KR20220094724A - Glechoma hederacea var extract with skin barrier protection function and its manufacturing method - Google Patents

Abstract

The present invention relates to a Glechoma longituba extract having a skin barrier protection function and a manufacturing method thereof and, more specifically, to a Glechoma longituba extract having a skin barrier protection function and a manufacturing method thereof, in which the skin barrier protection function of Glechoma longituba is confirmed, and the extraction efficiency is improved while minimizing the damage of the skin barrier protection function. According to the present invention, the manufacturing method of the Glechoma longituba extract having a skin barrier protection function comprises: an extraction step of extracting a Glechoma longituba sample in a powder form at room temperature using alcohol; a filtration step of filtering the extracted extract; a concentration step of concentrating the filtered extract under reduced pressure; and a freeze-drying step of drying the concentrated extract.

Description

Glechoma hederacea var extract with skin barrier protection function and its manufacturing method

The present invention relates to an extract of ginseng extract having a skin barrier protection function and a method for preparing the same, and more particularly, a skin barrier protection function that confirms the skin barrier protection function of geum jeonseok, minimizes damage to the skin barrier protection function, and increases extraction efficiency It relates to an extract of geumgeoncho, and a method for preparing the same.

The skin is largely divided into the outer epidermis, inner dermis and subcutaneous tissue, and has a function to protect internal organs from temperature and humidity changes, ultraviolet rays, and other physical and chemical external stimuli. It is divided into the stratum corneum and the basal layer, and the skin barrier function is created and maintained in the epidermis, the outer layer of the skin.

The outer layer of the epidermis, the stratum corneum, is composed of keratino-cyte, and after division, these keratinocytes move upward to differentiate and initiate keratinization of the epidermis. As a result, it plays a role in creating a skin barrier through division and differentiation.

The most important role of the skin barrier is to safely protect the body composed of about 80% water from the dry external environment. In addition, the skin barrier is the most important first line of defense against toxic substances, microorganisms, mechanical stimuli, and ultraviolet rays. However, it provides an environment in which the skin can perform its normal functions by suppressing water loss.

In addition, according to recent research results, it has been reported that the stratum corneum affects not only the skin barrier function but also the function, role, and structure of the inner living cell layer, that is, the epidermis or dermis, and its importance is continuously increasing.

When the skin barrier function is damaged, the moisture in the stratum corneum decreases and the flexibility of keratinocytes decreases, and the keratinocyte degrading enzymes that mediate the exfoliation of keratin cannot function normally. There is a problem in that the skin is rough and dry skin that loses its transparency appears due to the phenomenon of falling off as a lump.

In order to solve this problem, Korean Patent No. 10-2157970 discloses a technology related to a cosmetic composition for strengthening the skin barrier containing lactic acid bacteria fermented product of sprouted sprout extract, and also, Korean Patent No. 10-1780111 A technique related to a composition for enhancing skin barrier function comprising fennel fruit extract as an active ingredient has been known.

On the other hand, Geumjeoncho (Lysimachia christinae Hance) has two species, Glechoma longituba Kupr of the Lamiaceae family, called Lamiaceae, and L. christinae Hance of the Primrose family, called hyacinth. It is a herbal material used for oriental and folk treatment of diseases such as , jaundice, and is still used as a material for beverages, teas, and herbal medicine compositions. In addition, according to the study of Gao et al. (2013), geumjeon extract contains flavone, amino acid, tannin, choline, etc., myricetin, kaempferol It is rich in glycosides of (kaempferol) and quercetin, and it is known that this herb is effective in anti-inflammatory, antibacterial and reducing cholelithiasis.

Accordingly, the present applicant studied natural materials with a skin barrier protection function from external stimuli. As a result, the extract of Geumgeoncho increases the expression of filaggrin, a skin barrier relaxation gene, and helps to generate HAS, a skin moisturizing factor. By confirming that, the present invention was completed.

Republic of Korea Patent Publication No. 10-2157970 (2020.09.14.) Republic of Korea Patent Publication No. 10-1780111 (2017.09.13.)

The present invention has been devised to solve the above problems, and an object of the present invention is to confirm the skin barrier protection function of the ginseng plant, minimize damage to the skin barrier protection function, and to provide a method for producing a ginseng extract to increase the extraction efficiency will be.

