RU2426780C2 - EXPRESSION PLASMID DNA p6E-tTF CODING EXTRACELLULAR AND TRANSMEMBRANE DOMAINS OF HUMAN TISSUE FACTOR AND E.coli BL21 [DE3]/p6E-tTF STRAIN - PRODUCER OF RECOMBINANT HUMAN TISSUE FACTOR - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: polypeptide contains extracellular and transmembrane domains of a human tissue factor. A DNA fragment coding this polypeptide, and a plasmid pET28a(+) are used to produce a genetic make-up enabling biosynthesis of the recombinant human tissue factor. Also, the E coli BL21 [DE3]/p6E-tTF strain that is a producer of the recombinant human tissue factor is offered.

EFFECT: high-yield recombinant protein and simplified recovery and purification procedures.

2 cl, 4 dwg, 3 ex

Description

The invention relates to the field of biotechnology, and in particular to a technology for the production of biologically active substances (BAS) by genetic engineering, more specifically to methods for producing human tissue factor.

Human tissue factor (TF) (synonyms: blood coagulation factor III, thromboplastin, CD 142, inactive tissue prothrombinase, apoprotein C-thermostable lipoprotein) is mainly localized in subendothelial tissue cells and fibroblasts, on the monocyte membrane, in the lungs, brain and heart tissues, intestines, uterus. The main biological function of TF is to provide local hemostasis, realized through its ability to directly initiate a blood coagulation cascade. If the lining of the vessel wall is damaged, TF comes into contact with blood, which ultimately contributes to the generation of thrombin and the launch of the blood coagulation mechanism.

TF located on the surface of “acidic” lipid membranes has a high affinity for the coagulation factor fVII circulating in the blood. In the presence of Ca ++ ions, TF apoprotein forms a stoichiometric complex with fVII, causing its conformational changes and turning the latter into fVIIa serine proteinase by cleavage of the Arg-152-Ile peptide bond. The reaction is stimulated by trace amounts of proteinases circulating in the blood (fXa, thrombin, fVIIa, fIXa). The resulting active complex (fVIIa-TF) converts fX to serine protease fXa by site-specific proteolysis, which, in turn, converts prothrombin to thrombin. The TF-fVIIa complex is capable of activating both factor X and factor IX, which ultimately contributes to the generation of thrombin [Boyle, E.M., Verrier, E.D., et al., 1996].

In its structure, TF is a glycoprotein with a molecular weight of about 47 kDa. The polypeptide part of human TF consists of 263 amino acids and contains 5 cysteine residues forming 2 intramolecular disulfide bridges in the extracellular domain of TF.

Only the extracellular domain of TF containing 219 amino acid residues Ser-1-Glu-219 and the surface of the lipid membrane participate in the formation of the complex of TF with fVIIa. The 23-membered transmembrane domain of TF provides the correct orientation of the extracellular domain relative to the membrane; the short intracellular domain of TF provides “anchoring” of TF in the membrane due to hydrophobic interaction of radicals of aliphatic amino acids and formation of the thioether bond with membrane lipids, palmitate or stearate, as the only Cys residue, and also participates in the signaling function of TF as a protease-activated receptor and not affects the formation of a complex with fVIIa.

The extracellular domain of TF is glycosylated at three residues - Asn11, Asn124, Asn137 (Boys et al., 1993). It contains 4 Cys residues that form two disulfide bonds, one in the N-terminal, the other in the C-terminal region of the Cys49-Cys57 and Cys186-Cys-209 domains (Bach "Initiation of Coagulation by Tissue Factor", CRc Critical Rewiews in Biochemistry, 23 (4): 339-368 (1988)). These bonds stabilize the corresponding peptide loops. It was shown that the disulfide bond Cys186-Cys-209 located in the C-terminal region is functionally significant; it is its participation that is necessary for the manifestation of the cofactor functions of the tissue factor with respect to factors VII and VIIa. (Rehemtulla, et al., 1991). Variations in the composition of N-linked TF oligosaccharides that affect the total charge of TF molecules without affecting its procoagulant activity (Verstreeg, Ruf, 2006).

