KR102470954B1 - Development of genetic markers for early prediction of body length of Jindo dogs - Google Patents

Abstract

The present invention screens 10 SNPs capable of discriminating long individuals in Jindo dogs and confirms the length of Jindo dogs according to the genotype. , it can be usefully used as a genetic marker to improve the improvement effect on body length and to limit indiscriminate breeding to produce long or short individuals.

Description

Development of genetic markers for early prediction of body length of Jindo dogs}

The present invention relates to a SNP marker for early prediction of length in Jindo dog and a prediction method using the same.

Dogs are bred not only as pets familiar to people, but also for various practical purposes such as disaster rescue dogs, guard dogs, police dogs, and guide dogs for the blind. In particular, as society becomes urbanized, nuclear families, and aging, the role of dogs as life companions is becoming more and more important. These dogs have been improved for various purposes according to human breeding will, and more than about 400 breeds are currently being bred around the world. These breeds have their own form and properties, and these characteristics are maintained relatively well according to the pedigree of purebred dogs.

A breed unique to Korea is the Jindo dog, which originated from the island of Jindo, located in the southwest of Korea. The Jindo dog was designated as Natural Monument No. 53 by the Cultural Heritage Administration of the Republic of Korea in 1962, and since then, in accordance with the Cultural Property Management Act and the Korea Jindo Dog Protection and Raising Act (proclaimed on January 16, 1967), the Jindo dog’s unique lineage has been preserved, and its proliferation and distribution have been expanded. Through this, Jindo dog is protected and fostered to enhance its excellence and increase its utilization.

Body length refers to the length from the end of the sternum (front bone) of the chest of the Jindo dog to the end of the seat bone. The body length of the Jindo dog is one of the representative economic traits along with the height, and the need for early prediction through genetic testing is emerging as dog owners have different preferences according to appearance or function. Using genetic markers related to the length of the Jindo dog, it is possible to select a Jindo dog with an excellent length, and by limiting indiscriminate breeding to produce long or short individuals, it contributes to the protection and welfare policy of the Jindo dog. By discovering genes related to body length, it is expected to secure academic value and basic medical information on animal growth.

As prior literature related to the present invention, a SNP (single nucleotide polymorphism) marker for predicting body length in dogs and a prediction method using the same (Korean Registered Patent No. 10-2017-0056720), a document disclosing SNPs associated with the body length of Sapsaree ( Korea Sapsaree Foundation, assignment report 2011.12.23), a study on the genetic characteristics of morphology and personality using large-capacity SNPs in Sapsarees (Yeungnam University graduate school (2011), Mahboob) and for early diagnosis of hip joint dislocation, hair quality, and tailbone degeneration in dogs Although there is a literature disclosing the SNP composition (Rural Development Administration task report 2014.02.28, Choi Bong-hwan et al.), the SNP of the present invention for predicting the body length of the Jindo dog has not been disclosed so far.

The Korean Registered Patent (No. 10-2017-0056720) describes in detail the SNP marker for predicting the dog's body length and the prediction method using it, and the document disclosing the SNP associated with the body length of the Sapsaree (Korea Sapsaree Foundation Project Report 2011.12. 23), but the SNP of the present invention for predicting the length of Jindo dog has not been disclosed so far.

Therefore, the present inventors extracted DNA from the blood of 757 Jindo dogs, analyzed SNP genotypes using a 170K SNP chip for Jindo dogs, and conducted genome-wide association study (GWAS) to analyze the size of Jindo dogs in early stages of body growth. The present invention was completed by selecting 10 predictable SNPs.

An object of the present invention is to provide a composition comprising an agent capable of detecting or amplifying SNPs for predicting body length in Jindo dogs, a kit for predicting environmental adaptability of dogs including the composition, and a method for predicting environmental adaptability of dogs.

In order to achieve the above object, the present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, the 61st base is A or G SNP; and a SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10; Provided is a composition for predicting the length of a Jindo dog, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

In addition, the present invention provides a kit for predicting the body length of Jindo dog comprising the above composition.

In addition, the present invention provides a microarray for predicting the length of a Jindo dog comprising the above composition.

