RU2550027C2 - EXPRESSION PLASMID CONTAINING DNA FRAGMENT CODING MUTEIN [C245S] OF HUMAN TISSUE FACTOR WITH INSEPARABLE C-TERMINAL TAG, BACTERIUM E coli PRODUCING PRECURSOR PROTEIN OF MUTEIN [C245S] OF HUMAN TISSUE FACTOR WITH INSEPARABLE C-TERMINAL TAG, METHOD FOR PRODUCING RECOMBINANT MUTEIN [C245S] OF HUMAN TISSUE FACTOR WITH INSEPARABLE C-TERMINAL TAG, RECOMBINANT MUTEIN [C245S] OF HUMAN TISSUE FACTOR WITH INSEPARABLE C-TERMINAL TAG - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used for recombinant production of human tissue factor (hTF). Constructed is a plasmid pHYP-10ETFCS6 having a length of 5,912 b.p. with a physical map presented on Fig. 2, for expression in a bacterium of the genus Escherichia, which is a precursor of the mutant [C245S] hTF containing an inseparable N-terminal leader peptide containing a deca-histidine cluster and an enterokinase identification sequence fused in a frame with a sequence coding the above mutein fused in the frame with the sequence coding the additional inseparable C-terminal peptide containing the deca-histidine cluster. A method for producing the precursor of the mutein[C245S]hTF contains culturing the producing bacterium in a nutrient medium, recovering inclusion bodies, solubilising the precursor protein, performing a metal chelator chromatography in the denaturation environment, re-folding and diafiltration of the protein solution. A method for producing the mature mutein[C245S] hTF involves detecting the N-terminal leader peptide from the above mutein precursor with using enterokinase and recovering the target protein.

EFFECT: invention enables increasing the level of biosynthesis and yield of pro-coagulation active hTF.

9 cl, 5 dwg, 1 tbl, 7 ex

Description

Technical field

The invention relates to the field of biotechnology, and in particular to a technology for the production of biologically active substances (BAS) by genetic engineering, more specifically to methods for producing a biologically active recombinant human tissue factor.

The prior art.

Human tissue factor (TF) (synonyms: blood coagulation factor III, thromboplastin, CD142, inactive tissue prothrombinase, apoprotein C-thermostable lipoprotein) is a transmembrane protein located mainly in subendothelial tissue cells, which initiates the coagulation cascade due to activation of factor VII .

The formation of the TF-factor VII complex causes conformational changes in the latter, leading to cleavage of the Arg-152-Ile bond, accompanied by the conversion of fVII to the serine protease fVIIa. The resulting active complex (fVIIa-TF) converts zymogen factor X into serine protease fXa by site-specific proteolysis, which, in turn, converts prothrombin to thrombin. It was shown that the TF-fVIIa complex is capable of activating both factor X and factor IX, which ultimately contributes to the generation of thrombin (Boyle, E.M., Verrier, E.D., et al., 1996).

In terms of structure, TF is a glycoprotein weighing 47 kDa, consisting of 263 amino acids, and containing 5 cysteine residues forming 2 intramolecular disulfide bonds. The extracellular domain (Ser-1-Glu-219, hereinafter, the numbering of amino acids for the mature protein) and the surface of the lipid membrane is involved in the formation of a complex with fVII; The 23-membered transmembrane domain of TF provides the correct orientation of the extracellular domain relative to the membrane; the intracellular domain of TF provides anchoring of TF in the membrane and signal transmission during the functioning of TF as a transmembrane receptor. The function of the transmembrane receptor is not associated with the function of the cofactor fVII, recombinant TF without an intracellular domain exhibits procoagulation activity.

The extracellular domain of TF contains 4 cysteine residues forming two disulfide bonds Cys49-Cys57 and Cys186-Cys-209 (Bach "Initiation of Coagulation by Tissue Factor", CRc Critical Rewiews in Biochemistry, 23 (4): 339-368 (1988)) . It has been shown that the disulfide bond Cys186-Cys-209 is functionally significant; it is its participation that is necessary for the manifestation of the cofactor functions of the tissue factor with respect to factors VII and VIIa (Rehemtulla, et al., 1991).

The extracellular domain of TF is glycosylated at three asparagine residues - Asn11, Asn124, Asn137 (Boys et al., 1993). Variations in the composition of N-linked TF oligosaccharides affect the total charge of the tissue factor molecule, but do not affect its procoagulant activity (Verstreeg, Ruf, 2006).

The intracellular domain provides anchoring in the membrane due to the hydrophobic interaction of radicals of aliphatic amino acids and the formation of a thioether bond with membrane lipids by the only Cys245 cysteine residue.

Tissue factor is the main component of the “thromboplastin reagent” used for laboratory diagnostics of pathologies of the blood coagulation system using the prothrombin test (PT). PT is one of the most common methods of laboratory diagnostics, which is performed both during screening examinations and, for example, for monitoring anticoagulant therapy with warfarin or heparin. During the test, a molar excess of calcium chloride and a “thromboplastin reagent”, which are liposomes of a certain composition and anchored in them, are added to the blood plasma sample containing sodium citrate. A change in plasma coagulation time relative to a standard sample indicates a pathology of the hemostatic system. The average clotting time of standard plasma samples (prothrombin time, PV) and the ratio of clotting time of the studied plasma and standard (prothrombin ratio, PO) varies significantly in different test systems and depends, first of all, on the properties of the thromboplastin reagent. To normalize the results, an exponent is used to which the found software value should be raised - the international sensitivity index (MIC or ISI). The value of the MIC in the kits used usually varies in the range from 1 to 2. When monitoring anticoagulant therapy, the MIC of the thromboplastin reagent used should be no higher than 1.4.

A traditional source of TF for the production of a thromboplastin reagent is the cadaveric brain, human placenta, and rabbit brain. Since the TF content in these tissues is very small and the composition of natural lipids is not optimal, reagents based on natural TF variants have variable sensitivity and require exact observance of the preparation technology, and are also sensitive to variations in the composition of the raw materials. In addition, brain tissue extracts may contain dangerous viruses and prion pathogens, which increases the risk to laboratory personnel. Using recombinant TF (and a controlled mixture of synthetic lipids) allows you to get the best quality reagents.

A number of authors used transient transfection of cultured human A-293 cell line plasmid DNA encoding TF (US 5589363) to obtain recombinant human TF, or obtaining a producer strain of E. coli carrying a plasmid encoding TF and the leader peptide of one of the Bordetella pertussis proteins ( US 6261803); or obtaining a producer strain of E. coli, carrying a plasmid encoding the leader peptide B, directing the synthesized polypeptide into the periplasmic space of the bacterium, a short peptide fused with it, including the epitope of the monoclonal antibody and the factor Xa proteinase recognition site, and fused with it framed extracellular domain TF (US 5298599).