Based on the analysis of the primary structure, the location of disulfide bonds and the study of the functional features of the extracellular domain of TF, its homology with interferon receptors alpha and beta family of cytokine receptors of class II was revealed. In the blood coagulation system, the interaction of factors VII / VIIa with the receptor - cofactor - TF accelerates several thousand times the activation of the external mechanism of hemocoagulation. This is achieved, first of all, due to the proteolytic mechanism that is initiated during the formation of a tissue factor complex with factor VII / VIIa of blood coagulation, in which TF acts as a cofactor and modulator of factor VII / VIIa (procoagulant function of TF). The binding of factor VIIa to TF causes an increase in intracellular Ca2 + phosphorylation of mitogen-activated protein kinases (MAP kinases) - Erk-1, Erk-2, p38, Jnk and leads to transcription of the Egr-1 gene (early growth response), usually induced by cytokines and growth factors . Currently, it is known that the so-called external pathway of blood coagulation induced by tissue factor is the main mechanism of thrombinogenesis in the vascular bed [Mann, et al., 1999, Roberts, et al., 1998, Mann, et al., 1990].

The receptor function of TF, which also indirectly contributes to the acceleration of the activation of the external mechanism of hemocoagulation in vivo, is realized by a non-proteolytic mechanism in which the cytoplasmic domain of TF itself participates in the intracellular signaling leading to cell adhesion and migration [Banner, et al., 1996, Ruf, et al., 1999, Prydz, et al., 1999].

Initial biotechnological systems for producing recombinant human TF included transient transfection of cultured human A-293 cell line with plasmid DNA encoding TF (US 5589363), or obtaining a producer strain E. coli carrying a plasmid encoding TF and a leader peptide of one of the Bordetella pertussis proteins (US 6261803); or obtaining a producer strain of E. coli, carrying a plasmid encoding the leader peptide B, directing the synthesized polypeptide into the periplasmic space of the bacterium, a short peptide fused with it, including the epitope of the monoclonal antibody and the factor Xa proteinase recognition site, and fused with it framed extracellular domain TF (US 5298599).

The level of TF production in all these cases did not exceed 1% of the total protein. In addition, there was the likelihood of significant proteolytic degradation of recombinant TF during cultivation, isolation and purification.

A more advanced way of expressing recombinant TF is the system described in (US 5858724). For expression of recombinant rabbit TF, highly homologous human TF, a vector containing the thioredoxin gene fused in frame with the TF gene and a special E. coli strain AD494 [DE3] were used.

This technology allows you to get TF in soluble form in significant quantities, but it requires special, precisely selected fermentation conditions, including forced cooling of the fermenter to a temperature of + 16 ° C and a short induction of the culture at a very low density (1.5 O.E.), which significantly limits the economic attractiveness of such an expression system, and also requires complex multi-stage chromatographic purification. In addition, rabbit TF and human TF are not completely identical, which introduces certain limitations in the field of their application.

The closest in technical essence analogue of the present invention is the plasmid pHIL-S1-rRTF and the yeast producer strain P. pastoris GS115 / pHIL-S1-rRTF (US 6100072). This expression system allows the production of recombinant TF having a small additional C-terminal peptide including a hexahistidine cluster. The use of this variant of the protein makes it possible to carry out its purification in one stage using metal chelate chromatography.

The disadvantage of this expression system is the low level of TF biosynthesis (not more than 1-2% of the total protein), which is due to the need to include recombinant TF in the membrane of the yeast cell during protein biosynthesis.

The technical problem solved by the authors was the creation of a technology for producing TF with a higher yield.

The technical result was achieved by creating a technology that includes a new expression plasmid DNA p6E-tTF encoding a fragment of human tissue factor, creating a producer strain E. coli based on it, and TF isolation technology.

