RU2144957C1 - Recombinant plasmid dna ppins07 encoding fused polypeptide containing human proinsulin and strain of bacterium escherichia coli - producer of fused polypeptide containing human proinsulin - Google Patents

Abstract

FIELD: molecular biology, biotechnology, genetic engineering. SUBSTANCE: invention proposes recombinant plasmid DNA containing artificial gene that encodes the fused polypeptide consisting of a single IgG-bindining domain of protein A from Staphylococcus aureus, peptide linker His₆-Gly-Ser-Arg and human proinsulin, hybrid tac-promoter and terminator of ribosomal operon of E. coli. Invention proposes the strain of Escherichia coli - producer of fused polypeptide showing the human proinsulin sequence. Biosynthesis of fused polypeptide is induced by isopropylthiogalactopyranoside and level of its biosynthesis is 25% of total cellular protein, not less. Invention can be used for preparing the human recombinant proinsulin. EFFECT: increased yield of polypeptide. 3 cl, 2 dwg, 3 ex

Description

 The invention relates to the field of genetic engineering and medicine and can be used to create drugs for the treatment of insulin-dependent diabetes mellitus.

 Insulin - the peptide hormone of the pancreas - is synthesized by specialized cells called the islets of Langerhans in the form of a precursor - preproinsulin, consisting of 109 amino acid residues. During biosynthesis, as a result of cleavage of a signal peptide of 23 amino acids, proinsulin is released. Subsequently, proinsulin undergoes further processing, leading to the formation of insulin proper as a result of specific “cleavage” of 35 amino acids of the C-peptide. Mature biologically active insulin consists of two chains connected by two disulfide bonds. Chain A contains 21, and chain B contains 30 amino acid residues.

 The efforts of numerous teams over the past 30 to 35 years have been aimed at developing industrial methods for the production of human insulin, since the use of porcine insulin closest in structure to human often leads to undesirable side effects. Although the chemical synthesis of human insulin was carried out as far back as the 60s, it cannot serve as the basis for the industrial production of the hormone due to its extremely low profitability. Currently, there are two main methods for producing this human peptide hormone.

One of the methods is based on the use of the "semi-synthetic" method of converting porcine insulin into human. These proteins are distinguished by a single amino acid at the C-terminus of the B chain. In this position, Ala is in porcine insulin, and Thr in human insulin. The most technologically advanced variant of the method is the use of immobilized proteinase I from Achromobacter Lyticus to remove the C-terminal porcine insulin alanine, followed by condensation of des Ala ₃₀ -insulin with threonine tert-butyl ether. However, the most promising way to obtain human insulin is a method based on recombinant DNA technology.

 The gene encoding the biosynthesis of human proinsulin was obtained about 20 years ago both by cDNA synthesis on the mRNA matrix isolated from the human pancreas [1,2], and by chemical-enzymatic synthesis [3,4]. However, attempts to achieve a high level of proinsulin biosynthesis by E. coli cells have not been successful, due to the rapid degradation of the product encoded by the artificial gene. To date, a methodology has been developed for the expression of the human proinsulin gene in E. coli cells. It consists in the biosynthesis of proinsulin by cells of hybrid proteins in the form of insoluble “inclusion bodies”. Homo-oligopeptides [5], bovine protimosin [6], glutathione-S-transferase [7], proinsulin C-peptide [8], etc. were used as leader sequences protecting the recombinant protein from proteolytic degradation. Cleavage of proinsulin from the leader peptide is achieved by treatment cyanogen bromide at methionine residue [9, 10]. This treatment is made possible by the absence of methionine in the human proinsulin sequence. Subsequent renaturation of proinsulin and enzymatic transformation into insulin using trypsin and carboxypeptidase B is a technologically well-developed process. The main disadvantage of the described approach is the use of a highly toxic compound - cyanogen bromide in large-scale production.

