the wet sediment of the cell biomass.

The present invention makes it possible to obtain a hybrid polypeptide with a high proportion of insulin glargine (49.5%) and to increase the efficiency of purification of the target product due to the elimination of a closely related impurity Arg0-A-glargine. The invention is aimed at obtaining a highly productive bacterial strain - the producer of the insulin analogue glargine.

Prior art

Diabetes mellitus is currently the most serious medical and socio-economic problem around the world. In this regard, the development and implementation of modern methods of therapy for diabetes mellitus is one of the most priority areas of medicine and pharmaceutical industry (1).

Effective insulin replacement therapy, as the main method of therapy for insulin-dependent diabetes mellitus, is of particular importance in this regard. Natural and recombinant insulins are no longer able to fully meet the needs of clinicians and patients. Today's medicine requires the use of more modern antidiabetic drugs, such as short-acting and prolonged-acting human insulin analogues (2-5).

In healthy people, peaks in insulin secretion are directly related to food intake. Between meals, endogenous insulin levels drop to basal levels. In a healthy person, approximately 50% of insulin excreted per day is basal (6). This profile can best be replicated by the use of long-acting insulin in combination with short-acting insulin. Postprandial peaks of endogenous insulin activity can be simulated by administering short-acting insulin preparations, while insulins in combination with Hagedorn's neutral protamine (NPH insulin) or prolonged-acting human insulin analogs are used to recreate the basal insulin level (7).

One of the analogs of long-acting human insulin is insulin glargine, which, according to many studies, exhibits an activity profile in the body much closer to natural than NPH insulin (5).

By its chemical nature, the glargine molecule differs from the human insulin molecule in that it has two additional arginine residues at the C-end of the beta chain, and asparagine at position 21 of the alpha chain is replaced by glycine (2, 5). Insulin glargine has the empirical formula C267H404N72O78S6 and a molecular weight of 606.3 (8).

These modifications (Fig. 1), as well as the addition of a small amount of zinc ions to the preparation, increase the stability of the preparation and promote a shift in the isoelectric point of insulin glargine from 5.4 to 6.7, as compared to human insulin, which leads to a decrease in the solubility of the preparation in neutral the environment of the subcutaneous tissue.

Insulin glargine is highly soluble at pH 4.0. The acidic solution of the drug is neutralized by subcutaneous injections, and this analogue of insulin, which ex vivo is a clear solution, forms microprecipitates, from which there is a slow release of insulin hexamers and their dissociation to form di- and monomers. Due to these properties, the drug is slowly absorbed from the subcutaneous tissue into the bloodstream, does not have a pronounced peak of action and provides an almost constant basal concentration of the hormone in the blood throughout the day. The addition of zinc ions to the preparation also slows down the release of dimers and monomers, which increases the duration of the analogue action (2, 9). At the same time, the number of patients with type 1 diabetes who need insulin glargine on an ongoing basis is growing every year in the world.

Thus, the development of methods for producing the insulin analogue glargine is an urgent medical problem.

Currently, the most promising technology is the production of insulin and insulin analogs using the methodology of human proinsulin gene expression in Escherichia coli cells as part of fusion proteins in the form of insoluble inclusion bodies (10). The structure of the single-stranded precursor (hybrid polypeptide) expressed in known human insulin-producing strains is a leader peptide, Arg or Lys or Lys Arg proteolysis site, B chain, Arg Arg proteolysis site, C-peptide, Lys Arg proteolysis site, chain A (Fig. 2).

The need to include leader peptides in the hybrid polypeptide is associated with the low stability of proinsulin in Escherichia coli cells, the half-life of which is 2 minutes (4). Glutathione transferase (11), immunoglobulin binding (IgG) domain of protein A from S. aureus X (12), interleukin-2 (13), etc. are used as leader sequences that protect proinsulin from proteolytic degradation.

The technological scheme for obtaining insulin glargine from a hybrid polypeptide is characterized by the following stages: increasing the biomass of the cells of the producer strain, isolation of inclusion bodies, denaturation of the hybrid polypeptide, renaturation of the hybrid polypeptide. The next stage of the technological process is enzymatic hydrolysis using trypsin. Under the action of trypsin, hydrolysis of the peptide bond occurs mainly after arginine. The result is insulin glargine.

The disadvantages of previously used genetic constructs for the expression of a hybrid polypeptide include:

Low proportion of the end product - human insulin. This is due to the fact that leader peptides are rather extended amino acid sequences and make up from 40 to 60% of the mass of the hybrid polypeptide.

Formation of closely related impurities ₀ -A-Arg insulin by hydrolysis with trypsin the peptide bond after the amino acids lysine between C-peptide and A-chain (Fig. 2).

The closest in technical essence to the proposed invention are recombinant DNA plasmids pPINS07 (14), pGG-1 (15) and pHINS11 (16), which provide the synthesis of hybrid polypeptides containing the IgG-binding domain of staphylococcal protein A (pPINS07, pGG- 1) and the N-terminal fragment of human interferon gamma (pHINS11).