The basis of this solution is the 6065 bp plasmid DNA p6E-tTF developed by the authors, encoding a 28-kb synthetic N-terminal peptide. and the extracellular and transmembrane TF domains fused with it in the frame. This plasmid DNA consists of a 5311 bp fragment. plasmid pET28a (+) and a 754 bp DNA fragment amplified using adapter oligonucleotides and a TF cDNA template. Plasmid DNA also contains a T7 RNA polymerase transcriptional promoter and terminator, a T7 phage 10 gene translation enhancer, and a genetic marker of antibiotic resistance kanamycin. The plasmid contains unique (that is, only) recognition sites for restriction endonucleases: HindIII (174), SpeI (180), NheI (928), ApaI (2031), PciI (3921).

Plasmid DNA p6E-tTF, consisting of 6065 bp, has the following distinctive features:

- has a molecular weight of 3.75 MDa;

- contains a sequence encoding the transmembrane and extracellular domains of human tissue factor;

- includes the NheI / HindIII fragment of the pET28a (+) plasmid containing the Kan (R) gene, which ensures the resistance of transformed cells to kanamycin, as well as recognition sites for the following restrictase enzymes: HindIII (174), SpeI (180), NheI (928), ApaI ( 2031), PciI (3921).

The plasmid was introduced using standard technology (Jac A. Nickoloff, Electroporation Protocols for Microorganisms (Methods in Molecular Biology) // Humana Press; 1 ^st edition (August 15, 1995) into E. coli cells, and the BL21 producer strain was obtained [DE3] / p6E-tTF, which provided synthesis in recombinant TF in the amount of 15-40% of the total protein content of cells.

The strain Escherichia coli BL21 [DE3] / p6E-tTF was deposited in the collection of the GNU All-Russian Research Institute of Agricultural Microbiology on 12/23/08 under No. 516.

Generic and species name of the host strain (recipient): Esherichia coli.

The number or name of the strain GIMM: BL21 [DE3] / p6E-tTF. Pedigree GIMM: derivative of E. coli B. The strain was obtained by transformation of strain BL21 [DE3] plasmid DNA p6E-tTF into LLC ITs Novtekhmat, 115093, Moscow, ul. Bolshaya Serpukhovskaya, d.44, office 33.

Cultural and morphological features of the strain GIMM: gram-negative rods, form threads; on an agar medium — whitish large colonies with an uneven edge.

The scope of the GIMM strain: obtaining a recombinant human tissue factor for the production of thromboplastin reagents, namely obtaining a deletion variant of human tissue factor with the yield of the target product after induction of at least 20% of the total protein. The activity of the strain is determined by the method of densitometry electrophoregram.

The strain is stored under the following conditions: Lurie-Bertrand medium, 1% glucose, 10% glycerol.

The strain propagates under the following conditions: Lurie-Bertrand medium, 1% glucose, kanamycin sulfate 30 μg / ml.

Genetic features of the strain.

The genotype of the strain is F ^- ompT gal dcm lon hsdS _B (r _B ^- m _B ^- ) λ (DE3 [lacI lacUV5-T7 gene 1 indl sam7 nin5]).

Recombinant plasmid: p6E-tTF; 6065 bp, unique restriction sites for HindIII (174), SpeI (180), NheI (928), ApaI (2031), PciI (3921).

The strain Escherichia coli BL21 [DE3] / p6E-tTF encodes the extracellular and transmembrane domains of the recombinant human tissue factor fused in frame with an N-terminal peptide containing a six-histidine cluster and an enterokinase cleavage site immediately in front of the first amino acid of the extracellular domain of the tissue factor.

Design features and results of the practical application of the invention are shown in the following drawings.

Figure 1 - DNA sequence in the region of the insert, the sequence of the encoded polypeptide.

Figure 2 - scheme of the plasmid p6E-tTF, where the following notation is used: pBR322 ori is the plasmid replication initiation site, f1 ori is the bacteriophage replication initiation site f1, T7 prom is the T7 bacteriophage RNA polymerase promoter, ORF is the region encoding tTF, 6 -His is the hexahistidine cluster, EK-PRO is the enterokinase processing site, ECD is the region encoding the TF extracellular domain, TM is the region encoding the TF transmembrane domain, STOP is the stop codon block, T7term is the transcription termination site, lacI is the lactose repressor gene operon, KanR2 - kanamycin resistance gene.