In addition, the present invention is 1) a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from Jindo dog , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or its complementary A step of amplifying a site containing a SNP of a polynucleotide,

The SNP is base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 1, base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 2, base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 3 , Base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 4, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6, sequence Base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 8, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 Base 61 of the polynucleotide consisting of the nucleotide sequence of; and

2) A method for predicting the length of Jindo dog is provided, including determining the base type of the SNP at the site containing the amplified SNP.

The present invention screens 10 SNPs capable of discriminating long individuals in Jindo dogs and confirms the length of Jindo dogs according to the genotype. In addition, it can be usefully used as a genetic marker to improve the improvement effect on body length and to limit indiscriminate breeding to produce long or short individuals.

1 is a diagram showing a method for measuring phenotypes and numerical values (cm) for the body shape of Jindo dogs.

Hereinafter, the present invention will be described in detail.

The present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or G in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, the 61st base is A or G SNP; and a SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10; Provided is a composition for predicting the length of a Jindo dog, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

The agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide containing a site containing the SNP, or a polynucleotide thereof. It may be a primer capable of specifically amplifying a complementary polynucleotide.

The primers can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. These primers can be modified using a number of means known in the art, as long as they have an effect of detecting the site containing the SNP. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg ³² P), fluorescent molecules and chemical groups (eg biotin), etc. there is

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and includes oligonucleotide probes and single stranded DNA probes. , It can be produced in the form of a double stranded DNA probe or an RNA probe.

The probe can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such a probe can be modified using many means known in the art, as long as it has an effect of detecting the site containing the SNP. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further conjugate a reporter to its 5' end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2', 4', 5', 7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. However, other than those known in the art as materials that can be used as reporters, all may be used.

The probe may further conjugate a quencher to its 3' end. The photon is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ), but may be any one or more selected from the group consisting of, in addition, any material known in the art that can be used as a quencher may be used.

Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization there are enzymes The polymerase may be isolated from the bacteria itself, purchased commercially, or obtained from cells expressing high levels of a cloned gene encoding the polymerase.

In addition, the present invention provides a kit for predicting the length of a Jindo dog, including the composition for predicting the length of a Jindo dog.

The composition may have characteristics as described above. For example, the present invention relates to a single nucleotide polymorphism (SNP) in which the 61st base is A or G in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, the 61st base is G or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, the 61st base is C or A SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, the 61st base is A or G SNP; In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, the 61st base is A or G SNP; and a SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10; It may include an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide containing a site containing the SNP Alternatively, it may be a primer capable of specifically amplifying a polynucleotide complementary thereto.

The kit may be a PCR kit or a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can predict the body length of Jindo dog by confirming the genotype of the SNP marker provided in the present invention through amplification or by checking the mRNA expression level using the above composition. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, the RT-PCR kit includes, in addition to a pair of primers specific for a polynucleotide containing the site containing the SNP or a polynucleotide complementary thereto, a tube or other suitable container, a reaction buffer (with varying pH and magnesium concentration) , deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. On the other hand, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve the stability of the product by lowering the degree of freedom of the included components. For the production of such a dried form, the application of a drying step is required, and at this time, heating drying, natural drying, reduced pressure drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention provides a microarray for predicting the length of a Jindo dog comprising the composition for predicting the length of a dog.

In the present invention, a microarray means a microarray in which groups of polynucleotides are immobilized on a substrate at a high density, and each group of polynucleotides is immobilized in a certain area. Such microarrays are well known in the art.

In addition, the present invention is 1) a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from Jindo dog , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or its complementary A step of amplifying a site containing a SNP of a polynucleotide,

The SNP is base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 1, base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 2, base 61 of the polynucleotide composed of the base sequence of SEQ ID NO: 3 , Base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 4, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6, sequence Base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 8, base 61 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 Base 61 of the polynucleotide consisting of the nucleotide sequence of; and

2) A method for predicting the length of Jindo dog is provided, including determining the base type of the SNP at the site containing the amplified SNP.

Any method known to those skilled in the art may be used for amplifying the site including the SNP in step 1). For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), self-maintained sequence cloning (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)), and nucleic acid-based sequence amplification (NASBA) may be used.