In addition, another object of the present invention is to confirm the safety and anti-inflammatory activity of the extract of ginseng extract having a skin barrier protection function, confirm the moisturizing and skin barrier relief effects, and apply it to a cosmetic composition.

The present invention, in order to achieve the above object, an extraction step of extracting a powder form of gold leaf (Lysimachia christinae Hance) sample at room temperature using alcohol; A filtration step of filtering the extracted extract; a reduced pressure concentration step of concentrating the filtered extract; and a freeze-drying step of drying the concentrated extract.

Here, the gold leaf sample is dried and then ground to a grinding step of making a powder form; characterized in that it further comprises.

The extraction step is extracted 2 to 3 times every 24 hours using ethanol in an amount 10 to 12 times the amount of the gold leaf sample, and the filtration step is filtered using a filter paper having a pore size of 5 to 8 μm, and the reduced pressure The concentration step is characterized in that it is concentrated under reduced pressure using a rotary vacuum evaporator at a water temperature of 35 to 45 °C.

On the other hand, the freeze-dried extract is characterized in that it is stored and used at a temperature of 3 to 5 ℃ in powder form.

After the freeze-drying step, an efficacy verification step of verifying the stability, anti-inflammatory activity, moisturizing and skin barrier alleviation effect of the extract; characterized in that it further comprises.

In addition, the verification of the skin barrier alleviation effect of the efficacy verification step is characterized in that it is confirmed by determining whether the expression of filaggrin of the extract is concentration-dependent.

In addition, in order to achieve the above object, the present invention can provide an extract of Geumjosica oleracea having a skin barrier protection function prepared by the above-described manufacturing method.

The present invention has the advantage of being able to protect the skin barrier by using the ginseng plant in a skin barrier protective function cosmetic composition by confirming the skin barrier protective function of the ginseng plant, which is generally used to exhibit antioxidant and anti-inflammatory effects.

In addition, the present invention has the advantage of minimizing the damage to the skin barrier protection function of the extract of the ginseng extract having a skin barrier protection function and increasing the extraction efficiency.

1 is a flow chart showing a method for preparing an extract of Geumgeonchoy with a skin barrier protection function according to the present invention.
Figure 2 is a graph according to the verification evaluation of cell viability (safety) of the extract and Comparative Example according to the present invention.
Figure 3 is a graph according to the verification evaluation of anti-inflammatory activity of the extract and Comparative Example according to the present invention.
Figure 4 is a graph according to the verification evaluation of moisturizing and skin barrier relaxation of the Geumjeoncho extract according to the present invention and Comparative Example.
5 is a graph according to the cytotoxicity verification evaluation of the extract according to the present invention.

Advantages and features of the present invention, and a method of achieving them, will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in a variety of different forms, and only these embodiments allow the disclosure of the present invention to be complete, and common knowledge in the technical field to which the present invention belongs It is provided to fully inform the possessor of the scope of the invention, and the present invention is only defined by the scope of the claims.

With reference to the accompanying drawings will be described in detail for the implementation of the present invention. Irrespective of the drawings, like reference numbers refer to like elements, and "and/or" includes each and every combination of one or more of the recited items.

The terminology used herein is for the purpose of describing the embodiments, and is not intended to limit the present invention. In this specification, the singular also includes the plural unless specifically stated otherwise in the phrase. As used herein, “comprises” and/or “comprising” does not exclude the presence or addition of one or more other components in addition to the stated components.

Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used with the meaning commonly understood by those of ordinary skill in the art to which the present invention belongs. In addition, terms defined in a commonly used dictionary are not to be interpreted ideally or excessively unless clearly defined in particular.

As used herein, the term “skin barrier” refers to the upper layer of the epidermis, which is the outermost layer of the skin, and refers to the stratum corneum composed of keratinocytes. In addition, the skin barrier is the most important first line of defense against toxic substances, microorganisms, mechanical stimuli, and ultraviolet rays, and functions to provide an environment in which the skin can perform normal functions by suppressing electrolyte or moisture loss through the skin.

