KR102124770B1 - Composition for early predicting or diagnosing hip dysplasia in dog - Google Patents

Abstract

The present invention relates to a composition for early prediction or diagnosis of hip dislocation in dogs, which is to check a risk of hip dislocation according to a genotype by selecting 7 SNPs capable of discriminating individuals with a high risk of hip dislocation in dogs. The composition for predicting or diagnosing hip joint dislocation of dogs using the same predicts important genetic information when preparing for special management for dogs having a risk of hip joint dislocation, which is a genetically progressive disease, or when mating for breeding, and thus can be favorably used to select excellent dogs with no risk of hip dislocation.

Description

Composition for early predicting or diagnosing hip dysplasia in dog}

The present invention relates to a composition for early prediction or diagnosis of dislocation of a dog.

There are about 400 species of dogs worldwide, which is the result of excessive human breeding. As a result, dogs are exposed to various genetic diseases due to increased inbreeding. Hereditary diseases of the dog include hip dislocation (hip dysplasia), obesity, cataracts, degenerative retinopathy, allergies, epilepsy, and kidney disease. In particular, hip dislocation is one of the most common skeletal diseases that occur in dogs. It is a disease in which dislocation or degenerative arthritis occurs because the tissue supporting the hip joint is not firm.

Dog's hip dislocation is initially symptom-free, but it is a progressive disease that gradually develops after 4 months of age if there is a genetic predisposition. It is difficult to diagnose initially, and once it develops, periodic drug treatment or surgery can be used to correct it. Treatment is difficult. Hip dislocation occurs frequently in large dogs weighing more than 35kg, such as retrievers, shepherds, malinois, and English spaniels. In the case of breeds that are nurtured as special-purpose dogs such as retrievers and shepherds, hip dislocation occurs in about 20-50% due to continued inbreeding It is said to have a remark. Because hip dislocation does not have any symptoms initially, in the case of breeds that are selected as candidate dogs from 3 months of age and are trained as special-purpose dogs such as guide dogs and detection dogs after a long training period, a method of early diagnosis of hip dislocation is necessary. Was done.

On the other hand, DNA testing for genetic diseases provides important information for early identification of major risk variants. The genetic diseases of dogs currently being used for DNA testing include dwarfism, degenerative retinopathy, epilepsy and malignant fever, and are continuously being developed through molecular biology techniques.

F. Coopman et al. Veterinary Record, 163: 654-658, 2008.

An object of the present invention is to provide a composition for predicting or diagnosing a hip joint dislocation, a kit for predicting or diagnosing a hip joint comprising the same, or a method for predicting or diagnosing a hip dislocation using the same.

In order to achieve the above object, the present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP whose 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; And an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:7, Provided is a diagnostic composition.

In addition, the present invention provides a kit for predicting or diagnosing hip dislocation of a dog comprising the composition.

In addition, the present invention is 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of a sample isolated from a dog, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, and polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 A step of amplifying a site comprising the SNP of any one or more polynucleotides selected from the group consisting of or complementary polynucleotides thereof, wherein the SNP is SEQ ID NO: 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: Base number 61 of the polynucleotide consisting of the base sequence of 2, base number 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3, base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 4, of SEQ ID NO: 5 A step of being the base 61 of the polynucleotide consisting of the nucleotide sequence, the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 6, or the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 7; And 2) determining the base type of the SNP at the site containing the amplified SNP.

The present invention is to check the risk of hip dislocation according to the genotype by selecting 7 SNPs capable of discriminating individuals with high risk of hip dislocation, and the composition for predicting or diagnosing hip dislocation using the dog is genetically developed. It can be used to select excellent dogs that do not have a risk of hip dislocation by predicting important genetic information when preparing special care for a dog with a risk of hip dislocation, or breeding for breeding.

1 is a graph showing the result of measuring the risk of hip dislocation according to the genotype of the SNP (Nos. 1 and 2) of the present invention ('-' among graph x-axis items: full length with missing data whose genotype was not determined) Included in genome association analysis).
2 is a graph showing the results of measuring the risk of hip dislocation according to the genotype of SNP (Nos. 3 and 4) of the present invention.
3 is a graph showing the result of measuring the risk of hip dislocation according to the genotype of the SNP (Nos. 5 and 6) of the present invention ('-' in the graph x-axis item: full length with missing data whose genotype was not determined) Included in genome association analysis).
4 is a graph showing the results of measuring the risk of hip dislocation according to the genotype of SNP (No. 7) of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP whose 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; And an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:7, Provided is a diagnostic composition.

The agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to the site containing the SNP, a polynucleotide comprising the site containing the SNP, or a product thereof It may be a primer capable of specifically amplifying a complementary polynucleotide.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. These primers can be modified using a number of means known in the art, as long as it has the effect of detecting the site containing the SNP. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modification between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids are one or more additional covalently attached residues, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer may include a label that can be directly or indirectly detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g. ³² P), fluorescent molecules and chemical groups (e.g. biotin), etc. There is this.

As used herein, the term "probe" refers to nucleic acid fragments corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, oligonucleotide probes, single stranded DNA probes , It may be produced in the form of a double stranded DNA (double stranded DNA) probe or RNA probe.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such a probe can be modified using a number of means known in the art, as long as it has the effect of detecting the site containing the SNP. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may be further bonded to a reporter at its 5'end. The reporters are FAM (6-carboxyfluorescein), Texas red, fluorescein, fluorescein chlorotriazinyl, HEX (2',4',5',7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, alexa Fluoro(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine. However, any material known to be used as a reporter in the art can be used.

The probe may further be conjugated with a quencher at its 3'end. The quencher is TAMRA, black hole quencher (BHQ) 1, BHQ2, BHQ3, nonfluorescent quencher (NFQ), dabcyl, Eclipse, deep dark quencher (DDQ), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other material known to be used in the art as a quencher can be used.

Agents capable of detecting or amplifying the SNP may include reverse transcriptase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. Various DNA polymerases can be used in the amplification step of the present invention to amplify reverse-transcribed cDNA, and examples of DNA polymerases include C. lanau fragments of E.coli DNA polymerase I, thermostable DNA polymerases or bacteriophage T7 DNA polymerization There are enzymes. The polymerase can be obtained from cells expressing a high level of cloning gene that is isolated from the bacteria itself, purchased commercially or that encodes the polymerase.

In addition, the present invention provides a kit for predicting or diagnosing a hip joint dislocation comprising the composition for predicting or diagnosing a hip joint dislocation.

The composition may have the characteristics as described above. In one example, the composition is an SNP whose 61st base is A or G in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP whose 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; And an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7.

In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide including a site containing the SNP Or it may be a primer capable of specifically amplifying its complementary polynucleotide.

The kit may be a PCR kit, a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can predict or diagnose hip dislocation of the dog by confirming the genotype of the SNP marker provided by the present invention through amplification using the above composition, or by checking the expression level of mRNA. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, RT-PCR kits include tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary) in addition to specific primer pairs for polynucleotides or complementary polynucleotides thereof that contain the SNP-containing site. , Enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water. Meanwhile, the components included in the kit may be manufactured in a liquid form, or may be manufactured in a dried form in order to improve the stability of the product by lowering the degrees of freedom of the components. In order to manufacture the dried form, application of a drying step is required, and at this time, heating, natural drying, vacuum drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention is 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of a sample isolated from a dog, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, and polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 A step of amplifying a site comprising the SNP of any one or more polynucleotides selected from the group consisting of or complementary polynucleotides thereof, wherein the SNP is SEQ ID NO: 61 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: Base number 61 of the polynucleotide consisting of the base sequence of 2, base number 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3, base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 4, of SEQ ID NO: 5 A step of being the base 61 of the polynucleotide consisting of the nucleotide sequence, the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 6, or the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 7; And 2) determining the base type of the SNP at the site containing the amplified SNP.

The step of amplifying the site containing the SNP of step 1) may be any method known to those skilled in the art. For example, it can be obtained by amplifying and purifying the target nucleic acid through PCR. Other ligase chain reactions (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), autologous sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA) can be used.

The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) is sequencing, hybridization by microarray, allele specific PCR, dynamic allele hybridization technique (dynamic allelespecifichybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis) It can be, but is not limited to.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the base 61 of SNP of a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 or a complementary polynucleotide thereof is G, it is determined that the risk of hip dislocation is increased. Can be.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 2 or the SNP of the complementary polynucleotide No. 61 are A, it is determined that the risk of hip dislocation is increased. Can be.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the base 61 of SNP of a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 or a complementary polynucleotide thereof is G, it is determined that the risk of hip dislocation of the dog is increased. Can be.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the base 61 of SNP of a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 4 or a complementary polynucleotide thereof is G, it is determined that the risk of hip dislocation is increased. Can be.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the base 61 of SNP of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5 or a complementary polynucleotide thereof is A, it is determined that the risk of hip dislocation of the dog is increased. Can be.

In the method for predicting or diagnosing hip dislocation of the dog, when all of the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 6 or the SNP of the complementary polynucleotide No. 61 are A, it is determined that the risk of hip dislocation of the dog is increased. Can be.

In the method for predicting or diagnosing hip joint dislocation, if the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 7 or the base No. 61 of the SNP of the complementary polynucleotide are all A, it is determined that the risk of hip dislocation of the dog is increased. Can be.