The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) is sequencing, microarray-based hybridization, allele specific PCR, and dynamic allele hybridization techniques. (dynamic allelespecifichybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan techniques, SNPlex platform (Applied Biosystems), mass spectrometry (eg Sequenom's MassARRAY system), mini-sequencing methods , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (eg, Affymetrix GeneChip), and BeadArray Technologies (eg, Illumina GoldenGate and Infinium assays), etc. It may be, but is not limited thereto.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1, are A, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, are C, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, are G, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, are A, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of the Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, are C, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, are G, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7, are A, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, are G, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, are A, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In the method for predicting or diagnosing the length of Jindo dog, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, are A, or complementary to the genotype at the corresponding position of the polynucleotide complementary thereto If the enemy base is confirmed, it can be judged that the body length of the Jindo dog is long.

In a specific embodiment of the present invention, the present inventors extracted DNA from the blood of 757 Jindo dogs, analyzed SNP genotypes using a 170K SNP chip for Jindo dogs, and performed genome-wide association study (GWAS) Through this, we selected 10 SNPs that can predict the body length of Jindo dog early (see Tables 2 to 4).

Therefore, the SNP composition capable of discriminating a long-length individual in Jindo dogs according to the present invention, the kit for predicting the length of Jindo dogs including the same, or the method for predicting the length of Jindo dogs using the same, select Jindo dogs with excellent length and determine the length of Jindo dogs. It can improve the improvement effect and can be usefully used as a genetic marker to limit indiscriminate breeding to produce long or short individuals.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are only to illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

<Example 1> SNP genotyping analysis for Jindo dog

DNA was extracted from the blood of 757 Jindo dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then SNP genotype was analyzed using a 170K SNP chip (CanineHD BeadChip, Illumina, USA) for Jindo dogs. did

<1-1> Day 1: Amplification

20 μl of MA1 per well was added to a 96-well 0.8 ml MIDI plate (hereinafter ‘MSA3 plate’) with MSA3 barcode attached, 4 μl of each DNA extracted from the blood of 757 dogs was added per well, and DNA ID and The location of the displaced MSA3 plate was noted. Then, 4 μl of 0.1 N NaOH was added to each well, the plate was covered with a 96-well cap mat, and vortexing was performed at 1,600 rpm for 1 minute, followed by centrifugation at 280 Х g for 1 minute. did Then, after reacting at room temperature for 10 minutes, 34 μl of MA2 was added per well, 38 μl of MSM was added, and the 96-well was covered and centrifuged at 280 Х g for 1 minute. Samples were amplified by reacting in an oven (Illumina hybridization oven) at 37° C. for 20 to 24 hours.

<1-2> Day 2: Fragment

The MSA3 plate of Example 1-1 was taken out of the oven, centrifuged at 50 Х g for 1 minute, 25 μl of FMS was added to each well, and then the plate was covered with a cover and shaken at 1,600 rpm for 1 minute (vortexing) . Then, the plate was centrifuged at 50 Х g for 1 minute, and reacted for 1 hour on a 37°C heat block.

<1-3> Day 2: Precipitation

25 μl of PM1 per well was added to the plate of Example 1-2, covered, centrifuged at 1,600 rpm for 1 minute, and reacted in an oven at 37° C. for 5 minutes. After the plate was centrifuged at 50 Х g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, inverted 10 times to mix, and stored at 4°C for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and the supernatant was discarded by quickly inverting the plate. The remaining supernatant was removed by lightly tapping on a kitchen towel about 10 times, and the inverted plate was placed on the tube rack as it was and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> Day 2: Resuspend

23 μl of RA1 per well was added to the plate containing the DNA precipitation of Examples 1-3, and the remaining RA1 was frozen for later staining (XStain HD Bead Chip). A foil seal was placed on the plate and a heat-sealer block was pressed for 5 seconds to seal. After the sealed plate was reacted in an oven at 48 ° C. for 1 hour, it was shaken at 1,800 rpm for 1 minute (vortexing) and centrifuged at 280 Х g for 1 minute.

