KR20220081564A - Development of genetic markers for early prediction of body length vs. height ratio in Jindo dogs - Google Patents

Abstract

The present invention is the ratio of length to height in Jindogae By selecting 10 SNPs that can discriminate individuals close to 110:100, As the length to height ratio was confirmed, the SNP composition for predicting the length to height ratio of Jindo dogs using this selected Jindo dogs with excellent body proportions and indiscriminate breeding to produce individuals with a length to height ratio of 110:100. It can be usefully used as a genetic marker to allow restriction.

Description

Development of genetic markers for early prediction of body length vs. height ratio in Jindo dogs}

The present invention relates to a SNP marker for early prediction of length-to-height ratio of Jindo dog and a prediction method using the same.

Dogs are bred for various practical purposes, such as disaster relief dogs, guard dogs, police dogs, and guide dogs for the blind, as well as pets familiar to people. In particular, the role of dogs as life companions is becoming more and more important as society becomes more urbanized, nuclear family, and aging. These dogs have been bred for various purposes according to human breeding intentions, and more than 400 breeds are currently being bred around the world. These breeds have their own form and characteristics, and these characteristics are relatively well maintained according to the thoroughbred dog pedigree.

One of the indigenous breeds in Korea is the Jindo dog, which originated from an island called Jindo located in the southwest of Korea. The Jindo dog was designated as Natural Monument No. 53 by the Cultural Heritage Administration of the Republic of Korea in 1962, and since then, the native breed of the Jindo dog has been preserved under the Cultural Heritage Management Act and the Korean Jindo Dog Protection and Raising Act (promulgated on January 16, 1967), and its breeding and distribution has been expanded. In order to enhance the excellence of Jindo dogs and increase their utilization, they are being protected and nurtured.

The dog's height means the length from the top of the shoulder blade to the point where the front paw touches the ground, and the length means the length from the tip of the sternum (anterior bone) of the forearm to the tip of the ischial bone. In the standard body type standard for Jindo dogs, the standard length to height ratio is defined as 110:100. If your body is about 10% longer, it can be said that you have a suitable body type. Height and length in dogs are one of the representative economic traits, and since dog lovers have different preferences for appearance, the need for early prediction through genetic testing is emerging. By using genetic markers related to the length-to-height ratio of Jindo dogs, it is possible to select Jindo dogs with excellent body proportions by predicting the length-to-height ratio early, and it is possible to increase the effect of improving the length-to-height ratio, and to increase the length to height ratio. By limiting indiscriminate breeding to produce individuals with a ratio close to 110:100, it contributes to protection and welfare policies for Jindo dogs. It is expected that information will be available.

SNP marker for predicting the height of a dog and a prediction method using the same in the Korean Patent Registration (No. 10-2017-0056720) Methods, literature disclosing SNPs related to the length and height of Sapsal dogs (Korea Sapsal Dog Foundation Project Report 2011.12.23) and literature on the genetic characteristics of morphology and personality using large-capacity SNPs in Sapsal dogs (Yeongnam University Graduate School (2011), Mahboob), but the SNP of the present invention for predicting the length-to-height ratio of a Jindo dog has not been disclosed so far.

Accordingly, the present inventors extracted DNA from the blood of 757 Jindo dogs, analyzed the SNP genotype using a 170K SNP chip for Jindo dogs, and analyzed the length of Jindo dogs through genome-wide association study (GWAS). The present invention was completed by selecting 10 SNPs capable of predicting the body height ratio early.

An object of the present invention is a composition comprising an agent capable of detecting or amplifying a SNP for predicting the length-to-body height ratio of a Jindo dog, a kit for predicting the length-to-body height ratio of a Jindo dog, and a method for predicting the length-to-body height ratio of a Jindo dog comprising the composition is to provide

In order to achieve the above object, the present invention provides a single nucleotide polymorphism (SNP) wherein the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, the 61st base is C or A SNP; It provides a composition for predicting the length-to-body-height ratio of Jindo dogs, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

In addition, the present invention provides a kit for predicting the length-to-height ratio of Jindo dog comprising the composition.

In addition, the present invention provides a microarray for predicting the length-to-height ratio of Jindo dogs comprising the composition.