Figure 3 is an electrophoregram of the total protein of E. coli strains.

BL21 [DE3] / p6E-tTF before (-) and after (+) induction of IPTG for hours at + 37 ° C.

Figure 4 is an electrophoregram of the fractions of insoluble protein (INS), soluble protein (SOL), enriched inclusion bodies (WIB), purified denatured recombinant TF (EL) and purified recombinant TF after renaturation and concentration (REF). Lanes INS, SOL, WIB - restoring electrophoresis conditions, tracks EL, REF - non-reducing.

The practical applicability of the claimed invention is illustrated by the following examples.

Example 1. Obtaining plasmid DNA p6E-tTF.

A polymerase chain reaction was performed using specific primer synthetic oligonucleotides F3for, sF3rev, tF3rev, f1F3rev on a Tertsik MS2 instrument (DNA Technology, Russia).

Primary nucleotide sequences of primers:

F3for - TTGCTAGCGACGACGACGACAAGTCAGGCACTACAAATAC,

tF3rev - GGAAGCTTACTACTTGTGTAGAGATATAG

Preparative reactions were carried out in a volume of 50 μl, analytical in a volume of 25 μl. An incubation mixture of the following composition was prepared: 1x buffer for thermostable DNA polymerase; 10 pM of each primer oligonucleotide; 2 mM each deoxyribonucleotide triphosphate; 1-2 units thermostable DNA polymerase 0.1-0.2 μg of DNA. 50 μl of light mineral oil was layered on top of this mixture and amplified according to the scheme: 1 cycle - denaturation - 94 ° C, 3 min; 25 cycles - denaturation 94 ° С, 30 sec, annealing Х ° С 30 sec, completion 72 ° С, 45-60 sec; 1 cycle - completion 72 ° C, 7 min, where the calculation of the annealing temperature (X) was carried out according to the formula: X = 2 ° C × n (A / T) + 4 ° C × n (G / C) - 5 ° C, where n is the number of corresponding nucleotides.

The cDNA of the human TF gene deposited in the public database GeneBank NM_001993.2, distributed by Origene in the form of a plasmid, catalog number SC110888 was used as a matrix.

PCR products from pairs of primers F3for and sF3rev; F3for and tF3rev, F3for and f1F3rev, variants of TF polypeptides were mixed with 1 μl of application buffer and separation was performed on a 1% agarose gel with the addition of ethidium bromide (0.4 μg / ml). For DNA isolation, the band corresponding to the amplification product visualized by UV was excised from an agarose gel, placed in a 1.5 ml tube and DNA was isolated using the Wizard SV Gel and PCR Clean-Up System reagent kit (Promega ", USA) according to the protocol of the manufacturer.

The purified products were ligated into the PAL-TA vector plasmid (Evrogen CJSC, Russia) using T4 phage DNA ligase and standard buffer solution (Fermentas, Lithuania). Ligation was carried out in a volume of 10 or 20 μl, with a molar ratio of vector and insert of 1:10, for 2-20 hours at room temperature. T4 phage DNA ligase and standard buffer solution (Fermentas, Lithuania) were used for ligation. Ligation was carried out in a volume of 10 or 20 μl, with a molar ratio of vector and insert of 1:10, for 2-20 hours at room temperature. The obtained ligase mixtures transformed E. coli cells of strain DH5α, with the genotype F-φ80lacZΔM15 Δ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r _k -, m _k +) phoA supE44 λ-thi-1 gyrA96 relA1. For this, 5 μl of the ligase mixture was added to 200 μl of a frozen suspension of E. coli cells, incubated on ice for 30 minutes to sorb plasmid DNA, heated to 42 ° C for 60 seconds, and incubated on ice for 5 minutes. Then 800 μl of LB nutrient broth was added and incubated at 37 ° C for 60 minutes. After incubation, the suspension was transferred to a Petri dish with a solid agar medium containing ampicillin at a concentration of 100 μg / 1 ml of agar and placed in a thermostat at 37 ° C for 18 hours.