In a specific embodiment of the present invention, the present inventors extracted DNA from the blood of 70 dogs, analyzed the SNP genotype using a 170K SNP chip for the dog, and analyzed a genome-wide association study (GWAS). Through this, seven SNPs with early predictable risk of hip dislocation were selected (see Tables 1 to 4 and FIGS. 1 to 4).

Therefore, a composition for predicting or diagnosing hip dislocation according to the present invention, a kit for predicting or diagnosing hip dislocation comprising the same, or a method for predicting or diagnosing hip dislocation using the dog, has a risk of hip dislocation, which is a progressive disease that occurs genetically. It can be used to select excellent dogs without risk of hip dislocation by predicting important genetic information when preparing for special care for or breeding for breeding.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

SNP genotyping for dogs

DNA was extracted from the blood of 70 dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then the SNP genotype was analyzed using a 170K SNP chip (CanineHD BeadChip, Illumina, USA) for dogs. Did.

1-1. Day 1: Amplification

In a 96-well 0.8 ml MIDI plate (hereinafter referred to as'MSA3 plate') with MSA3 barcode, 20 µl of MA1 per well was added, and 4 µl of each DNA extracted from the blood of 70 dogs was added, followed by DNA ID and The location of the transferred MSA3 plate was noted. Then, add 4 μl of 0.1 N NaOH per well, cover the plate with a 96-well cover (96 well cap mat), shake for 1 minute at 1,600 rpm (vortexing), and centrifuge at 280 × g for 1 minute. Did. Thereafter, after reacting at room temperature for 10 minutes, 34 µl of MA2 per well was added, 38 µl of MSM was added, and the 96-well cover was covered and centrifuged at 280 × g for 1 minute. The sample was amplified by reacting in an Illumina Hybridization oven at 37° C. for 20 to 24 hours.

1-2. Day 2: Fragment

The MSA3 plate of Example 1-1 was taken out of the oven, centrifuged at 50 × g for 1 minute, 25 μl of FMS was added to each well, the plate was covered with a cover, and shaken for 1 minute at 1,600 rpm (vortexing). . Then, the plate was centrifuged at 50 x g for 1 minute, and reacted for 1 hour in a heat block at 37°C.

1-3. Day 2: Precipitation

After adding 25 μl of PM1 per well to the plate of Example 1-2, the lid was covered, centrifuged at 1,600 rpm for 1 minute, and then reacted in an oven at 37° C. for 5 minutes. After centrifuging the plate at 50 x g for 1 minute, the lid was removed and 155 µl of 2-propanol was added to each well. The plate was covered with a new 96-well cover and inverted 10 times to mix and stored at 4° C. for 30 minutes. Thereafter, after centrifugation at 4°C and 3,000 rpm for 20 minutes, the plate cover was removed and quickly turned over to discard the supernatant. The remaining supernatant was removed by tapping the kitchen towel about 10 times, and the inverted plate was placed on the tube rack as it was, and naturally dried for 1 hour to leave only DNA precipitation.

1-4. Day 2: Resuspend

23 μl of RA1 per well was added to the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for further staining (XStain HD Bead Chip). A foil seal was placed on the plate, and the heat-sealer block was pressed and sealed for 5 seconds. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken for 1 minute at 1,800 rpm (vortexing), and centrifuged at 280 × g for 1 minute.

1-5. Day 2: Hybridization

The plate of Example 1-4 was put in a 95°C heat block to denature the DNA sample for 20 minutes (denaturation). Subsequently, the plates were left at room temperature for 30 minutes, and while cooling, gaskets were put in the hybrid chamber, and 400 µl of each PB2 was added to eight humidifying buffer reservoirs in the hybridization chamber, and the lid was placed. Close and leave at room temperature. The MSA3 plate containing the DNA cooled at room temperature was centrifuged at 280×g for 1 minute. After preparing the refrigerated SNP chips one by one, prepare and align the barcode shape of the hybridization chamber insert with the barcode portion of the chip, and then load 15 μl of each DNA sample cooled with a multi-channel pipette into both portions of the chip. ). As soon as the sample loading of each chip was finished, it was put into the hybridization chamber and the next chip was repeated in the same way. When the chamber was completely filled, the chamber lid was closed, placed in an oven at 48°C, and the speed was set to 5 to react for 16 to 24 hours.

1-6. Day 3: Washing bead chips

The hybridization chamber of Example 1-5 was taken out of the oven, the inserts in the chamber were taken out one by one, and the seal attached to the chip was pulled out and removed, and the chip from which the seal was removed was placed in a wash rack and WB1 The dish was soaked in a wash dish. After all the chips were placed in WB1, the washing racks were removed from the dish for 1 minute, and then washed, while the racks were moved to another washing dish containing PB1 for 1 minute. After washing, the back frame is placed on the Multi-sample BeadChips Alignment fixture, the chips are placed one by one in accordance with the barcode direction, and the space of the transparent part separated from the white part is aligned. Fitted to the top and bottom of the. After raising the space, the alignment bar was placed on the top of the chip without the barcode, the glass plate was covered with the tip of the glass plate touching the bar, and a clip was inserted to complete the flow-through chamber assembly. The alignment bar was removed, and the space portions at both ends of the chamber assembly were cut with scissors.