The level of TF production in all these cases did not exceed 1% of the total protein. In addition, there was the likelihood of significant proteolytic degradation of recombinant TF during cultivation, isolation and purification.

A more advanced way of expressing recombinant TF is the system described in (US 5858724). For expression of recombinant rabbit TF, highly homologous human TF, a vector containing the thioredoxin gene fused in frame with the TF gene and a special E. coli strain AD494 [DE3] were used. This technology allows you to get TF in soluble form in significant quantities, but it requires special, precisely selected fermentation conditions, including forced cooling of the fermenter to a temperature of + 16 ° C and a short induction of the culture at a very low density (1.5 O.E.), which significantly limits the economic attractiveness of such an expression system, and also requires complex multi-stage chromatographic purification. In addition, rabbit TF and human TF are not completely identical, which introduces certain limitations in the field of their application.

A relatively convenient biotechnological system for producing tissue factor is based on the yeast producer strain P. pastoris GS115 / pHILS1-rRTF (US 6100072). This expression system allows one to obtain recombinant TF with a deletion of the intracellular domain and the addition of a small additional C-terminal peptide, including a hexahistidine cluster. The use of this variant of the protein makes it possible to carry out its purification in one stage using metal chelate chromatography. The disadvantage of this expression system is the low level of TF biosynthesis (not more than 1-2% of the total protein), which is due to the need to include recombinant TF in the membrane of the yeast cell during protein biosynthesis.

The closest in technical essence analogue of the present invention is the plasmid p6E-tTF and the producer strain BL21 (DE3) / tTF (RU2426780). This expression system allows one to obtain a deletion variant of recombinant TF, including extracellular and transmembrane domains and having a cleavable N-terminal leader peptide containing a hexahistidine cluster. The use of this variant of the protein makes it possible to carry out its purification in one stage using metal chelate chromatography under denaturing conditions. Among the disadvantages of this expression system, one can distinguish: 1) a low level of TF biosynthesis by a bacterial cell (100 mg / l of culture — 10% of the total cell protein) caused by the use of natural cDNA containing a codon that is not optimal for bacteria; 2) insufficient protein purity after purification by metal chelate chromatography, due to insufficient affinity of one 6-histidine cluster for the sorbent; 3) a supposedly low yield of the renaturation procedure caused by the high hydrophobicity of the C-terminal portion of the protein, which is a transmembrane domain. In addition, the suitability of the TF variant described in this patent for the preparation of a thromboplastin reagent has not been established.

A common significant drawback of the examples described above is the presence of an unpaired cysteine residue at position 245 of the human tissue factor, which in a natural protein forms a thioether bond with membrane lipids. When a human tissue factor is isolated from natural sources, this cysteine residue is usually masked by bound lipids, while in recombinant variants of a human tissue factor, it can be in a reduced state, which reduces the stability of the protein and can potentially lead to disulfide exchange with other cysteine residues and the formation of covalently bound TF dimers, i.e. to a significant decrease in the yield of the refolding procedure.

A brief description of the present invention

The technical problem solved by the authors was the creation of a technology for obtaining procoagulatively active recombinant human tissue factor with replacing the unpaired cysteine residue at position 245 with a serine residue [C245S], an inseparable additional C-terminal peptide, separated by an additional N-terminal peptide; with a higher level of biosynthesis, high yield during purification, suitable for obtaining a thromboplastin reagent.

The technical result was achieved by creating a technology that included a new expression plasmid DNA pHYP-10ETFCS6 encoding a synthetic human tissue factor gene optimized for expression in the bacterial system with the replacement of [C245S], creating a producer strain E. coli based on it and recombinant isolation technology a human tissue factor mutein suitable for creating a thromboplastin reagent.

The solution is based on a 5912 bp expression plasmid pHYP-10ETFCS6, developed by the authors, containing a DNA fragment containing a sequence encoding a 23 amino acid synthetic cleavable leader leader peptide containing a decagystidine cluster and an enterokinase cleavage site fused in frame with the sequence encoding the mutein [C245S] of human tissue factor and containing at the C-terminus a non-cleavable peptide of 13 amino acids in length, including a hexahistidine cluster. The indicated fragment contains the codon composition optimal for E. coli, which allows increasing the expression level of the heterologous protein due to the effective translation of all amino acids of the polypeptide. The presence of a cleavable N-terminal and non-cleavable C-terminal peptides with polyhistidine clusters allows for more efficient purification of the polypeptide using metal chelate chromatography; the presence of the TF intracellular domain, additionally increased by a non-cleavable C-terminal peptide containing hydrophilic and charged amino acid residues, allows efficient protein refolding and its subsequent lipidization does not affect the manifestation of procoagulant activity, which leads to a significant increase increase the yield of the target protein and reduce the cost of the thromboplastin reagent based on it.

The mutation [C245S] allows one to renature human tissue factor with a higher yield, since the absence of unpaired cysteine will reduce the likelihood of establishing intermolecular disulfide bonds, i.e. the formation of covalent multimers.

An object of the present invention is to provide an expression plasmid containing a DNA fragment encoding a human tissue factor mutein [C245S] precursor, comprising a sequence encoding an additional cleavable N-terminal peptide containing a decagidine cluster and an enterokinase recognition sequence fused with a mutein encoding sequence [ C245S] human tissue factor, as well as a 13 amino acid length non-cleavable C-terminal peptide fused to it, including hexahistidine A new cluster, under the control of a promoter that functions in a bacterial cell.

It is also an object of the present invention to provide an expression plasmid as described above, wherein said plasmid is represented by plasmid pHYP-10ETFCS6.

It is also an object of the present invention to provide a bacterium belonging to the genus Escherichia transformed with the plasmid described above, a producer of the recombinant mutein [C245S] human tissue factor precursor with a non-cleavable C-terminal peptide and a cleaved N-terminal leader peptide.

It is also an object of the present invention to provide a bacterium as described above, wherein said bacterium is represented by E. coli strain BL21 [DE3] / pHYP-10ETFCS6.

It is also an object of the present invention to provide a recombinant mutein precursor [C245S] of human tissue factor with a non-cleavable C-terminal peptide comprising a hexahistidine cluster containing a cleavable N-terminal leader comprising a decagystidine cluster and an enterokinase recognition sequence.

It is also an object of the present invention to provide a method for producing a recombinant mutein [C245S] recombinant human tissue factor with a non-cleavable C-terminal peptide and a cleavable N-terminal leader peptide, including culturing the above bacteria in a nutrient medium, isolating inclusion bodies, solubilizing the precursor protein, metal chelating denaturing chromatography and refolding of the precursor protein.