In addition, the present invention provides 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from Jindo dog , polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 or its complementary As the step of amplifying the region containing the SNP of the polynucleotide,

The SNP is nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, sequence Base 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 which is base 61 of a polynucleotide consisting of the nucleotide sequence of; and

2) It provides a method for predicting the length-to-height ratio of Jindo dogs, including determining the type of the base of the SNP at the site including the amplified SNP.

The present invention is the ratio of length to height in Jindogae By selecting 10 SNPs that can discriminate individuals close to 110:100, As the length to height ratio was confirmed, the SNP composition for predicting the length to height ratio of Jindo dogs using this selected Jindo dogs with excellent body proportions and indiscriminate breeding to produce individuals with a length to height ratio of 110:100. It can be usefully used as a genetic marker to allow restriction.

1 is a diagram showing a method for measuring phenotypes for the body type of a Jindo dog.

Hereinafter, the present invention will be described in detail.

The present invention relates to a single nucleotide polymorphism (SNP) wherein the 61st base is G or A in a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st nucleotide is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, the 61st base is C or A SNP; It provides a composition for predicting the length-to-body-height ratio of Jindo dogs, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

The agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide containing the site containing the SNP, or a polynucleotide thereof It may be a primer capable of specifically amplifying a complementary polynucleotide.

The primer can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. These primers can be modified using many methods known in the art as long as they exhibit an effect capable of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may contain one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg, horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg, ³² P), fluorescent molecules and chemical groups (eg, biotin), and the like. There is this.

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , a double-stranded DNA probe or an RNA probe may be manufactured.

The probe may be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such a probe can be modified using many means known in the art as long as it exhibits an effect capable of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may contain one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further have a reporter conjugated to its 5' end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, Alexa alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( It may be any one or more selected from the group consisting of tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. However, any material known in the art that can be used as a reporter may be used.

The probe may be further conjugated with a quencher at its 3' end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher (Blackberry Quencher), Iowa black (Iowa black) ) may be any one or more selected from the group consisting of, but any known material that can be used as a quencher in the art may be used.

Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP, and dTTP. Various DNA polymerases can be used in the amplification step of the present invention to amplify the reverse transcribed cDNA, and examples of the DNA polymerase include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization. There are enzymes. Polymerases can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of cloned genes encoding polymerases.

In addition, the present invention provides a kit for predicting the length-to-height ratio of the Jindo dog, comprising the composition for predicting the length-to-height ratio of the Jindo dog.

The composition may have the characteristics as described above. As an example, the present invention provides (single nucleotide polymorphism, SNP) in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 SNP in which the 61st base is A or G; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 61st nucleotide is A or SNP in which G is; SNP in which the 61st nucleotide is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st nucleotide is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SEQ ID NO: SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of 7; SNP in which the 61st nucleotide is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; Consists of the nucleotide sequence of SEQ ID NO: 9 Any one or more SNPs selected from the group consisting of SNPs in which the 61st base is G or A in the polynucleotide being Or it may include an agent capable of amplifying.

In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to a site containing the SNP, and a polynucleotide comprising the site containing the SNP. Or it may be a primer capable of specifically amplifying its complementary polynucleotide.

The kit may be a PCR kit or a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can predict the length-to-height ratio of a Jindo dog by using the composition to confirm the genotype of the SNP marker provided in the present invention through amplification or by checking the mRNA expression level. The kit provided in the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, the RT-PCR kit includes a tube or other suitable container, a reaction buffer (pH and magnesium concentration vary), in addition to a primer pair specific for a polynucleotide containing the SNP-containing region or a polynucleotide complementary thereto. , deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. On the other hand, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve the stability of the product by lowering the degree of freedom of the included components. In order to produce such a dried form, it is necessary to apply a drying step, and in this case, heating drying, natural drying, reduced pressure drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention provides a microarray for predicting the length-to-height ratio of Jindo dogs comprising the composition for predicting the body-to-body-height ratio.

In the present invention, a microarray refers to a microarray in which a group of polynucleotides is immobilized on a substrate at a high density, and each group of polynucleotides is immobilized in a predetermined region. Such microarrays are well known in the art.

In addition, the present invention provides 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from Jindo dog , polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 or its complementary As the step of amplifying the region containing the SNP of the polynucleotide,

The SNP is nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, sequence Base 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 which is base 61 of a polynucleotide consisting of the nucleotide sequence of; and

2) It provides a method for predicting the length-to-height ratio of Jindo dogs, including determining the type of the base of the SNP at the site including the amplified SNP.