 Recently, it was found that a hybrid protein consisting of two averaged immunoglobulin binding (IgG) domains of protein A from S. aureus and human proinsulin connected via Arg, LysArg or Lys residues after isolation from the inclusion bodies and renaturation can be in high yield and is specifically cleaved with a mixture of trypsin and carboxypeptidase B [11], which makes it possible to exclude a highly toxic product from the technology. The resulting insulin and C-peptide can be isolated by reverse phase chromatography. Purification of the hybrid protein is carried out using affinity chromatography on IgG-sepharose. It should be noted that, despite the obvious advantages, the approach used in [11] has a significant drawback, since it cannot be scaled up due to the use of IgG-sepharose.

 The closest in technical essence to the present invention is recombinant plasmid DNA pTrpZZ-R-proinsulin [11], encoding a fusion protein weighing about 27 kDa, in which the tandem of two IgG-binding domains is connected via the arginine residue to the amino acid sequence of human proinsulin.

The objective of the invention is the construction of a plasmid that determines the synthesis of a hybrid protein, in which a single IgG-binding domain of protein A is connected through the peptide linker His ₆ AspGlyArg to the amino acid sequence of human proinsulin. The advantages of the proposed construct are, firstly, in simplifying the affinity purification of the hybrid protein through the use of a more technologically advanced affinity sorbent containing residues capable of forming metal chelate complexes of iminodiacetic acid, and, secondly, in increasing the proportion of proinsulin in the hybrid protein by removing one IgG binding domain.

 The problem is solved by the construction of recombinant plasmid DNA pPINS07 and strain Escherichia coli JM109 / pPINS07, which provides the synthesis of a hybrid polypeptide with an expression level of at least 25-30%.

The initial plasmid for the construction of a new gene encoding a hybrid protein containing human proinsulin was the plasmid pPINS03. This plasmid was constructed on the basis of the vector plasmid pKK223-3, in which the BamHI restriction enzyme site located in front of the tac promoter was deleted by completing the sticky ends after partial hydrolysis and subsequent ligation of the resulting blunt ends. Thus obtained plasmid pKK223-3 ^* was used as a vector for simultaneous cloning at EcoRI and HindIII sites of fragments encoding the B domain of protein A from S. aureus and human proinsulin. An artificial gene encoding human proinsulin, flanked by restriction enzyme sites BamHI and HindIII, was obtained by chemical-enzymatic synthesis. A DNA fragment encoding the IgG binding domain of protein A was synthesized by polymerase chain reaction on a DNA matrix from S. aureus (Cowan strain) using specific primers. Before cloning, the amplificate was digested with restriction enzymes EcoRI and BamHI to generate sticky ends. The resulting plasmid pPINS03 contains between the EcoRI and HindIII sites an artificial gene encoding a fusion protein in which the amino acid sequence of protein A of the IgG-binding domain B of S. aureus is linked via the amino acid linker Gly-Ser-Met to the amino acid sequence of human proinsulin. To increase the level of biosynthesis of the hybrid protein, the proinsulin codons were selected taking into account their frequency in highly expressed E. coli genes. Plasmid pPINS03 provides in E. coli JM109 cells after isopropylthio-β, D-galactopyranoside (IPTG) induction a high level of protein biosynthesis. However, a significant drawback of such an expression system is the need to use highly toxic cyanogen bromide to cleave the fusion protein. To eliminate this drawback, a new recombinant plasmid pPINS05 was obtained using oligonucleotide directed mutagenesis, in which the amino acid sequences of the IgG-binding domain of protein A and human proinsulin are linked via the GlySerArg peptide linker. Site-directed mutagenesis was performed using polymerase chain reaction. For this, 20 amplification cycles (94 ^° C, 30 s; 48 ^° C, 45 s; 72 ^° C, 45 s) with a mutagenizing primer were performed on the plasmid DNA matrix
AACAAAGGTACCCGTTTTGTTAACCAAC-
ACC and TCCGCCAA- Anchor Primer
AACAGAAGCT. The amplification product was hydrolyzed with restriction enzymes BamHI and HindIII and cloned into a vector obtained by hydrolysis of the plasmid pPINS03 with the same endonucleases. The result was a recombinant plasmid DNA pPINS05. Thus obtained plasmid pPINS05 determines the biosynthesis of a hybrid protein from which human proinsulin can be released by enzymatic hydrolysis with a mixture of trypsin and carboxypeptidase B.