Colonies of E. coli, selected as a result of blue-white screening, were analyzed by clone PCR using primer oligonucleotides for the recipient plasmid sequences M13rev and M13for (primary nucleotide sequences of primers:

M13 rev 5'GAGCGGATAACAATTTCACACACAGAG3 ',

M13 for 5'GCCAGGGTTTTCCCAGTCACGA3 ') and specific oligonucleotides F3for, sF3rev, tF3rev, flF3rev (primary nucleotide sequences of primers

F3for - TTGCTAGCGACGACGACGACAAGTCAGGCACTACAAATAC,

tF3rev - GGAAGCTTACTACTTGTGTAGAGATATAG,

Selected clones were grown in 5 ml LB nutrient broth and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to the standard protocol of the manufacturer. The resulting genetic constructions PAL-tTF were analyzed by PCR sequencing using primer oligonucleotides to sequences recipient plasmid and M13rev M13for (primary nucleotide sequences of primers M13 rev 5'GAGCGGATAACAATTTCACACACAGG3 ', M13for 5'GCCAGGGTTTTCCCAGTCACGA3') and compliance verification carried coding sequence fragments TF sequences reference cDNA of the human TF gene published in the public database GeneBank NM_001993.2. After that, preparative restriction of the plasmid PAL-tTF with restriction endonucleases NheI and HindIII was performed. The reaction products were separated on a 1% agarose gel and isolated using the Wizard SV Gel & PCR Clean-Up System reagent kit according to the standard manufacturer's procedure.

The recipient plasmid pET28a (+) was sequentially digested with each of the NheI and HindIII endonucleases. First, aliquots of the plasmid were incubated for 2 hours in a water thermostat at 37 ° C with each of the restriction enzymes, the complete linearization of the plasmids was controlled by agarose gel electrophoresis (within the sensitivity of the method), after which a second restriction enzyme was added and incubated for another 2 hours. Then the samples were combined, the restriction enzymes were inactivated by heating at 65 ° C for 20 minutes, and the vector was dephosphorylated with alkaline phosphatase (Fermentas, Lithuania) according to the manufacturer's recommendations. Alkaline phosphatase was inactivated by heating to 85 ° C for 20 minutes. Restricted and dephosphorylated plasmid was treated with an equal volume of 1: 1 phenol-chloroform mixture and the aqueous phase was reprecipitated with 3 volumes of ethanol. It was centrifuged for 10 minutes at a speed of 13200 rpm at room temperature, the precipitate was washed with 70% alcohol, dissolved in water and used to set up a ligation reaction at a working concentration of 10 ^-2 μg / μl.

The ligation reaction of the purified fragment corresponding to the tTF minigen and the recipient plasmid was carried out as described above. After that, cells of E. coli strain DH5α were transformed, as described above.

Colonies of E. coli were analyzed by PCR from clones using the primer oligonucleotide for the sequence of T7t-5TGCTAGTTATTGCTCAGCGG3 'vectors and the specific oligonucleotides F3for, tF3rev (primary nucleotide sequences of the F3for primers - TTGCTAGGAGCACTGACTAGGAGCACTGACTAGCAGCACTGAC.

Selected clones were grown in 5 ml LB nutrient broth and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to the standard protocol of the manufacturer.

Using PCR sequencing for the p6E-tTF construct, the nucleotide sequence of both complementary DNA strands was determined for the insertion region. As a result of sequencing, it was found that the obtained plasmid preparation does not contain mutations in the insertion region, i.e., the correct sequence of the TF cDNA fragment is encoded.

Example 2. Obtaining a producer strain, evaluating the productivity of the producer strain and localization of the target protein.

To obtain a producer strain of recombinant TF, p6E-tTF plasmid DNA was used to transform competent cells of Escherichia coli BL21 (DE3) (with genotype F - ompT hsdS _B (rm-) gal dcm (DE3)) and clones that retained the level of recombinant biosynthesis were selected a polypeptide of not less than 10-12% of the total cellular protein for at least six consecutive passages.