As used herein, the term “skin barrier protection function” refers to strengthening the barrier function of the stratum corneum located at the outermost layer of the skin, and enhancing the skin barrier function by increasing the expression of filaggrin, a skin barrier peptide. means that

In addition, the term "extract" used in the present invention refers to a substance obtained by separating the components contained in the raw material from the natural product as an active ingredient contained in the extracting raw material by contacting the solvent and the extracting raw material under specific conditions.

Hereinafter, a manufacturing method according to an embodiment of the present invention will be described in detail with reference to the accompanying drawings.

1 is a flow chart showing a method for preparing an extract of geumgeonchoy with a skin barrier protection function according to the present invention.

Referring to FIG. 1, the method for producing an extract of ginseng extract having a skin barrier protection function according to the present invention includes an extraction step (S20), a filtration step (S30), a reduced pressure concentration step (S40), and a freeze-drying step (S50). , further comprising a grinding step (S10) and an efficacy verification step (S60).

First, in the grinding step (S10), a sample of Lysimachia christinae Hance is dried and then ground to a powder form.

The gold leaf sample can be used without limitation, such as cultivated or commercially available ones, but it is appropriate to use it after washing and drying it, and grinding it into a powder having a uniform particle size using a grinder.

According to a preferred embodiment, in the grinding step (S10), the gold leaf sample is washed, dried at room temperature for 24 hours, and then ground using a grinder to obtain a powder form.

Next, in the extraction step (S20), the gold leaf extract in powder form is extracted at room temperature using alcohol.

The extraction step (S20) is a step of preparing an extract of the ground gold leaf sample after the grinding step (S10). In order to minimize damage to the barrier protection function, in the extraction step (S20), it is appropriate to extract 2 to 3 times every 24 hours at room temperature using ethanol in an amount of 10 to 12 times the amount of the gold leaf sample.

The extraction solvent used in the extraction step (S20) is preferably ethanol, but may be selected from the group consisting of lower alcohol-based C1-C4 methanol, propanol, isopropanol, butanol and isobutanol.

In addition, it is preferable to use an alcohol extraction method as the extraction method used in the extraction step (S20), and when the gold leaf sample is extracted with a solvent such as hot water, ethyl acetate, and diethyl ether, the extraction efficiency of the gold leaf sample is low. .

In addition, the hydrophilic component is mainly eluted when extracting the gold leaf sample using water, and when extracting using ethanol, the fat-soluble component is mainly eluted, so the extraction step (S20) is performed at room temperature using 70% ethanol. According to extraction, both water-soluble and fat-soluble components of the Geumgyeoncho sample can be eluted.

According to a preferred embodiment, in the extraction step (S20), it is appropriate to extract twice every 24 hours at room temperature using 70% ethanol in an amount 10 times the amount of the gold leaf sample.

In this case, in the extraction step (S20), a large amount of the active ingredient of the ginseng extract can be extracted by performing extraction twice every 24 hours.

Next, the extract from which the gold leaf sample is extracted is subjected to a filtering step (S30) of filtering.

The filtering step (S30) is a process of removing suspended solid particles from the extract after the extraction step (S20), and it is preferable to go through the filtering step (S30), and the filtering step (S30) is a pore size (pore size) It is preferable to filter using filter paper having a size) of 5 to 8 μm.

According to a preferred embodiment, in the filtering step (S30), the extract is filtered using a filter paper having a pore size of 8 μm (Whatman No. 2, GE healthcare, Arlington Heights, IL, USA).

Next, the filtered extract is concentrated under reduced pressure (S40) to remove the solvent.

In the vacuum concentration step (S40), after the filtration step (S30), the filtered extract is put into a container and concentrated under reduced pressure using a known rotary vacuum evaporator at a water temperature of 35 to 45° C. to remove the solvent.

At this time, in the reduced pressure concentration step (S40), all of the ethanol is concentrated under reduced pressure before proceeding with the freeze drying step (S50), and this is because, when ethanol is included in the extract, drying does not work well during freeze drying. It is possible to reduce the time required for the subsequent freeze-drying step (S50) by removing all of the

Specifically, in the vacuum concentration step (S40), it is preferable to use the rotary vacuum evaporator as the concentration proceeds rapidly as the vaporization occurs at a relatively low temperature in the vacuum state, and when the temperature is raised above room temperature, it is helpful for concentration , it is preferable to concentrate at a water temperature of 35 to 45 ℃ because the extract is damaged by boiling when the temperature is raised a lot.