Лигазную смесь использовали для трансформации компетентных клеток Е. coli JM109. Полученная в результате рекомбинантная плазмида pPINS07 была проанализирована гидролизом эндонуклеазами HaeIII и HpaII, а также совместным гидролизом рестриктазами EcoRI и HindIII. Структура гена, кодирующего гибридный белок, была подтверждена секвенированием по модифицированному методу Максама-Гилберта [12] (фиг. 1).To simplify the isolation and purification of the hybrid protein, hexahistidine sequences were introduced into its composition, which made it possible to purify it in one stage using affinity chromatography on metal chelate columns. For this, the plasmid pPINS05 DNA was subjected to exhaustive hydrolysis with BamHI restriction enzyme and the obtained fragments were ligated with a synthetic oligonucleotide duplex:

The ligase mixture was used to transform competent E. coli JM109 cells. The resulting recombinant plasmid pPINS07 was analyzed by hydrolysis of the endonucleases HaeIII and HpaII, as well as the combined hydrolysis of restriction enzymes EcoRI and HindIII. The structure of the gene encoding the hybrid protein was confirmed by sequencing using the modified Maxam-Gilbert method [12] (Fig. 1).

Recombinant plasmid DNA pPINS07 encoding a hybrid polypeptide with the amino acid sequence of human proinsulin is characterized by the following features:
has a molecular weight of 3.3 MDa (5.051 kbp);
encodes a fusion protein in which the sequence of domain B of staphylococcal protein A with a C-terminal hexahistidine linker is connected via the GlySerArg tripeptide to the amino acid sequence of human proinsulin;
consists of: EcoRI / HindIII fragment of plasmid pKK223-3 ^* containing the tac transcription promoter, β-lactamase gene (bla), replication initiation site (ori), transcription terminator of the ribosome operon E. coli [16], EcoRI / BamHI- a fragment comprising an artificial gene encoding the IgG-binding domain of protein A from S. aureus and a hexahistidine domain, and a BamHI / HindIII fragment encoding a sequence of human arginine-proinsulin;
contains: a hybrid tac transcription promoter, an artificial gene encoding a hybrid polypeptide, in which the sequence of domain B of staphylococcal protein A with a C-terminal hexahistidine linker is connected via the GlySerArg tripeptide to the amino acid sequence of human proinsulin; as a genetic marker, the β-lactamase (bla) gene, which determines the resistance of bacterial cells transformed with plasmid pPINS07 to ampicillin; unique recognition sites by restriction endonucleases having the following coordinates: EcoRI - 1, NcoI - 217, BamHI - 221, PstI - 342 and 417, HindIII - 492, SalI - 4513, ClaI - 4792.

 An advantage of the proposed plasmid construct is that the fusion gene contained in it encodes a protein with a human proinsulin sequence preceded by a sequence of one IgG-binding domain B of protein A with a hexahistidine linker, which greatly simplifies the isolation of recombinant protein through the use of high-tech affinity chromatography on metal chelate carriers .

 To obtain a producer strain of a hybrid polypeptide with human proinsulin, competent cells of Escherichia coli JM109 recombinant plasmid DNA pPINS07 are transformed.

 The resulting strain of Escherichia coli / pPINS07 is characterized by the following features.

 Morphological signs: small rod-shaped cells, gram-negative, non-spore-bearing, 1 x 3.5 μm, motile.

 Cultural traits: when growing on LB agar medium, the colonies are round, smooth, translucent, shiny, gray. The edge is even, the diameter of the colonies is 1 - 3 mm, the consistency is pasty. Growth in liquid media (LB, minimal medium with glucose) is characterized by even turbidity, the sediment easily sedimentes.

Physico-biochemical characteristics: cells grow at 4 - 42 ^o C, the optimum pH of 6.8-7.6. As a source of nitrogen, both ammonium mineral salts and organic compounds are used: amino acids, peptone, tryptone, yeast extract. When growing on a minimal medium, glycerin, carbohydrates, amino acids are used as a carbon source.