It is also an object of the present invention to provide the method described above in which E. coli strain BL21 [DE3] / pHYP-10ETFCS6 is cultured.

It is also an object of the present invention to provide a method for producing a thromboplastin reagent based on mutein [C245S] recombinant human tissue factor, comprising mixing the renatured mutein [C245S] recombinant human tissue factor with lipids in the presence of detergent and subsequent removal of the detergent with dialysis.

It is also an object of the present invention to provide a thromboplastin reagent based on a mutein [C245S] human tissue factor obtained by the method described above.

Detailed description of the present invention

To implement the present invention, the main technical problem was the creation of a method for producing recombinant mutein [C245S] human tissue factor using a bacterium transformed with an expression plasmid containing a DNA fragment encoding a recombinant mutein precursor [C245S] recombinant human tissue factor comprising a sequence encoding a cleavable N- 19 additional amino acid terminal peptide comprising a decagystidine cluster and an e recognition sequence terokinazy, and fused in frame with it the sequence encoding the recombinant mutein [C245S] Recombinant human tissue factor and neotscheplyaemy C-terminal peptide of 13 amino acids in length, containing hexa-histidine cluster, under the control of a promoter functioning in a bacterial cell.

The term "expression plasmid" means plasmid DNA containing all the necessary genetic elements for the expression of a gene embedded in it, for example, such as a promoter, terminator. A specific example of the genetic elements necessary for the expression of the recombinant mutein [C245S] human tissue factor precursor in the expression cassette of the present invention is, but is not limited to, the T7 bacteriophage RNA polymerase promoter.

A DNA fragment encoding a recombinant mutein precursor [C245S] of human tissue factor is, for example, a synthetic gene encoding a recombinant mutein [C245S] precursor of human tissue factor comprising a sequence encoding a cleavable N-terminal additional peptide comprising a decagystidine cluster and enterocene recognition sequence fused in frame with the sequence encoding the recombinant mutein [C245S] of human tissue factor and non-cleavable C-terminal hexahistidine vy cluster. The specified DNA fragment can be obtained, for example, by PCR (see Example 1, Fig. 1). Also, the indicated DNA fragment can be obtained using the cloning technology of Sloning BioTechnology, described in PCT application WO 2005071077.

In order to ensure efficient translation of the cloned gene into E. coli, it is preferable that in the sequence encoding the recombinant mutein [C245S] human tissue factor precursor, all rare codons are replaced by synonymous codons often found in actively translated E. coli genes.

The OPC sequence of the gene encoding the mutein precursor [C245S] recombinant human tissue factor with the non-separable C-terminal tag is 10E-TF-CS6 according to the present invention, is presented in the Sequence Listing under the number SEQ ID NO: 1.

The amino acid sequence of the mutein precursor [C245S] recombinant human tissue factor with an inseparable C-terminal tag is 10E-TF-CS6 according to the present invention is presented in the Sequence Listing under the number SEQ ID NO: 2.

The amino acid sequence of the mature mutein [C245S] recombinant human tissue factor with an inseparable C-terminal tag - TF-CS6 is the sequence number SEQ ID NO: 2 without the first 23 amino acids.

DNA fragments that encode essentially the same protein can be obtained, for example, by modifying the nucleotide sequence of a DNA fragment (SEQ ID NO: 1) encoding the precursor of the recombinant mutein [C245S] human tissue factor, for example, using the site- directed mutagenesis, so that one or more amino acid residues at a particular site will be deleted, replaced, inserted or added. DNA fragments modified as described above can be obtained using traditional processing methods to obtain mutations. DNA fragments that encode essentially the same protein can be detected by expression of DNA fragments having the mutation described above in the corresponding cell and establishing the activity of the expressed product.

Human tissue factor (synonyms: blood coagulation factor III, thromboplastin, CD142, inactive tissue prothrombinase, apoprotein C-thermostable lipoprotein) is a transmembrane protein located mainly in subendothelial tissue cells, which initiates the coagulation cascade due to activation of factor VII. In terms of structure, TF is a 47 kDa glycoprotein consisting of 263 amino acids and containing 5 cysteine residues forming 2 intramolecular disulfide bonds. Only the extracellular domain (Ser-1-Glu-219) and the surface of the lipid membrane participate in the formation of the complex with fVII; The 23-membered transmembrane domain of TF provides the correct orientation of the extracellular domain relative to the membrane; the intracellular domain of TF provides anchoring of TF in the membrane. Tissue factor is the main component of the “thromboplastin reagent” used for laboratory diagnostics of the pathology of the blood coagulation system using the prothrombin test (PT). PT is one of the most common methods of laboratory diagnostics, which is performed both during screening examinations and, for example, for monitoring anticoagulant therapy with warfarin or heparin. During the test, a molar excess of calcium chloride and a “thromboplastin reagent”, which is liposomes containing TF, are added to the blood plasma sample containing sodium citrate. A change in plasma coagulation time relative to a standard sample indicates a pathology of the hemostatic system. The average clotting time of standard plasma samples (prothrombin time, PV) and the ratio of clotting time of the studied plasma and standard (prothrombin ratio, PO) varies significantly in different test systems and depends, first of all, on the properties of the thromboplastin reagent. To normalize the results, an indicator of the degree to which software is to be raised is used - the international sensitivity index (MIC or ISI). The value of the MIC in the kits used usually varies in the range from 1 to 2. When monitoring anticoagulant therapy, the MIC of the thromboplastin reagent used should be no higher than 1.4. The main indicator of the procoagulant activity of the TF variant used to obtain the reagent is the coagulation time of normal blood plasma, while the MIC of the reagent is more determined by the composition of lipid micelles. Thus, prothrombin time for normal plasma is the main indicator of the functional activity of TF. It is believed that the protein variant has the properties of a recombinant human tissue factor suitable for creating a thromboplastin reagent based on it, provided that the normal prothrombin time for the indicated TF variant in the composition of protein-lipid micelles is not more than 25 s, preferably not more than 18 s.

The expression plasmid according to the present invention contains a DNA fragment encoding a recombinant mutein precursor [C245S] of human tissue factor, comprising a sequence encoding a cleavable N-terminal 23 amino acid additional peptide containing a decagidine cluster and an enterokinase recognition sequence, and a sequence fused thereto, human tissue factor coding mutein [C245S] and 13 amino acid non-cleavable C-terminal peptide containing hexahistidine cl Sr., under the control of a promoter which functions in the bacterial cell.

As the recombinant plasmid of the present invention, various plasmids capable of expression in the recipient cell can be used, such as plasmids pBR322, pMW119, pUC19, pET22b, pET28b and the like, but the list of plasmids is not limited to them.