<1-5> Day 2: Hybridization

The plates of Examples 1-4 were placed in a 95°C heat block to denature the DNA samples for 20 minutes. Thereafter, while the plate was left at room temperature for 30 minutes to cool, gaskets were inserted into the hybridization chamber (HybChamber), 400 μl of PB2 was added to each of the 8 humidifying buffer reservoirs in the hybridization chamber, and the lids were closed. Closed and left at room temperature. MSA3 plates containing DNA cooled at room temperature were centrifuged at 280 Х g for 1 minute. Take out the SNP chips stored in the refrigerator one by one, prepare them, align the barcode shape of the hybridization chamber insert with the barcode part of the chip, and then load the cooled DNA samples into both parts of the chip by 15 μl each with a multichannel pipette. ) was done. As soon as the sample loading of each chip was finished, it was put into the hybridization chamber and the same method was repeated for the next chip. When the chamber is completely filled, the chamber lid is closed, and the mixture is placed in an oven at 48° C. and reacted for 16 to 24 hours by setting the speed to 5.

<1-6> Day 3: Washing bead chips

Take the hybridization chamber of Examples 1-5 out of the oven, take out the inserts in the chamber one by one, remove the seal attached to the chip by pulling it, and insert the chip from which the seal was removed into a wash rack to obtain WB1 was immersed in a wash dish containing After all the chips were placed in WB1, the washing rack was removed from the dish for 1 minute and then put in and out of the dish. After cleaning, place the back frame on the Multi-sample BeadChips Alignment fixture, place the chips one by one in the direction of the barcode, and place the space between the white part and the transparent part on the alignment fixture. fitted to the top and bottom of the After raising the space, an alignment bar was placed on the upper part of the chip without a barcode, the glass plate was covered so that the end of the glass plate touched the bar, and a clip was inserted to complete the flow-through chamber assembly. The alignment bar was removed, and the space portion at both ends of the chamber assembly was cut with scissors.

<1-7> Day 3: Staining (XStain Beadchips)

After adjusting the temperature of the chamber rack to 44° C., the chamber assembly of Examples 1-6 was inserted into the chamber rack. After adding 150 μl of RA1 to each chip and reacting for 30 seconds six times, 450 μl of XC1, 450 μl of XC2, and 200 μl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 μl of 95% formamide/1mM ethylenediaminetetraacetic acid (EDTA) was added to each chip and reacted for 1 minute, then added in the same manner and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, put 450 μl of XC3 into each chip and react for 1 minute, then put the same again and set the chamber rack temperature waited until it reached Thereafter, reagents were added to each chip in the order of A - B - A - B - A in Table 1 and reacted.

After the completion of the reaction, the chamber rack was immediately separated from the chamber assembly and moved to an experiment table at room temperature to be taken out flat. 310 ml of PB1 was put into a washing vessel and the rack for staining was immersed in the vessel. After removing the clip of the chamber rack using a tool and lifting and removing the glass block, the space was removed while not touching the bead portion of the chip. After removing all the attachments attached to the chip, it was inserted into a staining rack contained in PB1 and soaked in PB1. All chips were sequentially treated the same as above. After quenching the chip by slowly moving the dyeing rack up and down about 10 times, it was immersed for 5 minutes, and then filled with 310 ml of XC4 in another washing container, quenched in the same manner as above, and then soaked for 5 minutes. Thereafter, the rack for staining was taken out, and the chip was carefully taken out using tongs and placed on the rack of the tube. The tube rack on which the chips were placed was placed in a vacuum dryer and dried for 55 minutes under a vacuum of 508 mmHg (0.68 bar). Using a tissue (KIMWIPES) soaked in ethanol, the dried edge of the chip was wiped while being careful not to touch the bead portion. The bead chip on which the experiment was completed was imaged using a scanner within 72 hours.

<Experimental Example 1> Selection of 10 SNPs capable of early predicting the length of the Jindo dog

High-density SNP 170K chip analysis and genome-wide association study (GWAS) were performed on 757 dogs.