 Antibiotic resistance: cells of the producer strain show resistance to ampicillin (up to 300 mg / ml) due to the presence of the β-lactamase (bla) gene in the plasmid.

 The resulting strain was deposited in the collection of microorganisms of IBCh RAS under the number 013.

 In FIG. 1 shows the nucleotide sequence and its encoded amino acid sequence of the EcoRI / HindIII fragment of plasmid pPINS07; in FIG. 2 is a physical map of plasmid pPINS07.

 The invention is illustrated by the following examples.

 Example 1. Construction of intermediate recombinant plasmid DNA pPINS05.

10 μg of plasmid DNA pKK223-3 was treated in 200 μl of buffer containing 10 mm Tris-HCl, pH 7.5, 50 mm NaCl, 10 mm MgCl ₂ and 10 mm mercaptoethanol, hydrolyzed 7 units BamHI restriction enzymes under conditions of partial hydrolysis for 30 minutes at 20 ^° C. A linear DNA form is isolated from the obtained hydrolyzate by electrophoresis in a 1% gel of low melting agarose. The resulting DNA is treated for 30 min at 15 ^o C 10 units Klenov fragment of E. coli DNA polymerase I in 200 μl of buffer containing 20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 10 mM MgCl ₂ , 10 mM mercaptoethanol and 50 μM deoxynucleoside-5'-triphosphates. Thus obtained DNA is ligated in 100 μl of blunt ends ligation buffer [13]. 5 μl of the ligase mixture is used to transform competent E. coli JM109 cells [14]. Transformants are plated on LB agar containing 100 μg / ml ampicillin. Plasmid DNA was isolated from the grown clones and analyzed by restriction analysis using HaeIII and HpaII endonucleases. PKK223-3 ^* DNA containing no BamHI restriction enzyme site at position 256 was selected.

To clone the IgG-binding domain B of protein A, a polymerase chain reaction is performed on a 10 ng template of DNA from S. aureus (Cowan strain) in the presence of CCACCGA- oligonucleotide primers
ATTCTATGGCTGATAACAAAGAACAACAA and
CCACCGGATCCTTTGTTATCAGCTTTTT-
GTGCTTC in 100 μl amplification buffer [15]. 25 amplification cycles were carried out (95 ^° C, 45 s; 52 ^° C, 45 s; 72 ^° C, 45 s), the amplification product was hydrolyzed with EcoRI and BamHI restriction enzymes and a fragment of about 200 bp encoding the IgG binding domain B , purified by electrophoresis in 6% SDS page.

5 μg of plasmid DNA pKK223-3 ^{* is} treated with restriction enzymes EcoRI and HindIII and the vector portion of the plasmid (4.5 kb) is isolated by electrophoresis in 1% agarose gel.

1 μg of the resulting vector is ligated with 0.02 μg of a 200 bp EcoRI / BamHI fragment. containing the IgG-binding domain B gene and 0.02 μg of a 273 bp synthetic BamHI / HindIII DNA fragment encoding human proinsulin in 50 μl of ligation buffer [13] 10 hours at 8 ^° C in the presence of 20 units T4 DNA ligase. 3 μl of the ligase mixture is used to transform competent E. coli JM109 cells [14]. Transformants are plated on LB agar containing 100 μg / ml ampicillin. PPINS03 plasmid DNA was isolated from the grown clones and analyzed by restriction analysis using HaeIII and HpaII endonucleases, as well as co-hydrolysis with restriction enzymes EcoRI + BamHI and BamHI + HindIII. The final structure of plasmid pPINS03 was confirmed by the determination of the nucleotide sequence between the restriction sites EcoRI and BamHI.