A specific implementation of the present invention are a plasmid, which consists of:

1) a 5093 bp NheI-HindIII fragment of the pHYP vector containing the region of the beginning of replication of plasmid pBR322, a sequence encoding aminoglycoside-3'-phosphotransferase, a sequence for segregation stabilization of the plasmid, a promoter of T7 bacteriophage RNA polymerase; transcription termination site; a sequence encoding a repressor of a lactose operon; sequences encoding an N-terminal decahistidine cluster and a C-terminal hexahistidine cluster;

2) an 819 bp NheI-HindIII fragment encoding the human tissue factor mutein [C245S] and the enterokinase recognition sequence fused in frame.

The indicated plasmid contains unique recognition sites for restriction endonucleases: PsiI (5855), PciI (3542), BglII (1509), NcoI (1404), NheI (1363), PstI (1075), HindIII (544). The structure of the plasmid pHYP-10ETFCS6 is shown in FIG. one.

Using the created plasmid, it is possible to transform a bacterial cell, preferably a bacterium belonging to the genus Escherichia, susceptible to such transformation by the indicated plasmid. The choice of a particular cell is not critical, since the methodology and methods of transformation are well known to those skilled in the art. Although the expression level of the human enterokinase light chain mutein precursor may vary depending on the type of cell and culturing conditions of the obtained transformant, the fact of expression of the target protein will take place subject to successful transformation of the recipient cell.

"Transformation of a cell with a plasmid" means the introduction of a plasmid into a cell using methods well known to those skilled in the art. Transformation with this plasmid leads to the expression of the gene encoding the protein of the present invention and to the synthesis of the protein in the bacterial cell. Transformation methods include any standard methods known to one skilled in the art, for example, the method described in Jac A. Nickoloff, Electroporation Protocols for Microorganisms (Methods in Molecular Biology) // Humana Press; 1st edition (August 15, 1995).

According to the present invention, “bacterial cell producing a human tissue factor mutein precursor” means a bacterial cell having the ability to produce and accumulate a human tissue factor mutein precursor according to the present invention when the bacterial cell according to the present invention is grown in said culture medium. As used herein, the term “bacterial cell producing the human tissue factor mutein precursor” also means a cell that is capable of accumulating a human tissue factor mutein precursor product in an amount of not less than 10 mg / L, more preferably not less than 100 mg / L. The specified precursor mutein of human tissue factor accumulates in the specified cell, preferably in the form of inclusion bodies.

It is preferable to use a bacterium belonging to the genus Escherichia for transformation with a recombinant plasmid containing a DNA fragment encoding a human tissue factor mutein precursor.

The term "bacterium belonging to the genus Escherichia" may mean that the bacterium belongs to the genus Escherichia in accordance with the classification known to the person skilled in the field of microbiology. As an example of a microorganism belonging to the genus Escherichia, the bacterium Escherichia coli (E. coli) may be mentioned.

The range of bacteria belonging to the genus Escherichia is not limited in any way, however, for example, the bacteria described in Neidhardt, F.C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, Table 1), can be given as examples.

A specific example of a recipient strain for producing a producer of a human tissue factor mutein precursor according to the present invention is, but is not limited to, Escherichia coli BL21 strain [DE3].

The strain Escherichia coli BL21 [DE3] is characterized by the following cultural, morphological, physiological and biochemical characters and genetic characters.

Cultural and morphological features of the strain: gram-negative rods, form threads; on an agar medium — whitish large colonies with an uneven edge. The activity of the strain is determined by the method of densitometry electrophoregram. The strain is stored under the following conditions: Lurie-Bertrand medium, 1% glucose, 10% glycerol. The strain propagates under the following conditions - Lurie-Bertrand medium, 1% glucose, kanamycin sulfate 30 μg / ml.

Genetic features of the strain. The genotype of the strain is F ^- ompT gal dcm lon hsdS _B (r _B ^- m _B ^- ) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

Transformation of the Escherichia coli strain BL21 [DE3] with the plasmid pHYP-10ETFCS6 yields the producer strain BL21 [DE3] / pHYP-10ETFCS6, which provides the synthesis of recombinant protein precursor mutein of human tissue factor in the amount of 30-70% of the total protein content of cells.

The strain Escherichia coli BL21 [DE3] / pHYP-10ETFCS6 encodes a 10ETFCS6 precursor protein consisting of the amino acid sequence of the mutein [C245S] recombinant human tissue factor fused in the frame of the N-terminal peptide of 23 amino acids containing the decahididine cluster, the enterocin cleavage site, directly found before the first amino acid of the mutein of human tissue factor and the non-cleavable C-terminal peptide of 13 amino acids in length containing a hexahistidine cluster.

The method for producing mutein [C245S] of human tissue factor according to the present invention includes culturing the above bacteria in a culture medium suitable for growing said prokaryotic cells, inducing a promoter of the human tissue factor mutein [C245S] precursor gene, isolating inclusion bodies, solubilizing the precursor protein, metal chelating denaturing chromatography and refolding of the target protein.

A method for producing a thromboplastin reagent consists in mixing the renatured protein with lipids in the presence of a detergent and subsequent removal of the detergent with dialysis.

Features of the plasmid and the results of its practical application are shown in the following Figures.

Brief Description of Shapes :

The Figure 1 shows a diagram of the assembly of the synthetic mutein gene [C245S] of human tissue factor from oligonucleotide primers and a scheme for producing expression plasmids pHYP-10ETFCS6 and pHYP-MTFCS6. The following notation is used :; TF [C245S] is a polymerase chain reaction product encoding a mutein [[C245S] human tissue factor; FLAG-TF [C245S] is a polymerase chain reaction product encoding a human tissue factor mutein with an N-terminal leader peptide. The dashed line indicates the polymerase chain reaction, the solid line indicates the restriction and ligation of DNA fragments. The names of the restriction endonucleases used are shown in italics.

Figure 2 shows a map of the expression plasmid pHYP-10ETFCS6. The following notation is used: "pBR322ori" region of the beginning of replication of plasmid pBR322; "KanR2" is a sequence encoding aminoglycoside-3'-phosphotransferase, which provides bacterial resistance to kanamycin; "T7 prom" is the promoter of the T7 bacteriophage RNA polymerase; "T7term" - transcription termination site; "LacI" is the sequence encoding the repressor of the lactose operon; HS is an element for ensuring the segregation stability of the plasmid, "p10E-TFCS6 ORF" is an open reading frame (OPC) of the polypeptide of the mutein precursor protein [C245S] of human tissue factor with an inseparable C-terminal peptide containing 6 his hexahistidine cluster, and a detachable N- terminal additional peptide "10E" containing a decagystidine cluster. The arrows indicate the directions of gene transcription, the numbers of the first and last nucleotides of the fragments are indicated in parentheses. The recognition sites of restriction endonucleases are in italics, and the numbers of nucleotides at the cutting points are indicated in parentheses.