Specifically, all SNP data obtained after genotyping of Jindo dog length to discover length-related genetic loci using the Canine 170k (170,000) SNP chip were analyzed in terms of Hardy-Weinberg Equilibrium (HWE) and minor allele frequency (MAF). A chi-square test of the R/SNPassoc package was performed for each sample, and results that did not meet certain conditions were excluded (HWE; P<0.001, MAF; <1%). To test the association between length and SNP markers in order to detect the genetic loci associated with length in Jindo dogs, an R-statistics package for single marker regression was used to examine the additive effect of each SNP marker on average length. It was analyzed as in Formula 1.

[Formula 1]

y = μ + Sex _i + SNP _j + e _ij

(In Formula 1, y is the length of the body, μ is the overall average, Sex _i is the genotype effect (i = female, male and neutralized male), SNP _j is the genotype effect (j = AA, AB, BB), e _{ij is the} random error, N~(0, σ ² _e ))

For false positives due to random errors, which is a problem of multiple testing such as genome wide association test, 10,000 permutation tests were performed and genome-wise P- value was calculated.

As a result, 10 SNPs capable of early prediction of the body length of Jindo dogs were selected, the average and standard deviation (SD) of each selected phenotype value was calculated, and each standard deviation was divided by the square of the number of each genotype to obtain a standard error. (Standard error, SE) was calculated (Tables 2 to 4). For each phenotype, the lower the average value, the shorter the body length, and the higher the average value, the longer the body length.

<Statistical analysis of 10 single nucleotide mutations (SNPs) capable of early prediction of body length in Jindo dogs> number SNPs
Single nucleotide variant name Chr
chromosome bp (position) A1 A2 gene
frequency beta
statistic standard error p (probability value) One BICF2P454846 32 10830385 A G 0.1597 1.0054 0.2443 0.000038528 2 BICF2S23338638 12 28194934 C A 0.4717 0.7138 0.1746 0.000043525 3 BICF2P580549 23 49471629 A G 0.2695 -0.7617 0.1892 0.000056902 4 BICF2S23121945 26 7402315 G A 0.2276 -0.8080 0.2085 0.000106692 5 BICF2P1151337 19 13998398 G A 0.3345 0.6952 0.1795 0.000107321 6 BICF2S23519255 12 12725009 A G 0.4899 -0.6998 0.1811 0.000111131 7 BICF2S23419975 5 21241106 C A 0.3085 -0.7249 0.1902 0.000138669 8 BICF2S23419974 5 21241159 A G 0.3085 -0.7249 0.1902 0.000138669 9 BICF2S23758106 36 29530590 A G 0.0520 -1.4967 0.3932 0.000140787 10 BICF2S23718102 37 28688154 A C 0.0737 1.2369 0.3329 0.000202675

<Base sequence information of SNPs capable of early prediction of body length in Jindo dogs> number single nucleotide polymorphism name chromosome nucleotide sequence mutation region long length (width)
genotype One BICF2P454846 32 ATAAGATTATATCAAATATTATTTATATCTATGTCTTTCCAGTTGTCTATTTTCAGAGTC[A/G]GTCAGTATTTTTACATGGTTATAACTAATTATAGAACATATAATGTTTAGAAAAATCTTC A 2 BICF2S23338638 12 AAAAGTTAATGTAAATGATAAAGAAAAAGTACATAAAACAGATCATATAGCCTCCCACCC[A/C]AAACAGAAATTCTATGACTTGAATAACCACCAACTTTTCTCCATACCAACCCCTACTTGA C 3 BICF2P580549 23 AGCAGGAGACTTCTCCATGGCTTTAGCACAGCCCCTGACTTGCCCGAACGGTAGATATTG[A/G]GAATCTGGCACATGCAGTTACACGTCTTTATGGCTGTCTTTTCCTGCAATGGCAGTCAAA G 4 BICF2S23121945 26 GTTCATAAAAAATTAAACATCCAGATGCTAAATTAAAGTTCACATCTTCATTCCTTGAGTC[A/G]TTGTCTTTGCAAAGCTGTGTCTTGAAGTTATTTGAGAATGTGCGCACAGAAATCAGAGTA A 5 BICF2P1151337 19 AGCATCCACCTCCTCTTGAGCCCAAATCTAGATCATATGATTTCAACACACTGTCTCAGG[A/G]CATATGGGAGAAAAAAAAAAMAAMAAAAAAAGTAAAAAAAGCAGAACTTAACAAGTTGTG C 6 BICF2S23519255 12 TATTTGAAGAGGTACCTTCTCCATTAAGTTCCAATGGTTTGCATGTTCTGTGTGGAAGAG[A/G]GGACATCTGTAGGGTTGCATGGTGGAAAACTGAAAAGGTGGAGGGAAGAGCAGGAAGGGG G 7 BICF2S23419975 5 TTTTGTGRACCTAATACATAATGACAGAGAAAAAAATCACAGCATCCATTAAGATCTAAT[A/C]AAGCTGTATGAGGCACCATGGCATGGATGGGGGAGGTGAATAATTTTGAGTTTCCTATAA A 8 BICF2S23419974 5 ATTGAGCCATTATTTTGGAACTCTCGTGTAGAGTCTTTGCATTTTATTCCACATTTTGTG[A/G]ACCTAATACATAATGACAGAGAAAAAAATCACAGCATCCATTAAGATCTAATMAAGCTGT G 9 BICF2S23758106 36 AGCAAACACATTGTTTAATTAATGAAAAATTAGGCTGTTGGGTCAAGAGCATGATGGTAT[A/G]CAATGAATGGCATAACACATTTTAGGAGTTTGTTCATACCCATCTTCTTTATCACRGTAA A 10 BICF2S23718102 37 TCAGGGGTGGTTGGGCTCCTCCCGAAGCCAGGCAAGAACGTGTCAAGGAGAGGCTTCTTG[A/C]AGTTCTTGTTTTCCCAAAACAAAGGAAACTCCTTGCATTGCTGGAAGTCGCGTGCTTGGA A