According to a preferred embodiment, in the vacuum concentration step (S40), the filtered extract is put in a container and concentrated under reduced pressure using a rotary vacuum evaporator (HS-10SP; Hahnshin S&T, Korea) at a water temperature of 40°C. do.

Next, the extract concentrated in the reduced pressure concentration step (S40) proceeds to a freeze-drying step (S50) to dry.

Here, the extract may have differences in content, ingredients of raw materials such as vitamin C and essential oil components depending on the drying method, so a drying method must be applied differently according to the specific ingredients and effects to be obtained by extraction, and in the case of the extract, By freeze-drying, damage to the skin barrier protection function can be minimized and extraction efficiency can be increased.

The freeze-drying step (S50) is a process of drying the extract concentrated in the reduced pressure concentration step (S40).

Here, the extract proceeds at a high temperature to dry quickly, but at a high temperature, damage to the active ingredient occurs, so it is preferable to use a freeze-drying method with less damage and chemical variation of the active ingredient than other drying methods.

In addition, the extract is rapidly frozen and subjected to the freeze-drying step (S50) of sublimating the ice crystals in the raw material in a low pressure state, so that the extract can be stored for a long time, and the volume and weight are reduced, which makes storage and distribution convenient. .

According to a preferred embodiment, said In the freeze-drying step (S50), the extract is dried using a freezer (FD5525; Ilshin BioBase, Korea).

In addition, the freeze-dried extract is preferably stored and used at a temperature of 3 to 5 ° C in powder form, and when the extract is stored at a temperature outside the temperature range of 3 to 5 ° C, the extract may be discolored or safe and damage such as decreased functionality.

According to a preferred embodiment, the freeze-dried extract is stored and used at a temperature of 4° C. in powder form, and as it is stored at a low temperature, it is possible to reduce the possibility of physical deformation of the dried powder, damage to the active ingredient, and chemical change.

Next, the extract stored in powder form after being freeze-dried is extracted with 70% ethanol and the efficacy verification step (S60) is performed to verify the efficacy of the extract.

The efficacy verification step (S60) verifies the efficacy of the extract by verifying the stability, anti-inflammatory activity, moisturizing and skin barrier relief effects of the extract after the freeze-drying step (S50).

According to a preferred embodiment, in the efficacy verification step (S60), the stability of the extract is verified by evaluation of cell viability and cytotoxicity, and the anti-inflammatory activity is verified by evaluation of nitric oxide (NO) inhibition.

In addition. In the verification of the skin barrier alleviation effect of the efficacy verification step, it is preferable to confirm that the expression of filaggrin of the extract increases in a concentration-dependent manner.

By including the efficacy verification step (S60), the extract of the ginseng extract minimizes damage to the skin barrier protection function of the extract and increases the efficiency of the extract. have.

In addition, it is preferable that the extract according to the present invention is prepared as a cosmetic, and the cosmetic may include not only the extract according to the present invention, but also ingredients commonly used in cosmetics, for example, an antioxidant, a stabilizer, and a dissolving agent. conventional adjuvants such as agents, vitamins, pigments, and fragrances, and carriers.

In addition, as a product to which the cosmetic material can be added according to the present invention, cosmetics for moisturizing the human body are preferable. , cleansing cream, body cleanser, face wash, and cosmetics such as soap.

Specific formulations of the cosmetic of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, essence, nutrition, which are cosmetics for moisturizing the human body. Formulations such as essence and pack are preferable, and formulations such as shampoo, body lotion, lipstick, makeup base, foundation, press powder, loose powder, eye shadow, cleansing foam, cleansing lotion, cleansing cream, body cleanser, face wash, soap, etc. include

In addition, the cosmetic is a fatty substance, organic solvent, solubilizer, thickener, gelling agent, softening agent, antioxidant, suspending agent, stabilizer, foaming agent, Perfume, surfactant, water, ionic or nonionic emulsifier, filler, sequestering agent, chelating agent, preservative, blocking agent, wetting agent, essential oil, dye, pigment, hydrophilic or lipophilic active agent, commonly used in cosmetics It may additionally contain adjuvants commonly used in the field of cosmetology or dermatology, such as any other ingredients used.