Figure 3 shows a map of the expression plasmid pHYP-MTFCS6. Designations are used similarly to Figure 2, as well as: "MTF-CS6" is an open reading frame (ORF) of methionyl mutein [C245S] human tissue factor with an inseparable C-terminal peptide.

Figure 4 shows the electrophoregram of the total protein for two randomly selected colonies of the producer strain BL21 [DE3] / pHYP-10ETFCS6 before and after induction. Shake flask cultivation, 2xYT medium, induction of 1 mM IPTG, 37 ^° C., 14 hours. Lane 1 - total protein of colony 1 before induction, lane 2 - after induction, lane 3 - total protein of colony 2 before induction, lane 4 - after induction. Lane 5 is a molecular weight marker. The position of the target protein is indicated by the arrow.

The Figure 5 shows the electrophoregram fractions of the protein precursor 10ETFCS6 during purification by metal chelate chromatography under denaturing conditions and subsequent refolding. Restorative conditions for all tracks except “REF”. Designations: “IB” - solubilized inclusion bodies; “FF” is the slip fraction, “50-500” is the elution fraction with the corresponding imidazole concentrations, in mM; “REF” - 10ETFCS6 protein after refolding; “M” is a molecular weight marker. The molecular weights of the marker bands are indicated in kDa. The position of the target protein is indicated by the arrow.

The present invention will be described in more detail below with reference to the following non-limiting Examples.

Example 1. Obtaining plasmid DNA pAL-TF [C245S] and pAL-FLAG-TF [C245S]

For the amino acid sequence of the mutein [C245S] recombinant human tissue factor (SEQ ID NO: 3), reverse translation was performed into the DNA nucleotide sequence. In this case, codons optimal for the expression of this gene in E. coli class B were used, and the structure of the gene was optimized for the secondary structure of mRNA, GC composition, and the absence of undesirable regulatory elements (for example, the absence of internal ribosome binding sites) was ensured, as well as lack of extended repetitions, palindromes. The CAI (Codon Adaptation Index) index, which reflects the efficiency of gene expression in this organism, for the obtained sequence was 0.68, which is a good prognostic indicator for the industrial suitability of the producer strain obtained on its basis. The obtained nucleotide sequence with added restriction sites for subsequent subcloning is shown in the List of sequences under the number SEQ ID NO: 4.

The synthetic recombinant human tissue factor mutein [C245S] gene was collected by polymerase chain reaction (PCR) with primers AS-TF-F1 - AS-TF-F7 and AS-TF-R1 - AS-TF-R7 (SEQ ID NO: 5- 16) and AS-TF-F6short (SEQ ID NO: 17), the sequences of which are shown in Table 1.

Table number 1. Primer Sequences

SEQ ID NO The name of the oligonucleotide Sequence (5'-3 ') 5 AS-TF-F6 TTACATGTCTGGCACCACTAACACTGTTGCAGCGTACAACCTGACCTGGAAATCCACCAACTTCAAAACGATCCTGGAGTGGG 6 AS-TF-F5 ACGATCCTGGAGTGGGAACCGAAACCGGTTAACCAGGTTTACACTGTCCAGATCAGCACCAAATCCGGCGATTGGAAATCCAAATGCTTC 7 AS-TF-F4 GATTGGAAATCCAAATGCTTCTACACGACTGATACTGAGTGCGACCTGACTGACGAAATCGTGAAAGACGTGAAACAGACCTACCTGGCT 8 AS-TF-F3 AACAGACCTACCTGGCTCGCGTCTTCTCTTATCCGGCAGGTAACGTGGAAAGCACTGGCTCTGCAGGTGAACCGCTGTATGAAAACTCTC 9 AS-TF-F2 CCGCTGTATGAAAACTCTCCGGAATTCACCCCATACCTGGAAACTAACCTGGGTCAGCCAACTATCCAGTCTTTCGAACAGGTAGGCACC 10 AS-TF-F1 TCGAACAGGTAGGCACCAAAGTGAACGTTACTGTAGAAGACGAACGTACCCTGGTTCGTCGCAACAACACTTTTCTGTCTCTCCGTGACG eleven AS-TF-R1 GTTTTGGCGGTTTTTTTGCCAGAAGAGCTGGATTTCCAGTAATACAGCGTATAGATCAGGTCTTTGCCAAAGACGTCACGGAGAGACAGA 12 AS-TF-R2 GAATCACAGCCTGAACGCTGAAACAGTAGTTCTCACCTTTTTGTCCACGTCGATCAGGAATTCGTTGGTGTTGGTTTTGGCGGTTTTTTTGC 13 AS-TF-R3 GGAACTCACCTTTCTCCTGACCCATACACTCTACCGGAGAATCAGTGCTTTTGCGGTTTACCGTGCGAGATGGAATCACAGCCTGAACGC fourteen AS-TF-R4 GCTAATCGCCAGAATGATCACCAGAATGATAACTACGAACACGACAGCGCCGATAATGTAAAAGATTTCACGGAACTCACCTTTCTCCTG fifteen AS-TF-R5 AGCTTGGAAACGTTCAGTGGGGAGTTCTCTTTCCAAGACTGACCAACACCCGGTTTACGAGATTTATGCAGGCTAATCGCCAGAATGATC 16 AS-TF-R6 TTAAGCTTGGAAACGTTCAGT 17 AS-TF-F6short TTACATGTCTGGCACCACTAACA

PCR was performed on a Tertsik MC2 instrument (DNA Technology, Russia). Preparative reactions were carried out in a volume of 50 μl. An incubation mixture of the following composition was prepared: 1x buffer for thermostable DNA polymerase; 10 pM of each primer oligonucleotide; 2 mM each deoxyribonucleotide triphosphate; 2 units thermostable DNA polymerase. 50 μl of mineral oil was layered on top of this mixture and amplified according to the scheme: 1 cycle - denaturation - 94 ° C, 3 min; 25 cycles - denaturation 94 ° C, 30 s, annealing 62 ° C, 30 s, chain extension 72 ° C, 120 s; 1 cycle - chain extension 72 ° С, 10 min. PCR products were isolated from 1% agarose gel using the Wizard SV Gel and PCR Clean-Up System reagent kit (Promega, USA) according to the manufacturer's protocol, after which they were ligated into the PAL-TA T-vector (Eurogen, Russia ) using T4 phage DNA ligase and standard buffer solution (Fermentas, Lithuania). Ligation was carried out in a volume of 10 μl with a molar ratio of vector and insert 1:10, for 2-20 hours at room temperature. The obtained ligase mixtures transformed E. coli cells of strain DH5α, with the genotype F-φ80lacZΔM15 Δ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r _k -, m _k +) phoA supE44 λ-thi-1 gyrA96 relA1. For this, 5 μl of the ligase mixture was added to 200 μl of a frozen suspension of E. coli cells, incubated on ice for 20 minutes to adsorb plasmid DNA, heated to 42 ° C for 45 seconds, and incubated on ice for 5 minutes. Then 800 μl of SOB nutrient broth was added and incubated at 37 ° C for 60 minutes. Then, the suspension was transferred to a Petri dish with solid agar medium containing ampicillin at a concentration of 100 μg / 1 ml of agar, and placed in a thermostat for 18 hours at 37 ° C. E. coli colonies selected as a result of blue-white screening were analyzed by PCR with clones from primers T7prom (SEQ ID NO: 18) and SP6 (SEQ ID NO: 19). Selected clones were grown in 5 ml of 2xYT-Amp nutrient broth and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to the manufacturer's protocol, the primary nucleotide sequence was confirmed by PCR sequencing using T7prom primers (SEQ ID NO: 18) and SP6 (SEQ ID NO: 19).