Any method known to those skilled in the art can be used for the step of amplifying the SNP-containing region of step 1). For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. In addition, ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173) (1989)), self-maintaining sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)), and nucleic acid-based sequence amplification (NASBA) can be used.

The step of determining the base type of the SNP in the region containing the amplified SNP of step 2) is sequencing, hybridization by microarray, allele specific PCR, dynamic allele hybridization technique (dynamic allelespecifichybridization, DASH), PCR extension assay, PCR-SSCP, PCR-RFLP assay or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex systems (BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technology (eg, Affymetrix GeneChip), and BeadArray Technologies (eg, Illumina GoldenGate and Infinium assays), etc. may be, but is not limited thereto.

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, is all A, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, is all G, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, is all C, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, is all A, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, is all G, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, nucleotide 61, is all G, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, is all A, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, is all G, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, is all A, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In the method for predicting or diagnosing the length-to-height ratio of the Jindo dog, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, is all A, or the genotype at the corresponding position of its complementary polynucleotide When a base complementary to

In a specific embodiment of the present invention, the present inventors extracted DNA from the blood of 757 Jindo dogs, analyzed the SNP genotype using a 170K SNP chip for Jindo dogs, and analyzed the genome-wide association study (GWAS) 10 SNPs capable of predicting the length-to-height ratio of Jindo dogs at an early stage were selected (see Tables 1 to 4).

Accordingly, according to the present invention, a SNP composition capable of discriminating a genotype close to an individual having a length-to-height ratio of 110:100 in a Jindo dog according to the present invention, a kit for predicting a length-to-height ratio of a Jindo dog comprising the same, or a length-to-height ratio of a Jindo dog using the same The ratio prediction method is useful as a genetic marker to predict the length-to-height ratio of Jindo dogs early, select Jindo dogs with excellent body proportions, and limit reckless breeding to produce individuals with a length-to-height ratio close to 110:100. can be used

Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples.

However, the following Examples and Experimental Examples only illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

<Example 1> SNP genotype analysis for Jindo dog

After each DNA was extracted from the blood of 757 Jindo dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), the SNP genotype was analyzed using a 170K SNP chip for Jindo dogs (CanineHD BeadChip, Illumina, USA). did

<1-1> Day 1: Amplification

20 μl of MA1 per well was put in a 96-well 0.8 ml MIDI plate with MSA3 barcode (hereinafter referred to as “MSA3 plate”), and 4 μl of each DNA extracted from the blood of 757 dogs was put into each well, and the DNA ID and The position of the transferred MSA3 plate was recorded. Then, 4 μl of 0.1 N NaOH was added to each well, the plate was covered with a 96-well cap mat, and then shaken at 1,600 rpm for 1 minute (vortexing), and centrifuged at 280 Х g for 1 minute. did Thereafter, after reacting at room temperature for 10 minutes, 34 μl of MA2 was added per well, 38 μl of MSM was added, a 96-well cover was covered, and centrifugation was performed at 280 Х g for 1 minute. The sample was amplified by reacting in an oven at 37° C. (Illumina Hybridization oven) for 20 to 24 hours.

<1-2> Day 2: Fragment

The MSA3 plate of Example 1-1 was taken out of the oven, centrifuged at 50 Х g for 1 minute, 25 μl of FMS was put into each well, the plate was covered with a cover, and the plate was shaken at 1,600 rpm for 1 minute (vortexing). . Thereafter, the plate was centrifuged at 50 Х g for 1 minute, and reacted for 1 hour in a 37° C. heat block.

<1-3> Day 2: Precipitation

After putting 25 μl of PM1 into each well of the plate of Example 1-2, covering the plate, centrifuging at 1,600 rpm for 1 minute, and then reacting in an oven at 37° C. for 5 minutes. The plate was centrifuged at 50 Х g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, mixed by inverting 10 times, and stored at 4°C for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and quickly inverted to discard the supernatant. The remaining supernatant was removed by tapping it lightly on a kitchen towel about 10 times, and the inverted plate was placed on a tube rack as it is and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> Day 2: Resuspend

23 μl of RA1 per well was put into the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for later staining (XStain HD Bead Chip). A foil seal was placed on the plate, and a heat-sealer block was pressed for 5 seconds to seal. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken and mixed at 1,800 rpm for 1 minute (vortexing), and centrifuged at 280 Х g for 1 minute.