For this, E. coli BL21 (DE3) cells were transformed with p6E-tTF plasmid and plated on agar medium supplemented with kanamycin up to 30 μg / ml, clones were selected by PCR analysis using primer oligonucleotides for the T7t vector sequences and specific F3for, tF3rev oligonucleotides . The selected clones were expanded in 5 ml of nutrient broth with the addition of kanamycin to 30 μg / ml, plasmid DNA was isolated, its restriction analysis was performed with NheI and HindIII endonucleases, and the nucleotide sequence was verified by PCR sequencing using primer oligonucleotides to the sequences of p6E vector, as described above. After that, analytical expression of the target proteins was performed.

For this, clones of E. coli BL21 (DE3) cells transformed with p6E-tTF plasmid were grown in nutrient broth with the addition of kanamycin up to 30 μg / ml and glucose solution up to 1% for 12-14 hours, a new portion of the nutrient medium was inoculated with a ratio of 1 : 100, the culture was grown until an optical density of 2 OE was reached, wasopropylthio-pD-galactoside was induced and cultured for another 3-6 hours. After cultivation, the cell pellet was separated by centrifugation, the cells were resuspended in a solution of 10 mM Tris-HCl, 2 mM EDTA-Na, 0.1% Triton-X100, 10 μg / ml lysozyme in a ratio of 10 ml of solution per 1 g of cell paste, the suspension was kept 30 min on ice and cell destruction was performed with an ultrasonic dispersant. Samples were taken for electrophoretic analysis, the soluble and insoluble fraction of proteins was separated by centrifugation, the precipitate was additionally resuspended in the same solution, and precipitated by centrifugation. The analysis results are shown in figure 3, the target protein was almost completely localized in the insoluble fraction of proteins, i.e. was in the form of a “inclusion body”.

Example 3. Isolation, purification and renaturation of recombinant TF.

The producer strain BL21 [DE3] / p6E-tTF was seeded from the museum by a loop by a draining stroke on a Petri dish with agarized LB medium containing 30 μg / ml kanamycin and 1% glucose, grown for 14 hours at + 37 ° C. One single colony of the strain was transferred into 5 ml of LB liquid medium containing 30 μg / ml kanamycin and 1% glucose and grown on a rocking chair for 14 hours at + 37 ° C. The contents were inoculated with 250 ml of 2xYT medium containing 30 μg / ml kanamycin and 0.1% glucose, grown on a shaker for 3.5 hours at + 37 ° C, samples of the bacterial suspension were taken for analysis, IPTG was added to a final concentration of 1 mM, and still grown 4 hours.

The cell pellet was resuspended in 20 ml of solution A (50 mM Tris, pH 7.4, 2 mM EDTA), lysozyme up to 0.1 mg / ml and Triton X100 up to 0.1% were added, incubated for 30 min on ice. Cells and genomic DNA were destroyed using an ultrasonic disperser in 10 s pulses until the increased viscosity of the suspension disappeared. The precipitate was separated by centrifugation for 10 minutes at 20,000 rpm. The precipitate was resuspended in solution A, NP-40 detergent was added to 1%, the suspension was treated with an ultrasonic disperser until the sediment particles larger than 1 mm disappeared, and the precipitate was separated by centrifugation for 10 min at 20,000 rpm. The obtained precipitate was resuspended in solution A, NaCl was added to 500 mM, the suspension was treated with an ultrasonic disperser until the sediment particles larger than 1 mm disappeared, and the precipitate was separated by centrifugation for 10 min at 20,000 rpm. The resulting precipitate of enriched inclusion bodies was stored at -70 ° C.

To solubilize the target protein, solution B (6 M guanidine chloride, 50 mM sodium phosphate, 50 mM beta-mercaptoethanol, pH 8.0) was added to the precipitate of inclusion bodies in a ratio of 10 ml of solution per 1 g of precipitate.