To replace the methionine codon in the hybrid gene with an arginine one, a polymerase chain reaction is carried out on the pPINS03 plasmid matrix. For this, 0.01 μg of plasmid DNA is amplified in 50 μl of buffer [15] containing 25 mM Tris-HCl, pH 8.8, 10 mM (NH ₄ ) ₂ SO ₄ , 1.2 mM MgCl ₂ , 2 mM mercaptoethanol, 0.1 mM each deoxynucleoside 5-triphosphate and 50 pmol mutagenizing (AACAAAGGTACCCGTTTT-
GTTAACCAACACC) and anchor (TCCG-
CCAAAACAGAAGCT) primers in the presence of 2.5 units. Taq DNA polymerase. Spend 20 cycles of amplification (94 ^o C, 30 s; 48 ^o C, 45 s; 72 ^o C, 45 s). The amplification product is hydrolyzed with restriction enzymes BamHI and HindIII and ligated with 50 μg of the vector obtained by digesting the plasmid pPINS03 with the same restriction enzymes in a ligation buffer [13]. 10 μl of the ligase mixture is used to transform competent E. coli JM109 cells [14]. Transformants are plated on LB agar containing 100 μg / ml ampicillin. Plasmid DNA is isolated from the grown clones and analyzed by determining the nucleotide sequence of the DNA fragment between the restriction enzyme sites BamHI and HindIII. The plasmid pPINS05 thus obtained contains the tac promoter, followed by the EcoRI site, then between the EcoRI and BamHI sites the structural gene of domain B of staphylococcal protein A and the structural gene of human proinsulin between the sites BamHI and HindIII, connected to the domain of protein A by the arginine codon. E. coli JM109 cells transformed with pPINS05 plasmid are capable of synthesizing a hybrid polypeptide with human proinsulin upon induction of the IPTG tac promoter.

 Example 2. Construction of recombinant plasmid DNA pPINS07.

5 мкл лигазной смеси используют для трансформации компетентных клеток Е. coli JM109 [14] . Трансформанты высевают на LB-агар, содержащий 100 мкг/мл ампициллина. Из выросших клонов выделяют плазмидную ДНК и анализируют при помощи гидролиза рестриктазами EcoRI+BamHI и BamHI+HindIII. Из 16 проанализированных клонов 9 показали нужный набор рестриктных фрагментов. Окончательно строение рекомбинантной плазмиды pPINS07 подтверждают определением нуклеотидной последовательности фрагмента ДНК между сайтами рестриктаз BamHI и HindIII.5 μg of plasmid DNA pPINS05 is hydrolyzed by BamHI restrictase enzyme in accordance with procedure F described in [13]. The obtained vector fragment after purification by electrophoresis in a 1% gel of low-melting agarose is ligated with a 50-fold molar excess of oligonucleotide duplex:

5 μl of the ligase mixture is used to transform competent E. coli JM109 cells [14]. Transformants are plated on LB agar containing 100 μg / ml ampicillin. Plasmid DNA was isolated from the grown clones and analyzed by restriction enzyme digestion with EcoRI + BamHI and BamHI + HindIII. Of the 16 analyzed clones, 9 showed the desired set of restriction fragments. The final structure of the recombinant plasmid pPINS07 is confirmed by the determination of the nucleotide sequence of the DNA fragment between the restriction enzyme sites BamHI and HindIII.

 Example 3. Determining the productivity of a producer strain of a hybrid polypeptide with human proinsulin.

In 20 ml of LB liquid medium containing 100 μg / ml ampicillin, an individual colony of E. coli JM109 cells containing the plasmid pPINS07 was inoculated and grown at 37 ^° C on a shaker at 180 rpm for 4 hours to a turbidity of 0.8. Then IPTG was added to a concentration of 0.5 mM and incubation continued under the same conditions for 6 hours. A 2 ml sample was taken and centrifuged for 5 min at a speed of 6000 rpm, after which the cells were suspended in 200 μl of buffer containing 125 mM Tris- HCl, pH 6.8, 20% glycerol, 3% sodium dodecyl sulfate, 3% mercaptoethanol and 0.01% bromophenol blue, heated for 10 min in a boiling water bath. Samples of 2.5 μl, 5 μl, 7.5 μl, 10 μl and 15 μl were taken and analyzed by electrophoresis in a 13% polyacrylamide gel containing 0.1% sodium dodecyl sulfate [17]. The gel is stained with Coomassie R-250 and scanned on an Ultrascan XL laser densitometer. According to the scan, the hybrid polypeptide makes up 25-30% of the total cellular protein.