<1-5> Day 2: Hybridization

The plate of Examples 1-4 was placed in a 95° C. heat block to denaturate the DNA sample for 20 minutes. After that, put the plate at room temperature for 30 minutes and put gaskets in the hybridization chamber (HybChamber) while cooling down, put 400 μl of PB2 in each of the 8 humidifying buffer reservoirs in the hybridization chamber, and close the lid. Closed and left at room temperature. MSA3 plates containing DNA cooled at room temperature were centrifuged at 280 Х g for 1 minute. Take out the SNP chips stored in the refrigerator one by one and prepare them, align the barcode shape of the insert in the hybridization chamber with the barcode part of the chip, and then load 15 μl of each DNA sample cooled with a multi-channel pipette into both parts of the chip. ) was done. As soon as the sample loading of each chip was finished, it was put into the hybridization chamber and the next chip was repeated in the same way. When the chamber is completely filled, the chamber lid is closed, put in an oven at 48° C., and the speed is set to 5 to react for 16 to 24 hours.

<1-6> Day 3: Washing bead chips

Remove the hybridization chamber of Example 1-5 from the oven, remove the inserts from the chamber one by one, pull the seal attached to the chip to remove it, and then insert the chip from which the seal has been removed into a wash rack to WB1 Soaked in a wash dish containing this. After all the chips were placed in WB1, the washing rack was removed from the dish for 1 minute and then washed, and the rack was moved to another washing dish containing PB1 and washed while being removed and put in and out for 1 minute. After cleaning, put the back frame on the bead chip alignment fixture (Multi-sample BeadChips Alignment fixture), put the chips one by one according to the barcode direction, and then place the white part and the transparent part separated by the alignment fixture It was fitted to the upper and lower parts of the After raising the space, an alignment bar was placed on the top of the chip without a barcode, the glass plate was covered so that the end of the glass plate touched the bar, and a clip was inserted to complete the chamber assembly (flow-through chamber assembly). The alignment bar was removed, and the space part at both ends of the chamber assembly was cut with scissors.

<1-7> Day 3: Staining (XStain Beadchips)

After adjusting the temperature of the chamber rack to 44 ℃, the chamber assembly of Examples 1-6 was fitted to the chamber rack. After adding 150 μl of RA1 to each chip and repeating the process for 30 seconds, the process was repeated 6 times, 450 μl of XC1, 450 μl of XC2, and 200 μl of TEM were sequentially placed into each chip and reacted for 10 minutes each. 450 μl of 95% formamide/1 mM EDTA (ethylenediaminetetraacetic acid) was added to each chip and reacted for 1 minute, then put in the same way again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, add 450 μl of XC3 to each chip and react for 1 minute, then put the same again and set the temperature of the chamber rack waited until it reached Thereafter, reagents were put into each chip in the order of A - B - A - B - A of Table 1 and reacted.

Immediately after completion of the reaction, the chamber rack was removed from the chamber assembly, and it was transferred to an experiment table at room temperature and taken out flat. 310 ml of PB1 was placed in a washing container and a staining rack was immersed in the container. After removing the clip of the chamber rack using an instrument and lifting the glass block, the space was removed while not touching the bead part of the chip. After removing all the attachments attached to the chip, it was placed in a staining rack contained in PB1 and immersed in PB1. All chips were sequentially treated as above. After quenching the chip by slowly moving the staining rack up and down about 10 times, soak it for 5 minutes, then fill another washing container with 310 ml of XC4, quench the chip in the same way as above, and then soak for 5 minutes. After that, the staining rack was removed and the chip was carefully removed using tongs and placed on the tube rack. The tube rack on which the chip was placed was placed in a vacuum dryer and dried for 55 minutes under a vacuum of 508 mmHg (0.68 bar). The edge of the dried chip was wiped using a tissue (KIMWIPES) soaked in ethanol, being careful not to touch the bead part. The bead chip after the experiment was completed was imaged using a scanner within 72 hours.

<Experimental Example 1> Selection of 10 SNPs that can predict the length-to-height ratio of Jindo dogs early

High-density SNP 170K chip analysis and genome-wide association study (GWAS) were performed on 757 dogs.