RF patent No. 2144957 describes the E. coli JM109 / pPINS07 strain, which provides the synthesis of a hybrid polypeptide with an expression level of at least 25-30%. Plasmid pPINS07 determines the synthesis of a fusion protein, in which a single IgG-binding domain of staphylococcal protein A is connected through a peptide linker His ₆ GlySerArg with the amino acid sequence of human proinsulin. The advantages of the proposed construct are, firstly, in a high level of expression of the fusion protein and, secondly, in its efficient renaturation (refolding) and, as a consequence, in a high yield of correctly folded polypeptide.

RF patent No. 2325440C1 describes the E. coli BL21 / pGG-1 strain (15). Plasmid pGG-1 was obtained by directional mutagenesis of plasmid pPINS07 and determines the synthesis of a fusion protein in which the IgG-binding domain of staphylococcal protein A is connected via the peptide linker His ₆ GlySerArg to the amino acid sequence of proinsulin glargine.

A significant drawback of the recombinant plasmids pPINS07 and pGG-1 is that they encode a protein with a low proportion of insulin and insulin glargine, respectively, about 33%.

RF patent No. 2354702 describes the recombinant plasmid pHINS11 and the E. coli strain JM109 / pHINS11. This plasmid determines the synthesis of a hybrid polypeptide, in which the N-terminal fragment of human interferon gamma is connected through a peptide linker HisProGlySerHisHisHisHisGlySerArg with the amino acid sequence of human proinsulin and ensures its high expression. The use of these structures in the technological process makes it possible to obtain highly purified insulin with a purity of at least 98% and an activity of at least 27.5 IU / mg. This producer strain is characterized by a high level of biosynthesis of the hybrid polypeptide and a higher proportion of human insulin in the hybrid polypeptide (38%) compared to the recombinant plasmid pPINS07 (33%); however, the stage of renaturation of the produced hybrid half-peptide is not effective enough (15).

A common disadvantage of the hybrid polypeptides in the described patents is the "Lys Arg" proteolysis site between the C-peptide and the A-chain, which allows the formation of a closely related impurity Arg0-A-insulin.

The object of the present invention is to construct a plasmid that provides a high level of inducible expression of a hybrid polypeptide with a high proportion of insulin glargine and a modified proteolysis site between the C-peptide and the A-chain in order to prevent the formation of a closely related impurity Arg0-A-glargine during enzymatic hydrolysis of the hybrid polypeptide.

The problem is solved by constructing the recombinant plasmid DNA pF644 and the Escherichia coli BL21 / pF644 strain, transformed with this recombinant plasmid DNA, which provides the synthesis of a hybrid polypeptide with an expression level of at least 4% of the wet weight of the cell biomass.

Description of figures

FIG. 1 shows the molecular structure of insulin glargine (source: US FDA, NDA 21-081).

FIG. 2 shows the structure of a single-chain precursor (hybrid polypeptide) in insulin-producing strains.

FIG. 3 shows the structure of a DNA sequence obtained by chemical synthesis.

FIG. 4 shows the arrangement of primers on plasmid pF173 for site-directed mutagenesis of the proteolysis site between C-peptide and A-chain.

FIG. 5 shows the nucleotide sequence and the encoded amino acid sequence of the hybrid EcoRI / HindIII polypeptide fragment of the plasmid pF644. Initiating and terminating codons are underlined, restriction endonuclease recognition sites are indicated.

FIG. 6 - physical map of plasmid pF644. Restriction endonuclease sites are indicated, pBR322 ori - plasmid replication initiation site, Ptac - hybrid transcription promoter, rrnB - transcription terminator of E. coli ribosomal operon, Leader peptide - MetLeuTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyTyrTyrGluGlyLeuGlnAsp , Proglargine is proinsulin glargine, LacI is a transcriptional repressor that regulates the transcription of the Tac promoter.

Detailed description of the invention

According to the invention, there is provided a recombinant plasmid DNA pF644 encoding a hybrid polypeptide, in which the sequence of a fragment of the human HGS protein, a substrate of tyrosine kinase, is connected via a peptide linker GlyHis6GlySerArg with the amino acid sequence of proinsulin glargine, with arginine as a peptide and a chain between C-A chain with a molecular weight of 1.4 MDa (4345 bp), containing

- BglII / XhoI fragment of plasmid pBR322, including the kanamycin resistance gene;

- replication initiation site (ori);

- ROP gene regulating the copy number of the plasmid;

- XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter;

- EcoRI / HindIII fragment containing an artificial gene, in which the sequence of the short leader peptide MetLeuTyrTyr GluGlyLeuGlnAsp is connected via a peptide linker GlyHis6GlySerArg with the amino acid sequence of proinsulin glargine;

- HindIII / BglII fragment containing the terminator of the ribosomal RNA operon rrnB, the transcriptional repressor LacI, which regulates the transcription of the Tac promoter;

- unique recognition sites by restriction endonucleases with the following coordinates: XhoI - 54, EcoRI - 167, BamHI - 228, HindIII - 496, KasI - 1757, BglII - 1924, NdeI - 2528, AagI - 4215.