The suspension was incubated with stirring for 2 hours at + 37 ° C, insoluble cell debris was separated by centrifugation for 10 min at 20,000 rpm. The supernatant was diluted 5 times with solution B (6 M urea, 50 mm sodium phosphate, 300 mm sodium chloride, pH 8.0) to reduce the final concentration of beta-mercaptoethanol, the precipitate was separated by centrifugation for 10 min at 20,000 rpm and the supernatant was applied on a column with a Chelating Sepharose Fast Flow sorbent (GE Healthcare, USA) containing chelated nickel ions and balanced solution B. The column was washed sequentially with solution G (6 M urea, 50 mM sodium phosphate, 300 mM sodium chloride, pH 7.0) and solution D (6 M urea, 50 mm sodium phosphate, 300 mm sodium chloride i, 50 mM imidazole pH 7.0). The purified protein was eluted with solution E (6 M urea, 50 mm sodium phosphate, 300 mm sodium chloride, 250 mm imidazole, pH 7.0). The eluate was concentrated by ultrafiltration to a final protein concentration of 20 mg / ml and desalted by diafiltration.

Dithiothreitol was added to the concentrated desalted solution of the target protein to a final concentration of 10 mM, incubated for 2 hours at + 37 ° C to restore disulfide bonds, and octyl glucoside was added to a final concentration of 0.1 M. The denatured protein solution was added dropwise to a stirred refolding solution containing 20 mM Tris-HCl, pH 8.0, 1 mM EDTA-Na, 150 mM NaCl, 0.1 M octyl glucoside, 0.3 mM cysteamine and 1 mM cystamine. After the denatured protein solution was added, stirring was continued for 14 hours at a temperature of + 4 ° C, the formed precipitate of the denatured protein was separated by centrifugation, the supernatant was concentrated by ultrafiltration to a final protein concentration of 1 mg / ml and the protein was transferred via diafiltration to a storage solution containing 20 mM Tris-HCl, pH 8.0, 1 mM EDTA-Na, 150 mM NaCl, 0.1 M octyl glucoside, 1 mM beta-mercaptoethanol. The resulting prepared solution was stored at -20 ° C.

TF analysis was performed using SDS-PAGE under non-reducing conditions (Fig. 4). The purity of the target protein after purification was> 90% by densitometry of electrophoregrams, the proportion of covalent multimers <5%. The yield of the target protein from the total protein by SDS densitometry - PAG 100 mg / l culture (10% of the total protein). The yield of denatured protein after purification of 75 mg / l of culture (75%).

The product yield after refolding 30 mg / l of culture (total yield 40%). Protein after refolding is suitable for direct preparation of a thromboplastin reagent.

The results showed that the inclusion in the sequence of the synthesized protein of a short additional N-terminal peptide encoded by codons optimal for E. coli allows increasing the expression level of the heterologous protein due to the efficient translation of the first 28 amino acids of the polypeptide. This peptide also allows chromatographic purification of the expressed protein under denaturing conditions by metal chelate chromatography, which, in turn, allows one to obtain a completely purified product using a single chromatographic step. If necessary, this peptide can be removed by treatment with enterokinase and subsequent repeated metal chelate chromatography.

The advantages of the proposed E. coli BL21 [DE3] strain are the use of bacteria with the Lon OmpT phenotype, which excludes the possibility of proteolytic cleavage of the synthesized de novo recombinant TF and contamination of the secreted protein with the most active E. coli proteases. The T7 bacteriophage R7 polymerase RNA polymerase gene integrated in its genome is controlled by the lac promoter, which, when using the T7-lac promoter and T7 terminator in plasmids, leads to fast and efficient protein production.

Another common advantage of the used strain, expression vector and biosynthesis strategy is the ability to carry out induction without changing the temperature of cultivation.

Claims (2)

1. Expression plasmid DNA p6E-tTF, comprising a DNA region corresponding to SEQ ID NO: 1 and encoding a polypeptide with the sequence SEQ ID NO: 2, containing the extracellular and transmembrane domains of human tissue factor, as well as the NheI / HindIII fragment of plasmid pET28a (+) containing the Kan (R) gene. 2. The recombinant E. coli strain BL21 [DE3] / p6E-tTF stably transformed with the plasmid DNA p6E-tTF according to claim 1 is a producer of a deletion variant of a recombinant human tissue factor containing transmembrane and tissue domains.

Images