Sources of information:
1. Bell GI, Swain WF, Pictet R., Cordell B., Goodman HM, Rutter WJ // Nature, 1979, v. 282, p. 525 - 527.

 2. Sures I., Goeddel D.V., Gray A., Ulrich A. // Science, 1980, v. 208, p. 57-59.

 3. Williams D.C., Van Frank R.M., Murth M.L., Burnett J.P. // Science, 1982, v. 215, p. 687-689.

 4. Ovchinnikov Y. A., Efimov V.A., Ivanova I.N., Reverdatto S.V., Skiba N.P., Chakhmakhcheva O.G. // Gene, 1984, v. 31, p. 65-68.

 5. Sung W. L., Yao F.L., Zanab D.M., Narang S.A. // Proc. Natl. Acad Sci. USA, 1986, v. 83, p. 561-565.

 6. Tang J., Xue Y., Fan X., Fu Y. // Clin J. Biotechnol., 1993, v. 9, p. 71 - 78.

 7. Berg H., Walter M., Mauch L., Seissler J., Northemann W.J. // Immunol. Methods, 1993, v. 164, p. 221-231.

 8. Wei G., Hu M.H., Tang L.G. // Biochem. Mol. Biol. Int., 1995, v. 35, p. 37 - 46.

 9. McGregor W.C. // Ann. N.Y. Acad Sci., 1983, v. 413, p. 231-237.

 10. Cowley D.J., Mackin R.B. // FEBS Lett., 1997, v. 402, p. 124-130.

 11. Johansson P., Nilsson L., Samuelsson E., Moks T., Stahl S., Uhlen M. // Eur. J. Biochem., 1996, v. 236, p. 656-661.

 12. Chuvpilo S.A., Kravchenko V.V. // Bioorgan. Chemistry, 1983, v. 9, p. 1634 - 1637.

13. Sambrook J., Fritsch EF, Maniatis T. // Molecular Cloning. A Laboratory Manual. 2 ^nd ed. Cold Spring Harbor, NY 1989.

 14. Hanahan J. // J. Mol. Biol., 1983, v. 227, p. 557-580.

 15. Taylor G. R. In: Polymerase Chain Reaction. A practical Approach, v. 1, McPherson M.J., Quirke P., Taylor G. R., eds. Oxford Univ. Press Oxford 1994.

 16. Brosius J., Dull T.J., Sleeter D.D., Noller H.F. // J. Mol. Biol., 1981, v. 148, p. 107 -127.

 17. Laemmli U.K. // Nature, 1970, v. 227, p. 680-687.

Claims (2)

1. Recombinant plasmid DNA pPINS07 encoding a hybrid polypeptide with a human proinsulin sequence, in which the staphylococcal protein A domain B sequence is linked via the peptide linker His ₆ GlySerArg with the amino acid sequence of human proinsulin, with a molecular weight of 3.3 MDa (5051 bp) containing the EcoRI / HindIII fragment of plasmid pKK223-3 *, including the hybrid tac promoter, β-lactamase gene (bla), the replication initiation site (ori), and the transcription terminator of the E. coli ribosomal operon, EcoRI / BamHI fragment (220 n .o.) with artificial gene m encoding the IgG-binding domain of protein A from Staphylococcus aureus and the hexahistidine domain, and the BamHI / HindIII fragment (271 bp), encoding the sequence of human arginylproinsulin, the genetic marker is the β-lactamase (bla) gene, which determines the stability of transformed plasmid pPINS07 of E. coli cells to ampicillin, unique recognition sites by restriction endonucleases with the following coordinates: EcoRI - 1, Ncol - 217, BamHI - 221, PstI - 342 and 417, HindIII - 492, SalI - 4513, ClaI - 4792.  2. The strain Escherichia coli (pPINS07) IBCh RAS N 013 - producer of a hybrid polypeptide with the sequence of human proinsulin.

Images