Also provided is a strain of Escherichia coli BL21 / pF644 - a producer of a hybrid polypeptide with a proinsulin glargine sequence, transformed with a recombinant plasmid DNA according to the invention.

In addition, a hybrid polypeptide is proposed, in which the sequence MetLeuTyrTyrGluGlyLeuGlnAsp of a fragment of the human protein HGS, a substrate of tyrosine kinase, is linked via a peptide linker with the sequence GlyHis6GlySerArg with the amino acid sequence of proinsulin glargine as the site, and the peptide A between the peptide A-glargine as the site and the peptide using the recombinant plasmid DNA according to the invention.

A disadvantage of the hybrid polypeptides in the patents described in the prior art is that the resulting hybrid polypeptide includes a "Lys Arg" proteolysis site between the C-peptide and the A-chain, allowing for the formation of a closely related impurity Arg0-A-glargine.

The authors of the present invention have found that by significantly reducing the size of the hybrid polypeptide by using a short leader sequence of 31 amino acids and changing the proteolysis site between the C-peptide and the A-chain to "Arg", high yields of the target product can be achieved.

The leader peptide contains a short sequence of a fragment of the human protein HGS, a substrate of tyrosine kinase, which forms a pronounced spatial structure of the "alpha-helix" type. The presence of an N-terminal alpha-helical region in a hybrid polypeptide has a positive effect on the level of renaturation of the hybrid polypeptide.

The present invention allows to obtain a fusion polypeptide with a high degree of insulin glargine (49.5%) and to increase the effectiveness of the title product purification due to the elimination of the closely related impurity Arg _-A-0 glargine. The invention is aimed at obtaining a highly productive bacterial strain - the producer of the insulin analogue glargine.

The initial plasmid for the creation of the expression vector pF644 was the pF019 plasmid, which is a recombinant vector pBR322 (16), in which the tetracycline resistance gene was completely removed by molecular cloning (example 1).

At the next stage, a 1.6 kb DNA fragment was synthesized containing the following elements and restriction sites (Fig. 3):

- Tac promoter and Lac operator to control the expression of a hybrid polypeptide (17), flanked by XhoI and EcoRI restriction sites;

- the terminator of transcription of the rnnB operon of strain K-12 ER3413 (REGION: 4143199..4143361), in front of which there is a HindIII restriction site;

- LacI gene of strain K-12 ER3413 (REGION: 365804 to 367006) with a BglII restriction site at the 3 'end. The introduction of the LacI gene into an expression construct solves the problem of controlling the expression of a hybrid polypeptide using a wide range of host strains, including BL21, which is characterized by increased stability of recombinant polypeptides due to the removal of cell proteases lon and ompT.

The synthesized DNA fragment and plasmid DNA pF019 were incubated with restriction endonucleases XhoI and BglII for 3 hours at 37 ° C. The corresponding DNA fragments were isolated from the agarose gel using the Quiagen kit and ligated with T4 DNA ligase. After electroporation of the XL1-Blue E. coli strain, the plasmid DNA isolated from the grown colonies was analyzed using PCR and sequencing methods.

Thus, an expression vector pF20 was obtained based on the plasmid DNA pBR322, containing the Tac promoter, the rnnB terminator and the LacI gene encoding the transcriptional repressor of the Tac promoter, as well as EcoRI and HindIII restriction sites for subsequent insertion of the gene encoding the hybrid polypeptide.

The DNA sequence of the hybrid polypeptide containing the IgG-binding domain of protein A from Staphylococcus aureus as the leader peptide, the peptide linker His6GlySerArg and proinsulin glargine was excised from the plasmid DNA pPIN07 (14) using EcoRI / HindIII restriction endonucleases and the restriction enzyme was inserted into the corresponding expression sites vector pF20 in the manner described above, wherein a BamHI restriction site formed by the coding sequence of two amino acids of the GlySer peptide linker (GGATCC) appeared in the resulting vector. As a result, a recombinant plasmid DNA pF100 was obtained.

At the next stage, recombinant plasmid DNA pF173 was obtained after replacing the DNA sequence of the IgG-binding domain of protein A from Staphylococcus aureus with a DNA sequence encoding a shorter leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp, which is a fragment of the human protein HGS, a substrate (TKS) kinase example 2).

The amino acid sequence of LeuTyrTyrGluGlyLeuGlnAsp is located in the alpha-helical region of the TKS protein (3D structure no. In the PDB database: 3F1I). The presence of an alpha-helical region in the leader peptide facilitates efficient renaturation of the hybrid polypeptide.

The method of site-directed mutagenesis in the recombinant plasmid DNA pF173 removed the codon "aag" at position 373-375, corresponding to the amino acid lysine of the proteolysis site "Lys Arg" between the C-peptide and the A-chain of proinsulin. As a result, a recombinant plasmid DNA pF265 was obtained expressing human proinsulin as part of a hybrid polypeptide (example 3).