Specifically, all SNP data obtained after genotyping of the length-to-height ratio of Jindo dogs for the discovery of length-to-height non-associated loci using the Canine 170k (170,000) SNP chip were the Hardy-Weinberg equilibrium (HWE) and minor allele. The chi-square test of the R/SNPassoc package was performed on the frequency (MAF) of , and results that did not meet certain conditions were excluded (HWE; P<0.001, MAF; <1%). In order to detect the length-to-height non-associated loci in Jindo dogs, the correlation between the length-to-height ratio and the SNP marker was tested. Using the R-statistics package for single marker regression, the additive addition of each SNP marker to the average length-to-height ratio The genetic effect (additive effect) was analyzed as in the following general formula (1).

[General formula 1]

y = μ + Sex _i + SNP _j + e _ij

(In Formula 1, y is the height/length ratio (%), μ is the overall mean, Sex _i is the genotype effect (i=female, male, and neutralized male), SNP _j is the genotype effect (j=AA, AB) , BB), e _{ij is} random error, N~(0, σ ² _e ))

For false positives due to random errors, which is a problem in multiple testing such as genome wide association tests, 10,000 permutation tests were performed to reduce genome-wise P- to 0.1% level. The values were calculated.

As a result, 10 predictable SNPs for the length-to-height ratio of Jindo dogs were selected, the mean and standard deviation (SD) of each selected phenotype were calculated, and each standard deviation was calculated as the square of the number of each genotype. The standard error (SE) was calculated by dividing (Tables 2 to 4). For each phenotype, when the mean value is greater than 110%, the body length is longer than the standard ratio, and when the mean value is less than 110%, the body length is shorter than the standard ratio. The longer the body, the more rectangular the body shape.

<Statistical analysis of 10 single nucleotide variations (SNPs) that can predict the length-to-height ratio of Jindo dogs> number SNP
single nucleotide mutation name Chr
chromosome bp (position) A1 A2 gene
frequency beta
statistic standard error p (probability value) One TIGRP2P119932_rs8658799 8 68874072 G A 0.3610 -7.3241 1.4439 0.000000393 2 BICF2P491431 5 79708771 A G 0.1100 -10.4481 2.1983 0.000002007 3 BICF2G630507820 24 16702908 A C 0.0740 -11.2868 2.6174 0.000016156 4 BICF2P785888 30 15541731 A G 0.0996 -10.1786 2.3740 0.000018058 5 BICF2S22914567 14 48038654 G A 0.1846 -7.3036 1.7629 0.000034287 6 BICF2G630622300 29 14318438 G A 0.3264 -6.0558 1.4701 0.000037989 7 TIGRP2P9038_rs8982284 One 76458747 G A 0.1266 -8.4244 2.0651 0.000045162 8 BICF2G630454765 34 33664974 A G 0.3914 -6.0266 1.4929 0.000054199 9 BICF2G630617879 13 29992102 G A 0.1072 -9.5129 2.3873 0.000067517 10 BICF2S23029238 13 30004936 C A 0.1072 -9.5129 2.3873 0.000067517