However, the adjuvant and its mixing ratio may be appropriately selected so as not to affect the desirable properties of the cosmetic according to the present invention.

Hereinafter, the present invention will be described with reference to the following examples, which are not intended to limit the scope of the present invention.

Example 1

After washing 5 g of Glechoma hederacea var sample and drying it for 24 hours, it is ground into powder form using a grinder, extracted twice every 24 hours at room temperature using 50 L of 70% ethanol, and manure with a pore size of 8 μm After filtration using paper, the filtered extract was concentrated under reduced pressure using a rotary vacuum evaporator at a water temperature of 40° C., and then freeze-dried using a freezer, and the extract was stored in powder form at a temperature of 4° C. . In addition, 50L of 70% ethanol was added to the stored extract to prepare an extract of Geumjeoncho.

Comparative Example 1

The same procedure as in Example 1 was performed, except that 50 L of methanol was used to extract a gold leaf extract to prepare a gold leaf extract.

Comparative Example 2

The same procedure as in Example 1 was performed, except that 50L of ethyl acetate was used to extract the Geumjeoncho extract to prepare a Geumjeoncho extract.

Comparative Example 3

It proceeded in the same manner as in Example 1, but was concentrated under reduced pressure using a rotary vacuum evaporator at a water temperature of 50° C. to prepare an extract of Geumjeoncho.

Comparative Example 4

It proceeded in the same manner as in Example 1, but was concentrated under reduced pressure using a rotary vacuum evaporator at a water temperature of 30° C. to prepare an extract of Geumjeoncho.

Experimental Example 1

In Experimental Example 1, the extraction yield of the extracts prepared in Example 1 and Comparative Examples 1 to 4 was evaluated, and the extraction yield was measured as the content of solids.

In Experimental Example 1, in order to investigate the extraction yield of the extract according to the extraction solvent and water temperature during filtration, Examples 1 and Comparative Examples 1 to 4 were stored at a temperature of 4° C. in powder form after freeze-drying using a freezer. The extraction yield of the state was measured by the solid content, and the results are shown in Table 1.

division extraction solvent Water temperature (℃) Solid content (%) Example 1 ethanol 40 1.88 Comparative Example 1 methanol 40 1.79 Comparative Example 2 ethyl acetate 40 1.58 Comparative Example 3 ethanol 50 1.65 Comparative Example 4 ethanol 30 1.71

As shown in Table 1, the solid content of Example 1 was the highest, and when methanol, which is a lower alcohol, was used as the extraction solvent, the solid content was somewhat reduced, and when ethyl acetate was used as the extraction solvent, the solid content was confirmed to be low, and when the extract was concentrated under reduced pressure at 50 °C and 30 °C, it was confirmed that the extraction yield was somewhat low due to the low solid content.

Comparative Example 5

In the same manner as in Example 1, a ginseng fruit extract was prepared using ginseng fruit ( Panax ginseng CA Meyer ).

Comparative Example 6

The same procedure as in Example 1 was performed, except that an extract of oxalis follicles was prepared using Nelμmbo nucifera Gaertner .

Comparative Example 7

Except in the same manner as in Example 1, clove extract was prepared using clove ( Syzygiμm aromaticμm ).

In order to confirm the skin barrier protection function of the ginseng extract prepared according to the present invention, the extracts of Comparative Examples 5, 6 and 7 using ginseng berries, bell peppers and cloves, which are natural materials with anti-inflammatory and antioxidant effects, as well-known was prepared, and the safety, anti-inflammatory activity, and moisturizing and skin barrier relief effects were compared with the extract prepared according to the present invention.

Experimental Example 2 - Safety Evaluation

This Experimental Example 2 was used to evaluate the material stability of Example 1 and Comparative Examples 5 to 7, and cell viability was measured using an MTT assay kit.

In Experimental Example 2, 180 μl of RAW 264.7 cells (mouse macrophages) were dispensed in a 96-well plate at a concentration of 4ㅧ10⁴cells/mL, and cultured at 37°C, 5% CO ₂ in an incubator for 24 hours. After culturing, the low concentration After adding 20 μl each at a high concentration, the culture was further incubated for 24 hours.