In the next step, the last codon of the A-chain "AAC" encoding the amino acid asparagine was replaced by site-directed mutagenesis of the recombinant plasmid DNA pF265 to the codon "ggt" encoding glycine. The described method was obtained recombinant plasmid DNA pF266, expressing proinsulin glargine (example 4).

At the last stage, the ampicillin resistance gene was replaced by Fusion-PCR with the kanamycin resistance gene amplified from the pET24a template (Novagen, 69749-3) using the primers Pr408 (gatgcttttctgtgactggtg) and Pr122 (ctgtcagaccaagtttactcatatatac) (Example 5).

As a result of the described molecular genetic manipulations, a recombinant plasmid DNA pF644, encoding a hybrid polypeptide with the amino acid sequence of proinsulin glargine, was obtained, which is characterized by the following features:

has a molecular weight of 1.4 MDa (4345 bp);

consists of the following structural elements (Fig. 6):

BglII / XhoI fragment of plasmid pBR322, in which the ampicillin resistance gene is replaced by the kanamycin resistance gene;

replication initiation site (ori);

ROP gene regulating the copy number of the plasmid;

XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter;

EcoRI / HindIII fragment containing an artificial gene, in which the sequence of the short leader peptide MetLeuTyrTyrGluGlyLeuGlnAsp is connected via a peptide linker GlyHis6GlySerArg to the amino acid sequence of proinsulin glargine;

HindIII / BglII fragment containing the terminator of the ribosomal RNA operon rrnB, as well as the transcriptional repressor LacI, which regulates the transcription of the Tac promoter;

contains unique recognition sites by restriction endonucleases with the following coordinates: XhoI - 54, EcoRI - 167, BamHI - 228, HindIII - 496, KasI - 1757, BglII - 1924, NdeI - 2528, AagI - 4215.

The advantages of the proposed recombinant plasmid DNA construct are the high proportion of insulin glargine in the hybrid polypeptide (49.5%), the presence in the leader peptide of a sequence that forms a spatial structure of the "alpha-helix" type to improve the efficiency of renaturation of the hybrid polypeptide, modification of the proteolysis site between C- peptide and A-chain, excluding the formation of a closely related impurity Arg0-A-glargine during enzymatic hydrolysis of the hybrid polypeptide.

To obtain a producer strain of a hybrid polypeptide with proinsulin glargine, electrocompetent cells of the recipient strain Escherichia coli BL21 were transformed with recombinant plasmid DNA pF644 by electroporation according to the described method (18) and plated on LB agar containing 50 μg / ml kanamycin.

The resulting Escherichia coli BL21 / pF644 producing strain is characterized by the following features:

Morphological features: Cells are small, rod-shaped, gram-negative, non-spore-bearing, 1x3.5 µm in size, motile, with well-distinguishable inclusion bodies after induction of hybrid polypeptide synthesis.

Cultural traits: when growing on agar medium LB colonies are round, smooth, translucent, shiny, gray; the edge is even, the diameter of the colonies is 1-3 mm, the consistency is pasty. Growth in liquid media (LB, glucose minimal media) is characterized by even haze.

Physiological and biochemical signs: cells grow at a temperature
4-42 ° C, with an optimum pH of 6.8-7.6. As a source of nitrogen, both mineral ammonium salts and organic compounds are used: amino acids, peptone, tryptone, yeast extract. Glycerin, carbohydrates, amino acids are used as a carbon source for growth on a minimal medium.

Antibiotic resistance: cells of the producer strain show resistance to kanamycin (up to 100 mg / ml).

The invention is illustrated by the following examples.

Example 1. Construction of an intermediate genetic construct pF019.

PCR product with a size of 2.8 kb, obtained as a result of amplification of plasmid pBR322 with primers Pr033 (5 '- ccaacgtaacagatct (BglII) aacagctcgaactcgag (XhoI) ttgaagacgaaagggcctcg - 3') and Pr039 (ccaacgtaacagatct) , excised from the gel, purified using the Qiagen kit. After incubation with restriction endonuclease BglII for 3 hours at 37 ° C, the purified DNA fragment was ligated using T4 DNA ligase and used to transform XL1-Blue E. coli strain (Agilent Technology, 200249) by electroporation (18). The correctness of plasmid DNA isolated from colonies grown on LB medium with ampicillin (100 μg / ml) was confirmed by sequencing. By the method described above, a recombinant plasmid DNA pF019 was obtained, which is a fragment of plasmid DNA pBR322 with a complete deletion of the tetracycline resistance gene.

Example 2. Construction of the intermediate recombinant plasmid pF173.

Primers pr096 (tcaacgtaacgaattct atg ctg tat tat gaa ggc ctg cag gac ggc agc agc cac cac catcatcatcatcatggatcccg) and pr130 (tgcctggcggcagtagcgcg) were synthesized for the introduction of a short leader peptide into proinsulin. Primer pr096 contains an EcoRI restriction endonuclease recognition site; the region coding for the amino acid sequence of the leader peptide; sequence corresponding to the peptide linker His6GlySerArg construct pF100.