<SNP sequence information that can predict the length-to-height ratio of Jindo dogs> number single nucleotide polymorphic name chromosome nucleotide sequence mutation region close to 110%
genotype One TIGRP2P119932_rs8658799 8 GCATTTGTCCAAGGTCCTGGAGCTTCAAACTCAGGCTGTCAAGAATAGAGAGAGTCAAGG[A/G]TAGAGAGAGAATGGCTACATGGAAGTAAGCACTGGCATTATTACCTAGAGCCCAATATCT A 2 BICF2P491431 5 CCCTTCCCCTCAGCACCTCACTGCAGTATGGGGCCCAGGAGGACACGGCCCGGTTCTGCC[A/G]GAGTTAGGGGTGACTCACTGCGTAGTCACAGCCCTCATTTCAGTACAGAAAGGAAAAGCA G 3 BICF2G630507820 24 TTCATGACAAATGTTCTGCAGTTCTGGAAAACCATTCATAAATTCAAAATAATGGGACTA[A/C]CCATGAAGCTACCTCTCTTTTTATTCATCCCTATGAAGAGGAGAGCTTTCACTTTTATTAT C 4 BICF2P785888 30 tttGTCTGAATTCCTTCTGGTTTGGAGATCATTGAATCAGGCACTTGTGACCCTGACTYT[A/G]TGTATGGTAGAGATCAGTGCCTGGGCTCCCTAGCTTAAGGAATGGACCTTGCCCCAACTG A 5 BICF2S22914567 14 TAATTTTTTTGTAAGAAAAATAAGGGTGGAACTTAATAGGCAGTTGTTAACTATACATGT[A/G]TGAGAAAGTAGAGACATTTTGATTGCTCTTTATCCCTTTGTTTTGGTGTAGTTAAGGGAG G 6 BICF2G630622300 29 TTAACCTTTAGTTTTTAAAAAAACTTCTTGTGGTCACCGCCTGGCCTTTCTCAGGCCCCC[A/G]TCACCTTTTCTTCTCAAACTCCTTTACCTTGAGTCATTGAGATTATAGGTTTCTAGACTT G 7 TIGRP2P9038_rs8982284 One GAATGAGAACCACAAAGATCAGAGTAAGAGATGGCTCTCTGATGAACTTGCTGGTAATTC[A/G]GACACTTGGAGGGAATTCAAACCTGGACCTAGAATTCCTGTTATAAACCGACCRAGAAAA A 8 BICF2G630454765 34 AAGTGGATTCAGTCAAAGGTGAAGAAAAGCAACTTCATTCTTTTGCTCTACTCTCCCTGA[A/G]TATTTATTTGTGGACTTTTGTTTCTGCTTCCTGAATGTGGATTTTTCCATAGGTTTTTCA G 9 BICF2G630617879 13 AATAGCCATTAGTTTGGTTGTTCATGTGCTCATCCATTCAGATACAGTCAGTAACCCACT[A/G]TGGGCTGTAGCTGTGAGGAGAAAGGGCAAGATATCATAGACCACACAAAGTGCTGGCCTG A 10 BICF2S23029238 13 CCCCAAGTATGTGGGGAGCCTGTTTTTGCTTTAGTATTTCAAAATTTCAGTGACAGTATT[A/C]TAGCTGAAAGTATCTGTTTTTCAGCAGCCTGCCTCACTGTTCTGAAGCAGTGTCATAATT A

<The average value and standard error value of each genotype related to the length-to-height ratio of Jindo dogs> number single nucleotide polymorphic name chromosome Item Genotype-1 Genotype-2 Genotype-3 One TIGRP2P119932_rs8658799 8 Variation (number of individuals) AA (306) AG(349) GG(99) Average 106.01 105.57 105.66 standard error 1.21 1.36 3.67 2 BICF2P491431 5 Variation (number of individuals) AA(13) AG(140) GG(600) Average 103.16 105.22 105.92 standard error 12.56 2.89 0.92 3 BICF2G630507820 24 Variation (number of individuals) AA(5) AC(102) CC(649) Average 104.05 105.59 105.79 standard error 25.49 3.15 0.95 4 BICF2P785888 30 Variation (number of individuals) AA(12) AG(126) GG(615) Average 107.06 105.85 105.73 standard error 15.25 3.00 0.91 5 BICF2S22914567 14 Variation (number of individuals) AA(496) AG(236) GG(22) Average 105.98 105.19 106.06 standard error 0.86 2.18 8.98 6 BICF2G630622300 29 Variation (number of individuals) AA(340) AG(323) GG(90) Average 105.43 106.00 106.20 standard error 0.94 1.61 3.85 7 TIGRP2P9038_rs8982284 One Variation (number of individuals) AA(579) AG(158) GG(15) Average 114.74 105.42 104.35 standard error 0.95 2.41 12.49 8 BICF2G630454765 34 Variation (number of individuals) AA(97) AG(399) GG(257) Average 104.12 105.92 106.09 standard error 3.10 1.38 1.27 9 BICF2G630617879 13 Variation (number of individuals) AA (602) AG(143) GG(9) Average 106.09 104.41 104.30 standard error 0.97 2.62 15.37 10 BICF2S23029238 13 Variation (number of individuals) AA (602) AC(143) CC(9) Average 106.09 104.41 104.30 standard error 0.97 2.62 15.37