For the control group, Dulbecco's modified Eagle mediμm (DMEM; Hyclone ^TM , GE Healthcare Life Sciences, UK) medium containing the same amount of 1% penicillin/streptomycin (Hyclone ^TM , GE Healthcare Life Sciences, UK) as the sample was added and cultured under the same conditions. After incubation, MTT (Sigma-Aldrich) solution prepared at a concentration of 5 mg/mL in each well was diluted in distilled water, dispensed in 20 μl each, and incubated for 4 hours, the culture medium was removed and dimethyl sulfoxide (DMSO; Sigma). - Aldrich) and ethanol in a 1:1 ratio, 200 μl was added to each well, reacted for 30 minutes at room temperature, and absorbance was measured at 540 nm with an ELISA reader. It was expressed as the absorbance decrease rate.

The measured value was compared with the absorbance value of the control group to calculate the relative cell viability, and for the accuracy of the experiment, the same experiment was repeated 3 times in principle with 3 repetitions, and the results are shown in FIG. 2 .

As shown in FIG. 2 , the cell viability of Example 1 and Comparative Example 5 showed significant toxicity compared to the normal cell group (con) at a concentration of 75 to 100 μg/mL, and additional experiments were conducted at a concentration of 50 μg/mL or less. , Comparative Examples 6 and 7 showed significant toxicity compared to the normal cell group (con) at a concentration of 50 to 100 μg/mL, and an additional anti-inflammatory experiment was performed at a concentration of 25 μg/mL or less.

As a result of measuring the cytotoxicity, the cytotoxicity was somewhat confirmed in Comparative Example 7, the significance of the cytotoxicity was confirmed in the case of Comparative Example 6, and the cell viability was confirmed to be relatively excellent in Examples 1 and 5.

Experimental Example 3 - Anti-inflammatory activity evaluation

Experimental Example 3 is to evaluate the anti-inflammatory activity of Examples 1 and 5 to 7, and Nitric Oxide (NO) inhibitory ability was measured using a Nitric Oxide assay kit.

In Experimental Example 3, 2700 μl of RAW 264.7 cells (mouse macrophages) were dispensed into a 6 well plate at a concentration of 4×10 ⁵ cells/mL, and cultured at 37° C., 5% CO ₂ in an incubator for 24 hours, and the next day after culturing. , After culturing for 18 hours using a serum-free medium, samples were treated by concentration, and after 2 hours, 1 μg/mL of LPS was put into all wells except for the normal (normal cell) group and stimulated, and the supernatant after 24 hours After reacting 100 μl and 100 μl of griess reagent for 15 minutes, absorbance was measured at 540 nm with an ELISA reader to determine the amount of nitric oxide (NO) produced, and the result is shown in FIG. 3 .

As shown in FIG. 3 , the anti-inflammatory activity showed that when each sample was treated after inducing LPS in a normal cell group, Example 1, Comparative Example 6 and Comparative Example 7 showed that Nitric Oxide (NO) was concentration-dependently It was confirmed that the decrease was confirmed, and when compared in the same 25 μg / mL concentration group, it was confirmed that the anti-inflammatory activity was high in the order of Comparative Example 7, Comparative Example 5, Comparative Example 6, and Example 1.

Experimental Example 4 - Evaluation of moisturizing and skin barrier relief effects

This Experimental Example 4 was used to evaluate the moisturizing and skin barrier alleviation effects of Examples 1 and 5 to 7, and the Filaggrin mRNA expression, a skin barrier alleviation gene, was measured using the Filaggrin production assay kit.

In Experimental Example 4, HaCaT Cells (keratinocytes) were dispensed in a 24 well plate at a rate of 4×10 ⁵ cells/well, and after 24 hours, each sample was added at each concentration and cultured for 4 hours. RNA was extracted using μl TRI-Solution (Bio science technology), and cDNA was synthesized by reverse transcription using PrimeScript™ RT Master Mix (Takara, RR036A). Filaggrin gene expression was amplified using TB Green Premix Ex Taq™II (Takara, RR280A) to compare Filaggrin gene expression, and real-time PCR (Takara, TP940) was performed at 94℃, 30 sec (denaturation), 55℃, 30 sec ( annealing), 72° C., and 30 seconds (extension) were repeated 40 times, and the primers used are shown in Table 2, and the results are shown in FIG.