To obtain the plasmid pAL-FLAG-TF [C245S], PCR was performed with primers AS-TF-R6 (SEQ ID NO: 16) and AS-TF-F6NheTag (SEQ ID NO: 20) using the plasmid pAL-TF as a template [C245S], with the formation of a PCR product containing the region encoding the N-terminal tag and restriction sites for subsequent subcloning. The sequence of the obtained PCR product corresponds to SEQ ID NO: 4, where the first 7 nucleotides are replaced by the sequence of SEQ ID NO: 21.

PCR, cloning into the PAL-TA vector, and clone analysis were performed as described above.

Example 2. Obtaining expression plasmids pHYP-MTFCS6 and pHYP-10ETFCS6

To obtain pHYP-MTFCS6, the pAL-TF [C245S] donor plasmid was restricted with endonuclease PciI and HindIII. To obtain pHYP-10ETFCS6, the donor plasmid pAL-FLAG-TF [C245S] was restricted with NheI and HindIII endonucleases. The reaction products were separated on a 1% agarose gel and isolated using the Wizard SV Gel & PCR Clean-Up System reagent kit according to the method of the manufacturer of the donor fragment to obtain an expression plasmid.

The recipient plasmid pHYP (application p0, Fig. 2) was sequentially digested with each of the NcoI and HindIII endonucleases to obtain pHYP-MTFCS6, or NheI and HindIII to obtain pHYP-10ETFCS6. First aliquots of the plasmid were incubated for 2 hours at 37 ° C with each of the restriction enzymes, the linearization of the plasmids was monitored by agarose gel electrophoresis, then a second restriction enzyme was added and incubated for another 2 hours. Then the samples were combined, the enzymes were inactivated by heating at 65 ° C for 20 minutes, and alkaline phosphatase dephosphorylation (Fermentas, Lithuania) was performed according to the manufacturer's protocol. Alkaline phosphatase was inactivated by heating to 85 ° C for 20 minutes. Restricted and dephosphorylated plasmid was reprecipitated with 3 volumes of ethanol, centrifuged for 10 minutes at a speed of 13200 rpm at room temperature, the precipitate was washed with 70% alcohol, dissolved in water and used to set up a ligation reaction at a working concentration of 10 ^-2 μg / μl. The ligation reaction of the purified donor fragments and the recipient plasmid and the transformation of E. coli strain DH5α by ligates were performed as described in Example 1. E. coli colonies were analyzed by PCR from clones from primers T7prom (SEQ ID NO: 18) and T7t (SEQ ID NO: 22). Selected clones were grown in 5 ml of 2xYT-Kan nutrient broth, plasmid DNA was isolated with the Wizard Plus SV Minipreps kit. The nucleotide sequence was verified by PCR sequencing with primers T7prom (SEQ ID NO: 18) and T7t (SEQ ID NO: 22).

As a result of sequencing, it was found that the obtained plasmid preparations pHYP-MTFCS6 and pHYP-10ETFCS6 do not contain mutations in the insertion region, i.e., the correct gene sequence is encoded. Design maps are shown in figure 2 and figure 3, respectively.

Example 3. Obtaining a producer strain of E. coli BL21 [DE3] / pHYP-10ETFCS6, evaluating the productivity of the producer strain and localization of the target protein.

To obtain the producer strain of the mutein [C245S] of human tissue factor, the construct obtained in Example 2 was used to transform competent Escherichia coli cells BL21 (DE3) (with the genotype F-ompT hsdS _B (rm-) gal dcm (DE3)) and clones were selected that retained the level of biosynthesis of the recombinant polypeptide after induction of at least 30% of the total cellular protein for at least four consecutive passages. To obtain E. coli strain BL21 [DE3] / pHYP-10ETFCS6, a producer of the mutein [C245S] precursor protein of human tissue factor, cells of E. coli strain BL21 [DE3] were transformed with the expression plasmid pHYP-10ETFCS6. Transformants of E. coli BL21 [DE3] were plated on 2xYT agar medium supplemented with kanamycin up to 30 μg / ml and glucose up to 2%, and target gene expression was induced for five randomly selected transformant colonies with a typical colony phenotype. Clones were grown in nutrient broth with the addition of kanamycin up to 30 μg / ml and glucose solution up to 2% for 6-7 hours, a new portion of the medium was inoculated with a ratio of 1: 100, the culture was grown until the optical density of 2 OE was reached, isopropylthio-β was induced -D-galactoside (IPTG) and cultured for another 16 hours. After cultivation, the cell pellet was separated by centrifugation, the cells were resuspended in a solution of 10 mM Tris-HCl, 2 mM EDTA-Na, 0.1% Triton-X100, 10 μg / ml lysozyme in the ratio of 10 ml of solution per 1 g of cell paste, wiped ivali suspension for 30 min on ice and was performed by ultrasonic destruction of cells dispersant until the disappearance of apparent viscosity of the slurry. Samples were taken for electrophoretic analysis, the soluble and insoluble fraction of proteins was separated by centrifugation in a microcentrifuge, the precipitate was additionally resuspended in the same solution, and precipitated by centrifugation. The results of electrophoretic analysis of total protein for two colonies of strain BL21 [DE3] / pHYP-10ETFCS6 are shown in Fig.4.

Electrophoretic mobility of the target protein corresponds to the calculated value. According to gel electrophoresis of protein fractions (data not shown), the target protein is almost completely localized in the insoluble fraction of proteins, i.e. is in the form of a “inclusion body”.

Example 4. Isolation and purification of denatured recombinant mutein [C245S] human tissue factor.