The reaction mixture (100 μl) for polymerase chain reaction (PCR) consisted of the following components:

10 μl 10x Pfu DNA Polymerase Buffer,

0.1 ng pF100 plasmid DNA,

1 μl of 10 mM dNTP mixture,

0.5 μl of each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (30 sec ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. The PCR product corresponding to 600 bp was excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit. Electrophoresis was performed in standard TBE (Tris-borate-EDTA) buffer using 1% agarose. DNA was visualized using the Fusion-SL2-400 gel documenting system.

The PCR product cut from the gel and plasmid pF100 were incubated with restriction endonucleases EcoRI and HindIII for 3 hours at 37 ° C. The corresponding DNA fragments (330 bp and 4.2 kb) were isolated from the agarose gel using the Quiagen kit and ligated with T4 DNA ligase. After electroporation of the XL1-Blue E. coli strain, the recombinant plasmid DNA isolated from the grown colonies were analyzed by PCR and sequencing.

Example 3. Construction of intermediate recombinant plasmid DNA pF265 by site-directed mutagenesis of plasmid pF173.

To modify the Lys Arg proteolysis site between C-peptide and
The A-chain of proinsulin synthesized oligonucleotides Pr237 (cgtggtatcgttgaacagtg) and Pr238 (ctgcagagaaccttccagag) containing a phosphate group from the 5 'end (Fig. 3).

The reaction mixture (100 μl) for polymerase chain reaction (PCR) consisted of the following components:

10 μl 10x Pfu DNA Polymerase Buffer,

0.1 ng plasmid DNA pF173,

1 μl of 10 mM dNTP mixture,

0.5 μl of each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (3 min ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. The PCR product corresponding in size to the plasmid pF173 (4.5 kb) was excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit. Electrophoresis was performed in standard TBE buffer using 1% agarose. DNA was visualized using the Fusion-SL2-400 gel documenting system.

To obtain the recombinant plasmid DNA pF265, the ends of the PCR product isolated from the gel were ligated using T4 DNA ligase (NEB). The ligation mixture (10 μL) was used to transform the BL21 strain by electroporation (18). After transformation, the colonies grown on a medium with ampicillin were selected, plasmids were isolated from them and analyzed by sequencing the hybrid polypeptide sequence. As a result, a recombinant plasmid DNA pF265 was obtained expressing proinsulin as part of a hybrid polypeptide.

Example 4. Construction of intermediate recombinant plasmid DNA pF266.

Recombinant plasmid DNA pF266 was obtained by site-directed mutagenesis of recombinant plasmid DNA pF265. For this, oligonucleotides (primers) Pr074 (ccagctggaaaactactgcggttagtaagc) and Pr075 (tacagagagcagatagaggtg) containing a phosphate group from the 5'-end were synthesized. Primer Pr074 contained the "ggt" sequence encoding the amino acid glycine. Polymerase chain reaction (PCR) using primers Pr074 and Pr075 led to the replacement of the last codon in the proglargin gene "aac" (asn) by the codon "ggt" (gly).

The reaction mixture (100 μL) for PCR consisted of the following components:

10 μl 10x PFU DNA Polymerase Buffer,

0.1 ng plasmid DNA pF265,

1 μl of 10 mM dNTP mixture,

0.5 μl of each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (3 min ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. The PCR product corresponding in size to the recombinant plasmid DNA pF265 (4.5 kb) was excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit. Electrophoresis was performed in standard TBE buffer using 1% agarose. DNA was visualized using the Fusion-SL2-400 gel documenting system.

To obtain plasmid DNA, the ends of the PCR product isolated from the gel were ligated with T4 DNA ligase (NEB). The ligation mixture (10 μL) was used to transform the BL21 strain by electroporation (18).

After transformation, colonies grown on a medium with ampicillin were selected, recombinant plasmid DNA was isolated from them and analyzed by sequencing the sequence of the hybrid polypeptide. As a result, a recombinant plasmid DNA pF266 with an ampicillin resistance gene was obtained, expressing proinsulin glargine as part of a hybrid polypeptide.

Example 5. Obtaining the final genetic construct pF644 with the kanamycin resistance gene expressing the hybrid polypeptide of proinsulin glargine.

Recombinant plasmid DNA pF644 was obtained by Fusion-PCR. For this, oligonucleotides Pr121 (cctgataaatgcttcaataatattgaaaaaggaagagtatgagccatattcaacgggaaacg), Pr120 (ttagaaaaactcatcgagcatcaaatgaaactg), Pr408 (gatgcttttcttgtgt12ggat1), Pr408 (gatgcttttctctgtgt12ggat1), Pr408 (gatgcttttcttgtgt12ggat1 end.

At the first stage, PCR fragments 1 and 2 were obtained.

Using the pF266 template and the Pr408 / Pr122 primers, a PCR fragment of 3958 bp was amplified (Fig. 5).

The kanamycin resistance gene (PCR fragment 2, 816 bp) was amplified using the pET24a template (Novagen, 69749-3) and the Pr408 / Pr122 primers.