Gene Primer Sequence (5’to 3’) Filaggrin Forward AAGCTTCATGGTGATGCGAC Reverse TCAAGCAGAAGAGGAAGGCA β-actin Forward AGAGCTACGAGCTGCCTGAC Reverse AGCACTGTGTTGGCGTACAG

As shown in FIG. 4 , the moisturizing and skin barrier alleviation effects confirmed that Example 1 and Comparative Example 6 increased the expression of Filaggrin mRNA expression at high concentrations, and as the skin barrier relaxation gene Filaggrin increased in a concentration-dependent manner, The moisturizing and skin barrier relief effects of Example 1 and Comparative Example 6 were confirmed.

Experimental Example 5 - Cytotoxicity evaluation

This Experimental Example 5 is to evaluate the cytotoxicity of Example 1, and the cytotoxicity was measured using the LDH assay kit.

In Experimental Example 5, HaCaT Cells (keratinocytes) were dispensed in a 24 well plate at 3 × 10 ⁵ cells/well, and cultured at 37° C., 5% CO ₂ in an incubator for 24 hours, and after culturing, each treatment was performed at a low concentration and a high concentration. After incubation for 4 hours, 50 μl of the supernatant was mixed with 50 μl of the reaction solution (LDH cytotoxicit assay kit, Cayman, USA), reacted at room temperature for 30 minutes, and absorbance was measured at 490 nm. 5 is shown.

As shown in FIG. 5 , the cytotoxicity measurement result of Example 1 confirmed that the Geumgeoncho extract of Example 1 had a cytoprotective effect as the release of LDH decreased as the concentration of the sample increased.

According to the above results, the extract of Geumjeoncho increases the production of Filaggrin, a skin barrier alleviation gene, and has an inhibitory effect on the destruction of the skin barrier due to inflammation, as well as helps the generation of HAS, a skin moisturizing factor, has a moisturizing effect, and is safe. And by confirming the anti-inflammatory activity, it can be confirmed that the skin barrier protective function of the extract prepared according to the present invention.

Although embodiments of the present invention have been described with reference to the above and the accompanying drawings, those of ordinary skill in the art to which the present invention pertains can practice the present invention in other specific forms without changing its technical spirit or essential features. You can understand that there is Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

S10: grinding step
S20: Extraction step
S30: Filtration step
S40: vacuum concentration step
S50: freeze-drying step
S60: Efficacy verification step

Claims (7)

An extraction step of extracting a sample of Lysimachia christinae Hance in powder form using alcohol at room temperature;
A filtration step of filtering the extracted extract;
a reduced pressure concentration step of concentrating the filtered extract; and
Freeze-drying step of drying the concentrated extract. According to claim 1,
The method for producing a gold leaf extract having a skin barrier protection function, characterized in that it further comprises a; grinding step of making a powder form by grinding the gold leaf sample after drying. According to claim 1,
The extraction step is extracted 2 to 3 times every 24 hours using ethanol in an amount of 10 to 12 times the amount of the gold leaf sample,
The filtering step is filtered using a filter paper having a pore size of 5 to 8 μm,
The reduced pressure concentration step is a method for producing an extract of geumjeoncho extract having a skin barrier protection function, characterized in that the concentration is under reduced pressure using a rotary vacuum evaporator at a water temperature of 35 to 45 °C. According to claim 1,
The freeze-dried extract is stored at a temperature of 3 to 5° C. in powder form and used. According to claim 1,
After the freeze-drying step, an efficacy verification step of verifying the stability, anti-inflammatory activity, moisturizing and skin barrier alleviation effect of the extract; 6. The method of claim 5,
The verification of the skin barrier alleviation effect of the efficacy verification step is a method for producing a ginseng extract having a skin barrier protection function, characterized in that it is confirmed by determining whether the expression of filaggrin of the extract is concentration-dependent. [Claim 7] A skin barrier protection function of the GEUM GEON CHO extract prepared by the method according to any one of claims 1 to 6.

Images