<Mean value and standard error value for each genotype related to the length of the Jindo dog> number single nucleotide polymorphism name chromosome Item genotype-1 genotype-2 genotype-3 One BICF2P454846 32 Variation (Number of Populations) AA(24) AT(198) TT(533) Average 52.11 52.27 51.08 standard error 2.25 0.95 0.54 2 BICF2S23338638 12 Variation (Number of Populations) AA(214) AC(358) CC(179) Average 51.00 51.37 51.96 standard error 0.81 0.64 1.11 3 BICF2P580549 23 Variation (Number of Populations) AA(66) AG(288) GG(403) Average 49.59 51.14 51.90 standard error 1.97 0.73 0.61 4 BICF2S23121945 26 Variation (Number of Populations) AA(436) AG(276) GG(36) Average 51.92 50.78 50.22 standard error 0.56 0.84 2.21 5 BICF2P1151337 19 Variation (Number of Populations) AA(348) AC(317) CC(90) Average 50.78 51.98 51.83 standard error 0.73 0.67 1.19 6 BICF2S23519255 12 Variation (Number of Populations) AA(181) AG(381) GG(189) Average 50.70 51.44 52.12 standard error 1.05 0.66 0.76 7 BICF2S23419975 5 Variation (Number of Populations) AA(354) AC(321) CC(76) Average 51.96 51.13 49.98 standard error 0.55 0.77 1.83 8 BICF2S23419974 5 Variation (Number of Populations) AA(76) AG(321) GG(354) Average 49.98 51.13 51.96 standard error 1.83 0.77 0.55 9 BICF2S23758106 36 Variation (Number of Populations) AA(1) AG(73) GG(683) Average 53.30 49.65 51.62 standard error 0.00 0.48 0.51 10 BICF2S23718102 37 Variation (Number of Populations) AA(2) AG(90) GG(644) Average 54.00 52.35 51.26 standard error 5.00 1.21 0.50