The composition of the reaction mixtures (100 μl) for PCR included the following components:

10 μl 10x Pfu DNA Polymerase Buffer,

0.1 ng plasmid DNA,

1 μl of 10 mM dNTP mixture,

0.5 μl of each primer (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (3 min ).

The amplification products were analyzed by agarose gel electrophoresis using the intercalating dye GelRed, Biotium. PCR fragments 1 and 2 were excised from the gel and purified using the Zymoclean ™ Gel DNA Recovery Kit.

PCR fragments 1 and 2 were combined at the Fusion-PCR stage under the following conditions:

The composition of the reaction mixtures (100 μl) for PCR included the following components:

10 μl 10x Pfu DNA Polymerase Buffer,

0.1 ng PCR fragment 1,

0.6 ng PCR fragment 2

1 μl of 10 mM dNTP mixture,

0.5 μl of primer Pr120 (10 μM),

0.5 μl of primer Pr122 (10 μM),

2 units Pfu DNA Polymerase,

2 units Taq DNA polymerase.

PCR was carried out using a DNA amplifier T100 Thermal Cycler, Bio-Rad under the following conditions: 96 ° C (5 min), 30 cycles - 96 ° C (15 sec), 55 ° C (15 sec), 72 ° C (3 min ).

To obtain plasmid DNA pF644, the ends of the 4345 bp PCR product isolated from the gel were ligated with T4 DNA ligase (NEB). The ligation mixture (10 μL) was used to transform the BL21 strain by electroporation (18).

After transformation, colonies grown on a medium with kanamycin (50 mg / L) were selected, plasmids were isolated from them and analyzed by sequencing the hybrid polypeptide sequence. As a result, a recombinant plasmid DNA pF644 with a kanamycin resistance gene, expressing proinsulin glargine as part of a hybrid polypeptide, was obtained.

Example 6. Determination of the productivity of the hybrid polypeptide producer strain.

An individual colony of E. coli BL21 cells containing recombinant plasmid DNA pF644 was inoculated with 2 ml of LB medium containing kanamycin at a concentration of 50 μg / ml, grown in a thermal shaker at 37 ° C for 22 hours with stirring (170 rpm) ... After measuring the optical density OD _{600, the} night culture was inoculated with 40 ml of liquid LB medium containing 50 μg / ml kanamycin (OD starting ₆₀₀ = 0.1) and grown for 1-2 hours at 37 ° C on an incubator shaker with stirring (180 rpm ) until the optical density reaches OD ₆₀₀ = (0.8 ± 0.2). 20 ml of culture was transferred to another flask (control without induction), 10 μl of 1M IPTG (isopropyl-beta-galactopyranoside) (final concentration of IPTG - 0.5 mM) was added to the remaining 20 ml. After 4 hours of incubation on an incubator shaker with stirring (180 rpm), the cell cultures were centrifuged (15 min, 3000 rpm), the mass of the wet cell pellet was determined, and frozen. The content of the hybrid polypeptide in% of the wet sediment weight was measured by capillary electrophoresis. The expression level was no less than 4% of the wet weight of the cell biomass.

Sources of information:

1. King H, Aubert RE, Herman WH. Global burden of diabetes, 1995-2025: prevalence, numerical estimates, and projections. Diabetes care. 1998 Sep; 21 (9): 1414-31. PubMed PMID: 9727886.

2. Bolli GB, Owens DR. Insulin glargine. Lancet. 2000 Aug 5; 356 (9228): 443-5. PubMed PMID: 10981882.

3. Meece JD, Campbell RK. Insulin lispro update. The Diabetes educator. 2002 Mar-Apr; 28 (2): 269-77. PubMed PMID: 11924304.

4. Dunn CJ, Plosker GL. Insulin lispro: a pharmacoeconomic review of its use in diabetes mellitus. PharmacoEconomics. 2002; 20 (14): 989-1025. PubMed PMID: 12403639.

5. Home PD, Ashwell SG. An overview of insulin glargine. Diabetes / metabolism research and reviews. 2002 Sep-Oct; 18 Suppl 3: S57-63. PubMed PMID: 12324987.

6. Nakashima E, Kuribayashi N, Ishida K, Taketsuna M, Takeuchi M, Imaoka T. Efficacy and safety of stepwise introduction of insulin lispro mix 50 in Japanese patients with type 2 diabetes inadequately controlled by oral therapy. Endocrine journal. 2013; 60 (6): 763-72. PubMed PMID: 23459461.

7. Roach P, Woodworth JR. Clinical pharmacokinetics and pharmacodynamics of insulin lispro mixtures. Clinical pharmacokinetics. 2002; 41 (13): 1043-57. PubMed PMID: 12403642.

8. Levien TL, Baker DE, White JR, Jr., Campbell RK. Insulin glargine: a new basal insulin. The Annals of pharmacotherapy. 2002 Jun; 36 (6): 1019-27. PubMed PMID: 12022906. Epub 2002/05/23.