The producer strain BL21 [DE3] / pHYP-10ETFCS6 was seeded from the museum with a loop by a draining stroke on a Petri dish with agarized LB medium containing 30 μg / ml kanamycin and 1% glucose, grown for 14 hours at 37 ° C. One single colony of the strain was transferred to 5 ml of LB liquid medium containing 30 μg / ml kanamycin and 1% glucose and grown on a shaker for 14 hours at 37 ° C. The contents were inoculated with 250 ml of 2xYT medium containing 30 μg / ml kanamycin and 0.1% glucose, grown on a shaker for 3.5 hours at 37 ° C, bacterial suspension samples were taken for analysis, IPTG was added to a final concentration of 1 mM and grown for another 3-15 hours

The cell pellet was separated by centrifugation, resuspended in 20 ml of solution A (50 mm Tris-HCl pH = 7.4, 2 mm EDTA), lysozyme was added to 0.1 mg / ml and Triton X100 to 0.1%, incubated for 30 mines on ice. Cells and genomic DNA were destroyed using an ultrasonic disperser in 10 s pulses until the increased viscosity of the suspension disappeared. The precipitate was separated by centrifugation for 10 minutes at 20,000 rpm. The precipitate was resuspended in solution A, NP-40 detergent was added to 1%, and the precipitate was separated by centrifugation, as described above. The precipitate was resuspended in solution A, NaCl was added to 500 mM, and the precipitate was separated. The precipitate of purified inclusion bodies was resuspended in a solution of 50 mM Tris-HCl pH = 7.4 and the precipitate was separated by centrifugation for 10 min at 20,000 rpm. The resulting preparation of enriched inclusion bodies was stored at -70 ° C.

To solubilize the target protein, solution B was added to the inclusion body precipitate (8 M urea, 50 mM Tris-HCl, 50 mM beta-mercaptoethanol, pH = 9.5) in a ratio of 10 ml of solution per 1 g of precipitate. The suspension was incubated with stirring for 2 hours at + 37 ° C, insoluble cell debris was separated by centrifugation for 10 min at 20,000 rpm. The supernatant was diluted 5 times with solution B (8 M urea, 50 mm sodium phosphate, 500 mm sodium chloride, pH = 8.0) to reduce the final concentration of beta-mercaptoethanol, the precipitate was separated by centrifugation for 10 min at 20,000 rpm and the supernatant was applied to a column with a Chelating Sepharose Fast Flow sorbent (GE Healthcare, USA) containing chelated nickel ions and balanced solution B. The column was sequentially washed with solution G (8 M urea, 50 mM sodium phosphate, 500 mM sodium chloride, pH 7.0 ) and a solution of D (8 M urea, 50 mm sodium phosphate, 500 mm chlorine and sodium, 50 mM imidazole, pH = 7,0) to stabilize the baseline. The purified protein was eluted with solutions with an imidazole concentration of 100, 200 and 500 mM. The eluate containing the purified 10ETFCS6 precursor protein was concentrated by ultrafiltration to a final total protein concentration of 20 mg / ml and desalted; the resulting solution was stored frozen. The polypeptide was purified under denaturing conditions to a fraction of visible impurities of less than 5% by densitometry electrophoregram (figure 5).

Example 5. Renaturation of the recombinant mutein [C245S] human tissue factor.

For refolding, DTT was added to a thawed solution of denatured 10ETFCS6 to a concentration of 10 mM and incubated at 37 ° C for 2 hours. The protein was then diluted with refolding buffer solution (50 mM TRIS, pH = 8.8, 2 mM EDTA, 2 mM reduced glutathione, 0.2 mM oxidized glutathione; 2 M urea, 10 mM octyl glucoside) in a ratio of 1:40 and incubated at room temperature for 12-16 hours. The precipitate was separated by centrifugation and the resulting solution was used to lipidize tissue factor.

Example 6. Obtaining a thromboplastin reagent based on recombinant mutein [C245S] human tissue factor.

The solution of the renatured 10ETF6 protein with lipids was mixed in a HBS solution containing 10 mM HEPES pH = 7.0, 140 mM NaCl, 0.1% NaN ₃ . A portion of a solid mixture of phosphatidylserine and phosphatidylcholine 70:30 M: M (Avanti Polar Lipids, USA) was dissolved in HBS, additionally containing 20 mM octylglucoside, the final total lipid concentration of 80 g / L. The 10ETFCS6 protein solution, the lipid solution and the HBS solution were mixed with the addition of octyl glucoside up to 10 mM to a final concentration of 10ETFCS6 monomer of 20 μg / ml, lipids 0.8 g / L. The resulting mixture was incubated for 2 hours at a temperature of 37 ° C with stirring, after which the detergent was removed by dialysis against HBS solution for 48 hours with a change of the dialysis solution every 12 hours.

The resulting emulsion of liposomes containing recombinant tissue factor was used as a thromboplastin reagent to determine “prothrombin time” (PV). The main indicator of the functional activity of tissue factor is the coagulation time of normalized citrate blood plasma when thromboplastin reagent and calcium ions are added to it. For the obtained preparation of lipidized protein 10ETFCS6, the clotting time was 13.4 s, the clotting time of a plasma with a control thromboplastin reagent based on natural tissue factor was 16.9 s, and the clotting time of a plasma with a control reagent containing only liposomes was more than 200 ° s. Measurements were carried out using a ThromboScreen 400c semi-automatic coagulometer (Pacific Hemostasis, USA) and reagents manufactured by Renam NPO (Russia). The resulting renatured protein 10ETFCS6 is suitable for the manufacture of a thromboplastin reagent.

Example 7. Comparison of the procoagulant activity of a thromboplastin reagent obtained on the basis of the recombinant mutein [C245S] of human tissue factor with a processed and unprocessed N-terminal leader peptide and N-terminal methionine residue.

The purified and renatured mutein precursor protein [C245S] of human tissue factor 10ETFCS6 obtained in Examples 4-5 was concentrated to 2 mg / ml by ultrafiltration, CaCl _{2 was} added to 5 mM, enterokinase (Sigma, USA) was added in a 1: 1000 molar ratio and cleaved the N-terminal peptide for 16 hours at room temperature. The progress of the reaction was monitored using SDS-PAGE; the degree of cleavage was more than 90%. Enterokinase activity was blocked by the addition of EDTA-Na to 10 mM, the free 10E peptide was separated by ultrafiltration on a 10 kDa membrane. Thus obtained preparation of a mature TFCS6 protein containing an extracellular domain of tissue factor without additional amino acids was used to obtain a thromboplastin reagent, as described in Example 6.