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Development of genetic markers for early prediction of body length of Jindo dogs <130> 2020P-11-047 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2P454846 <220> <221> variation <222> (61) <223> n is A or G <400> 1 ataagattat atcaaatatt atttatatct atgtctttcc agttgtctat tttcagagtc 60 ngtcagtatt tttacatggt tataactaat tatagaacat ataatgttta gaaaaatctt 120 c 121 <210> 2 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23338638 <220> <221> variation <222> (61) <223> n is A or C <400> 2 aaaagttaat gtaaatgata aagaaaaagt acataaaaca gatcatatag cctcccaccc 60 naaacagaaa ttctatgact tgaataacca ccaacttttc tccataccaa cccctacttg 120 a 121 <210> 3 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2P580549 <220> <221> variation <222> (61) <223> n is A or G <400> 3 agcaggagac ttctccatgg ctttagcaca gcccctgact tgcccgaacg gtagatattg 60 ngaatctggc acatgcagtt acacgtcttt atggctgtct tttcctgcaa tggcagtcaa 120 a 121 <210> 4 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23121945 <220> <221> variation <222> (61) <223> n is A or G <400> 4 gttcataaaa attaaacatc cagatgctaa attaaagttc acatcttcat tccttgagtc 60 nttgtctttg caaagctgtg tcttgaagtt atttgagaat gtgcgcacag aaatcagagt 120 a 121 <210> 5 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2P1151337 <220> <221> variation <222> (61) <223> n is A or G <400> 5 agcatccacc tcctcttgag cccaaatcta gatcatatga tttcaacaca ctgtctcagg 60 ncatatggga gaaaaaaaaa amaamaaaaa aagtaaaaaa agcagaactt aacaagttgt 120 g 121 <210> 6 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23519255 <220> <221> variation <222> (61) <223> n is A or G <400> 6 tatttgaaga ggtaccttct ccattaagtt ccaatggttt gcatgttctg tgtggaagag 60 nggacatctg tagggttgca tggtggaaaa ctgaaaaggt ggagggaaga gcaggaaggg 120 g 121 <210> 7 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23419975 <220> <221> variation <222> (61) <223> n is A or C <400> 7 ttttgtgrac ctaatacata atgacagaga aaaaaatcac agcatccatt aagatctaat 60 naagctgtat gaggcaccat ggcatggatg ggggaggtga ataattttga gtttcctata 120 a 121 <210> 8 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23419974 <220> <221> variation <222> (61) <223> n is A or G <400> 8 attgagccat tattttggaa ctctcgtgta gagtctttgc atttattcc acattttggg 60 nacctaatac ataatgacag agaaaaaaat cacagcatcc attaagatct aatmaagctg 120 t-121 <210> 9 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23758106 <220> <221> variation <222> (61) <223> n is A or G <400> 9 agcaaacaca ttgtttaatt aatgaaaaat taggctgttg ggtcaagagc atgatggtat 60 ncaatgaatg gcataacaca ttttaggagt ttgttcatac ccatcttctt tatcacrgta 120 a 121 <210> 10 <211> 121 <212> DNA <213> artificial sequence <220> <223> BICF2S23718102 <220> <221> variation <222> (61) <223> n is A or C <400> 10 tcaggggtgg ttgggctcct cccgaagcca ggcaagaacg tgtcaaggag aggcttcttg 60 nagttcttgt tttcccaaaa caaaggaaac tccttgcatt gctggaagtc gcgtgcttgg 120 a 121

Claims (15)

A single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, the 61st base is C or A SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, the 61st base is A or G SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 61st base is G or A SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, the 61st base is G or A SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the 61st base is A or G SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, the 61st base is C or A SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, the 61st base is A or G SNP;
In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, the 61st base is A or G SNP; and
A composition for early prediction of body length in Jindo dogs, comprising an agent capable of detecting or amplifying a SNP in which the 61st base is A or C in a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10.
The composition for early prediction of body length in Jindo dog according to claim 1, characterized in that the agent capable of detecting or amplifying the SNP is a primer or a probe.
A kit for early prediction of body length in Jindo dogs, comprising the composition of claim 1.
A microarray for early prediction of body length in Jindo dogs, comprising the composition of claim 1.
1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and SEQ ID NO: 4 from the DNA of the sample isolated from Jindo dog A polynucleotide composed of the nucleotide sequence, a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7, a nucleotide sequence of SEQ ID NO: 8 Amplifying a site containing SNPs of a polynucleotide consisting of a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 9 and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 10 or a polynucleotide complementary thereto; and
2) A method for early prediction of body length in Jindo dog, characterized in that it comprises the step of determining the base type of the SNP at the site containing the amplified SNP.


delete delete delete delete delete delete delete delete delete delete

Images