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Development of genetic markers for early prediction of body length/height ratio in Jindo dogs <130> 2020P-11-048 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P119932_rs8658799 <220> <221> variation <222> (61) <223> n is A or G <400> 1 gcatttgtcc aaggtcctgg agcttcaaac tcaggctgtc aagaatagag agagtcaagg 60 ntagagagag aatggctaca tggaagtaag cactggcatt attacctaga gcccaatatc 120 t 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P491431 <220> <221> variation <222> (61) <223> n is A or G <400> 2 cccttcccct cagcacctca ctgcagtatg gggcccagga ggacacggcc cggttctgcc 60 ngagttaggg gtgactcact gcgtagtcac agccctcatt tcagtacaga aaggaaaagc 120 a 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630507820 <220> <221> variation <222> (61) <223> n is A or C <400> 3 ttcatgacaa atgttctgca gttctggaaa accattcata aattcaaaat aatgggacta 60 nccatgaagc tacctctctt ttattcatcc ctatgaagag gagagctttc acttttatta 120 t 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P785888 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tttgtctgaa ttccttctgg tttggagatc attgaatcag gcacttgtga ccctgactyt 60 ntgtatggta gagatcagtg cctgggctcc ctagcttaag gaatggacct tgccccaact 120 g 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S22914567 <220> <221> variation <222> (61) <223> n is A or G <400> 5 taattttttt gtaagaaaaa taagggtgga acttaatagg cagttgttaa ctatacatgt 60 ntgagaaagt agagacattt tgattgctct ttatcccttt gttttggtgt agttaaggga 120 g 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630622300 <220> <221> variation <222> (61) <223> n is A or G <400> 6 ttaaccttta gtttttaaaa aaacttcttg tggtcaccgc ctggcctttc tcaggccccc 60 ntcacctttt cttctcaaac tcctttacct tgagtcattg agattatagg tttctagact 120 t 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P9038_rs8982284 <220> <221> variation <222> (61) <223> n is A or G <400> 7 gaatgagaac cacaaagatc agagtaagag atggctctct gatgaacttg ctggtaattc 60 ngacacttgg agggaattca aacctggacc tagaattcct gttataaacc gaccragaaa 120 a 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630454765 <220> <221> variation <222> (61) <223> n is A or G <400> 8 aagtggattc agtcaaaggt gaagaaaagc aacttcattc ttttgctcta ctctccctga 60 ntatttattt gtggactttt gtttctgctt cctgaatgtg gatttttcca taggtttttc 120 a 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630617879 <220> <221> variation <222> (61) <223> n is A or G <400> 9 aatagccatt agtttggttg ttcatgtgct catccattca gatacagtca gtaacccact 60 ntgggctgta gctgtgagga gaaagggcaa gatatcatag accacacaaa gtgctggcct 120 g 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23029238 <220> <221> variation <222> (61) <223> n is A or C <400> 10 ccccaagtat gtggggagcc tgtttttgct ttagtatttc aaaatttcag tgacagtatt 60 ntagctgaaa gtatctgttt ttcagcagcc tgcctcactg ttctgaagca gtgtcataat 120 t 121

Claims (15)

single nucleotide polymorphism (SNP) in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;
SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;
SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;
SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8;
SNP in which the 61st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; and
SNP in which the 61st base is C or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10;
A composition for predicting the length/height ratio of a Jindo dog, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.
The composition of claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
A kit for predicting the length/height ratio of Jindo dog, comprising the composition of claim 1.
A microarray for predicting the length/height ratio of Jindo dogs, comprising the composition of claim 1 .
1) From DNA of a sample isolated from Jindo dog, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, of SEQ ID NO: 4 A polynucleotide consisting of a nucleotide sequence, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 7, a nucleotide sequence of SEQ ID NO: 8 SNP of any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 or its complementary polynucleotide As a step of amplifying the region comprising
The SNP is nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, sequence Base 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, nucleotide 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 which is base 61 of a polynucleotide consisting of the nucleotide sequence of; and
2) A method for predicting the length/height ratio of Jindo dogs, comprising determining the base type of the SNP at the site including the amplified SNP.
The method according to claim 5, wherein when base 61, which is a SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, is all A, or a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, are G, or a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when base 61, which is a SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, is all C, or when a base complementary to the genotype is identified at a corresponding position of its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when base 61, which is a SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, is all A, or a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, are G, or when a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, are G, or when a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, are A, or when a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, are G, or when a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, are A, or a base complementary to the genotype is identified at the corresponding position of its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.
The method according to claim 5, wherein when all of nucleotides 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, are A, or when a base complementary to the genotype is identified at a position corresponding to its complementary polynucleotide , it can be judged that the length-to-height ratio of the Jindo dog is close to 110:100.

Images