To obtain the E. coli strain BL21 [DE3] / pHYP-MTFCS6, a producer of the mutein precursor protein [C245S] of human tissue factor with the N-terminal methionine residue, cells of the E. coli strain BL21 [DE3] were transformed with the expression plasmid pHYP-MTFCS6 as in Example 3 The OPC sequence of the methionyl mutein [C245S] coding recombinant human tissue factor with the non-separable C-terminal peptide, MTFCS6, is a sequence under the number SEQ ID NO: 1 in which nucleotides 4-69 are missing. The amino acid sequence of methionyl mutein [C245S] recombinant human tissue factor with the inseparable C-terminal tag MTFCS6 is a sequence under the number SEQ ID NO: 2, in which amino acids 2-23 are absent. Isolation and renaturation of MTFCS6 protein was performed as described in examples 4 and 5.

The resulting protein preparations TFCS6 and MTFCS6 were lipidized as indicated in Example 6, and prothrombin time was measured for the obtained thromboplastin reagent variants. It was found that the prothrombin time for normalized plasma does not have significant differences for all three variants of the thromboplastin reagent and is 13-14 s.

The results showed that the use of codons that are optimal for E. coli for coding for OPC allows increasing the expression level of a heterologous protein due to the efficient translation of all amino acids of the polypeptide. The presence of a cleavable N-terminal and non-cleavable C-terminal peptides with polyhistidine clusters allows efficient chromatographic purification of the expressed protein under denaturing conditions using metal chelate chromatography. The presence of the [C245S] mutation allows the refolding procedure to be carried out for purified high-yield precursor protein. This order of stages allows to obtain a completely purified and renatured product using a single chromatographic purification step. The presence of an intracellular domain elongated due to the non-cleavable C-terminal peptide, in addition to metal chelate purification, allows refolding of the target protein in high yield. The N-terminal peptide can be separated by treatment with enterokinase (Sigma, USA), while the specific procoagulant activity of the lipidized protein does not change. The combination of these advantages makes it possible to reduce the cost of a thromboplastin reagent based on 10ETFCS6 protein by reducing the cost of obtaining a solution of a renatured recombinant tissue factor.

The advantages of the proposed E. coli BL21 [DE3] strain are the use of bacteria with the Lon OmpT phenotype, which excludes the possibility of proteolytic cleavage of the human tissue factor mutein synthesized de novo and contamination of the secreted protein with the most active E. coli proteases. The T7 bacteriophage R7 polymerase RNA polymerase gene integrated into the genome of the recipient strain under the control of the lacUV5 promoter using the T7-lac promoter and T7 terminator in plasmids leads to fast and efficient protein production. Another common advantage of the used strain, expression vector and biosynthesis strategy is the ability to carry out induction without changing the temperature of cultivation. Another advantage is the possibility of obtaining a mutein of human tissue factor that does not contain contamination with partner proteins, without additional chromatographic purification.

Although the invention has been described in detail with reference to Examples, it will be apparent to those skilled in the art that various changes can be made and equivalent replacements made, and such changes and replacements are not outside the scope of the present invention.

Claims (9)

1. Plasmid pHYP-10ETFCS6 with a length of 5912 bp with the physical map shown in FIG. 2, for expression in a bacterium belonging to the genus Escherichia, a precursor of the mutein [C245S] human tissue factor containing a cleavable N-terminal leader peptide containing a decagidine cluster and an enterokinase recognition sequence fused in frame with a sequence encoding the specified mutein fused in frame with a sequence encoding an additional non-cleavable C-terminal peptide containing a hexahistidine cluster, essentially in the following sequence consisting of:
- site of replication initiation pBR322 ori;
- lactose operon repressor gene;
- promoter of RNA polymerase of the bacteriophage T7;
- the region represented in the Sequence Listing under the number SEQ ID NO: 1 encoding an N-terminal leader peptide characterized by a decagystidine cluster and an enterokinase recognition sequence fused in frame with a sequence optimized for expression in the indicated bacterium by codons encoding mutein [C245S] tissue human factor fused in frame with a sequence encoding an additional non-cleavable C-terminal peptide characterized by a hexahistidine cluster;
- plot termination of transcription of the bacteriophage T7;
- a fragment providing segregation stability of the plasmid; and
- kanamycin resistance gene. 2. The plasmid according to claim 1, characterized in that the precursor of the mutein [C245S] of human tissue factor is a protein, the sequence of which is shown in the List of sequences under the number SEQ ID NO: 2. 3. The bacterium belonging to the genus Escherichia, transformed with the plasmid according to claim 1, is a producer of the human tissue factor mutein [C245S] precursor, the sequence of which is shown in the Sequence Listing under SEQ ID NO: 2 containing a cleavable N-terminal leader peptide containing a decagystidine cluster and enterokinase recognition sequence fused in frame with a sequence encoding said mutein fused in frame with a sequence encoding an additional non-cleavable C-terminal peptide containing general hexahistidine cluster. 4. The bacterium according to claim 3, characterized in that said bacterium is E. coli BL21 [DE3] / pHYP-10ETFCS6 bacterium. 5. A method of obtaining a recombinant precursor of mutein [C245S] human tissue factor, the sequence of which is shown in the sequence Listing under the number SEQ ID NO: 2, containing a cleavable N-terminal leader peptide containing a decagidine cluster and an enterokinase recognition sequence fused in frame with the sequence, encoding the specified mutein, fused in a frame with a sequence encoding an additional non-cleavable C-terminal peptide containing a hexahistidine cluster, including culture tion bacterium according to claim. 3 in a culture medium, isolation of inclusion bodies, solubilization of the precursor protein, metal chelate chromatography under denaturing conditions, and diafiltering the protein refolding solution. 6. The method according to p. 5, characterized in that the bacterium E. coli BL21 [DE3] / pHYP-10ETFCS6 is cultured. 7. The precursor mutein [C245S] of human tissue factor, the sequence of which is shown in the List of sequences under the number SEQ ID NO: 2, containing a cleavable N-terminal leader peptide containing a decagidine cluster and an enterokinase recognition sequence fused in frame with the sequence encoding the specified mutein fused in frame with a sequence encoding an additional non-cleavable C-terminal peptide containing a hexahistidine cluster obtained by the method of claim 5. 8. A method of producing a mature mutein [C245S] human tissue factor, the sequence of which is shown in the List of sequences under the number SEQ ID NO: 2 without the first 23 amino acids containing non-cleavable C-terminal peptide containing hexahistidine cluster, including the separation of the N-terminal leader peptide from a predecessor of said mutein according to claim 7 using enterokinase and isolating the target mature mutein [C245S] human tissue factor. 9. Mature mutein [C245S] of human tissue factor, the sequence of which is shown in the List of sequences under the number SEQ ID NO: 2 without the first 23 amino acids, containing non-cleavable C-terminal peptide containing hexahistidine cluster obtained by the method according to p. 8.

Images