9. Dunn CJ, Plosker GL, Keating GM, McKeage K, Scott LJ. Insulin glargine: an updated review of its use in the management of diabetes mellitus. Drugs. 2003; 63 (16): 1743-78. PubMed PMID: 12904090.

10. Bairamashvili DI. Genetically engineered human insulin: successes and prospects. Ros chem (Zh Ros about-va im DI Mendeleev). 2005; XLIX (1): 34-45.

11. Berg H, Walter M, Mauch L, Seissler J, Northemann W. Recombinant human preproinsulin. Expression, purification and reaction with insulin autoantibodies in sera from patients with insulin-dependent diabetes mellitus. Journal of immunological methods. 1993 Sep 15; 164 (2): 221-31. PubMed PMID: 8370928.

12. Jonasson P, Nilsson J, Samuelsson E, Moks T, Stahl S, Uhlen M. Single-step trypsin cleavage of a fusion protein to obtain human insulin and its C peptide. European journal of biochemistry / FEBS. 1996 Mar 1; 236 (2): 656-61. PubMed PMID: 8612642.

13. Castellanos-Serra LR, Hardy E, Ubieta R, Vispo NS, Fernandez C, Besada V, et al. Expression and folding of an interleukin-2-proinsulin fusion protein and its conversion into insulin by a single step enzymatic removal of the C-peptide and the N-terminal fused sequence. FEBS letters. 1996 Jan 8; 378 (2): 171-6. PubMed PMID: 8549827.

14. Korobko VG, Boldyreva EF, Shingarova LN. Recombinant plasmid DNA pPINS07, encoding a hybrid polypeptide containing human proinsulin, and a bacterial strain Escherichia coli, a producer of a hybrid polypeptide containing human proinsulin: RF Patent No. 2144957; 1999.

15. Shmatchenko VV, Shmatchenko NA, Baidus AN. Recombinant plasmid DNA pHINS11, encoding fusion protein - human insulin precursor, Escherichia coli cell transformed with recombinant plasmid DNA pPHINS11, bacterial strain Escherichia coli JM109 / pHINS11 - producer of fusion protein - human insulin precursor, and method for producing human insulin 2006. Available from: http://bd.patent.su/2263000-2263999/pat/servl/servletc85e.html.

16. Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, Boyer HW, et al. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene. 1977; 2 (2): 95-113. PubMed PMID: 344137. Epub 1977/01/01.

17.de Boer HA, Comstock LJ, Vasser M. The tac promoter: a functional hybrid derived from the trp and lac promoters. Proceedings of the National Academy of Sciences of the United States of America. 1983 Jan; 80 (1): 21-5. PubMed PMID: 6337371.

18. Lessard JC. Transformation of E. coli via electroporation. Methods in enzymology. 2013; 529: 321-7. PubMed PMID: 24011058. Epub 2013/09/10.

--->

LIST OF SEQUENCES

<110> Zakrytoe Aktsionernoe Obshchestvo "FARM-Kholding"

<120> Recombinant Plasmid DNAPf644 encoding Hybrid polypeptide comprising proinsulin glargine, and proinsulin glargine - comprising hybrid polypeptide producer bacterial strain Escherichia coli

<140> RU 2019116105

<141> 2019-05-23

<160> 1

<210> 1

<211> 10

<212> PRT

<213> E. coli

<400> 1

GlyHisHisHisHisHisHisGlySerArg

<210> 2

<211> 9

<212> PRT

<213> E. coli

<400> 2

HisHisHisHisHisHisGlySerArg

<210> 3

<211> 11

<212> PRT

<213> E. coli

<400> 3

HisProGlySerHisHisHisHisGlySerArg

<210> 4

<211> 9

<212> PRT

<213> E. coli

<400> 4

MetLeuTyrTyrGluGlyLeuGlnAsp

<210> 5

<211> 8

<212> PRT

<213> E. coli

<400> 5

LeuTyrTyrGluGlyLeuGlnAsp

<210> 6

<211> 21

<212> DNA

<213> E. coli

<400> 6

gatgcttttctgtgactggtg

<210> 7

<211> 28

<212> DNA

<213> E. coli

<400> 7

ctgtcagaccaagtttactcatatatac

<210> 8

<211> 53

<212> DNA

<213> E. coli

<400> 8

ccaacgtaacagatct16

aacagctcgaactcgag17

ttgaagacgaaagggcctcg20

<210> 9

<211> 37

<212> DNA

<213> E. coli

<400> 9

ccaaccgtaacagatct 17

ctgtggaacacctacatctg 20

<210> 10

<211> 79

<212> DNA

<213> E. coli

<400> 10

tcaacgtaacgaattct 17

atgctgtattatgaaggcctgcaggacggcagcagccaccac 42

catcatcatcatggatcccg 20

<210> 11

<211> 20

<212> DNA

<213> E. coli

<400> 11

cgtggtatcgttgaacagtg

<210> 12

<211> 20

<212> DNA

<213> E. coli

<400> 12

ctgcagagaaccttccagag

<210> 13

<211> 30

<212> DNA

<213> E. coli

<400> 13

ccagctggaaaactactgcggttagtaagc

<210> 14

<211> 21

<212> DNA

<213> E. coli

<400> 14

tacagagagcagatagaggtg

<210> 15

<211> 62

<212> DNA

<213> E. coli

<400> 15

cctgataaatgcttcaataatattgaaaaaggaagagtatgagccatattcaacgggaaacg

<210> 16

<211> 33

<212> DNA

<213> E. coli

<400> 16

ttagaaaaactcatcgagcatcaaatgaaactg

<210> 17

<211> 21

<212> DNA

<213> E. coli

<400> 17

gatgcttttctgtgactggtg

<210> 18

<211> 28

<212> DNA

<213> E. coli

<400> 18

ctgtcagaccaagtttactcatatatac

<210> 19

<211> 720

<212> DNA

<213> E. coli

<400> 19

tttgtttaactttaagaaggagagaattct atg ctgtattatgaa 45

aaacaaattgaaattcttcctctcttaagatacgacataatactt 45

ggcctgcaggacggcagcagccaccaccatcatcatcatggatcc 45

ccggacgtcctgccgtcgtcggtggtggtagtagtagtacctagg 45

cgttttgttaaccaacacctgtgcggttctcacctggttgaagct 45

gcaaaacaattggttgtggacacgccaagagtggaccaacttcga 45

ctgtacctggtttgcggtgaacgtggtttcttctacaccccgaag 45

gacatggaccaaacgccacttgcaccaaagaagatgtggggcttc 45

acccgtcgtgaagctgaagacctgcaggttggtcaggttgaactg 45

tgggcagcacttcgacttctggacgtccaaccagtccaacttgac 45

ggtggtggtccgggtgctggtagcctgcaaccgctggctctggaa 45

ccaccaccaggcccacgaccatcggacgttggcgaccgagacctt 45

ggttctctgcagcgtggtatcgttgaacagtgctgcacctctatc 45

ccaagagacgtcgcaccatagcaacttgtcacgacgtggagatag 45

tgctctctgtaccagctggaaaactactgcggt tagtaa gcttag 45

acgagagacatggtcgaccttttgatgacgcaatcattcgaatc 45

<210> 20

<211> 106

<212> PRT

<213> E. coli

<400> 20

MetLeuTyrTyrGlu 5

GlyLeuGlnAspGlySerSerHisHisHisHisHisHisGlySer 15

ArgPheValAsnGlnHisLeuCysGlySerHisLeuValGluAla 15

LeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrProLys 15

ThrArgArgGluAlaGluAspLeuGlnValGlyGlnValGluLeu 15

GlyGlyGlyProGlyAlaGlySerLeuGlnProLeuAlaLeuGlu 15

GlySerLeuGlnArgGlyIleValGluGlnCysCysThrSerIle 15

CysSerLeuTyrGlnLeuGluAsnTyrCysGly 11

<---

Claims (12)

1. Recombinant plasmid DNA pF644 for expression in Escherichia coli of human proinsulin glargine as part of a hybrid polypeptide, having a plasmid map as shown in FIG. 6, with a molecular weight of 1.4 MDa (4345 bp), encoding a hybrid polypeptide in which the sequence of a fragment of the human protein HGS, a substrate of tyrosine kinase, is connected through a peptide linker GlyHis6GlySerArg with the amino acid sequence of proinsulin glargine, with arginine as a proteolysis site between C-peptide and chain A, comprising the amino acid sequence of SEQ ID NO: 20, wherein the pF644 plasmid DNA contains: BglII / XhoI fragment of plasmid pBR322; kanamycin resistance gene; replication initiation site (ori); ROP gene regulating the copy number of the plasmid; XhoI / EcoRI fragment, which is a hybrid Tac transcription promoter; EcoRI / HindIII fragment containing an artificial gene, in which the nucleotide sequence corresponds to SEQ ID NO: 19; HindIII / BglII fragment containing the terminator of the ribosomal RNA operon rrnB, the LacI transcriptional repressor, which regulates the transcription of the Tac promoter; unique recognition sites by restriction endonucleases with the following coordinates: XhoI - 54, EcoRI - 167, BamHI - 228, HindIII - 496, KasI - 1757, BglII - 1924, NdeI - 2528, AagI - 4215. 2. The Escherichia coli BL21 / pF644 strain is a producer of a hybrid polypeptide with the proinsulin glargine sequence, the strain obtained by transforming the cells of the E. coli BL21 strain with the recombinant plasmid DNA pF644 according to claim 1. 3. Hybrid polypeptide of human proinsulin glargine, in which the sequence MetLeuTyrTyrGluGlyLeuGlnAsp of a fragment of human protein HGS, a substrate of tyrosine kinase, is connected through a peptide linker with the sequence GlyHis6GlySerArg with the amino acid sequence of the site of proinsulin glargine and the amino acid sequence of the peptide-peptide glargine chain and the amino acid sequence of the amino acid peptide-peptidase chain between arginine SEQ ID NO: 20.

Images