1-7. Day 3: dyeing (XStain Beadchips)

After setting the temperature of the chamber rack to 44°C, the chamber assembly of Examples 1-6 was fitted to the chamber rack. After adding 150 µl of RA1 to each chip and repeating the reaction for 30 seconds 6 times, 450 µl of XC1, 450 µl of XC2 and 200 µl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 µl of 95% formamide/1 mM EDTA (ethylenediaminetetraacetic acid) was added to each chip and reacted for 1 minute, followed by the same addition once again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, add 450 µl of XC3 to each chip, react for 1 minute, then add the same again, and set the temperature of the chamber rack Waited to reach. Thereafter, reagents were added to each chip in the order of A-B-A-B-A in Table 1 below, and reacted.

set order Reagents in each chip Reaction time after adding reagent A One 250 μl LTM 10 minutes 2 450 μl XC3 1 min 3 450 μl XC3 5 minutes B One 250 μl ATM 10 minutes 2 450 μl XC3 1 min 3 450 μl XC3 5 minutes

After completion of the reaction, the chamber rack was immediately removed from the chamber assembly and transferred to a laboratory table at room temperature and placed flat. 310 ml of PB1 was placed in the washing container and the staining rack was placed in the container. After removing the clip of the chamber rack using an instrument and lifting the glass block, the space was removed while not touching the bead portion of the chip. After removing all the attachments attached to the chip, they were placed in a staining rack contained in PB1 and soaked in PB1. All chips were processed in the same way as above. The dyeing rack was slowly moved up and down about 10 times to quench the chips, soaked for 5 minutes, then filled with 310 ml of XC4 in another washing container, and the chips were immersed in the same manner as above, and then soaked for 5 minutes. Thereafter, the dyeing rack was taken out, and the chip was carefully taken out using forceps and placed on the tube rack. The tube rack with the chips was placed in a vacuum dryer and dried under vacuum at 508 mmHg (0.68 bar) for 55 minutes. The edges of the dried chips were wiped with care to avoid touching the bead using KIMWIPES moistened with ethanol. After completion of the experiment, the bead chip was imaged using a scanner within 72 hours.

Experimental Example 1. Screening of 7 SNPs that can predict the risk of hip dislocation early

High-density SNP 170K chip analysis and genome-wide association study (GWAS) were performed on 70 dogs.

Specifically, the images obtained in Example 1 were analyzed to analyze genotypes of 70 dogs. Subsequently, the SNP was filtered using PLINK and R/SNPassoc package for quality control (QC) and database construction of the full-length genotype data, and Hardy-Weinberg equilibrium (HWE) inspection and MAF (minor allele) frequencies) genes not suitable for the conditions were excluded (HWE p <0.001, MAF <0.001, call rate <90%). Thereafter, the degree of hip dislocation of the 70 dogs was evaluated and scored to calculate the phenotypic value of the degree of hip dislocation for each genotype. Through the full-length genome association analysis, the degree of association with the risk of hip dislocation according to the genotype analyzed from the SNP chip was calculated, and a significant SNP was explored using a mixed linear model based association analysis (MLMA). .

As a result, seven SNPs capable of predicting the risk of hip dislocation of dogs were selected, and the mean and standard deviation (SD) of each selected phenotypic value were determined, and each standard deviation was divided by the square of the number of genotypes. Standard errors (SE) were calculated (Tables 2-4, and Figures 1-4).

Statistical analysis of 7 SNPs that can predict the risk of hip dislocation (1) number SNP name chromosome bp (position) A1 A2 Gene frequency One BICF2S2352810 4 37777662 G A 0.0714286 2 BICF2S23531949 6 23736871 A G 0.42029 3 BICF2P832958 4 38315755 A G 0.0785714 4 BICF2P1205894 28 29441358 G A 0.275362 5 BICF2P308917 4 37492018 A C 0.0642857 6 BICF2P1216748 18 35169287 A G 0.178571 7 BICF2P761195 23 39187054 A G 0.357143

Statistical analysis of 7 SNPs that can predict the risk of hip dislocation (2) number SNP name Beta statistics Standard error p (probability) One BICF2S2352810 5.05702 1.23274 0.0000409 2 BICF2S23531949 2.35472 0.601846 0.0000913 3 BICF2P832958 4.6026 1.1867 0.0001051 4 BICF2P1205894 2.3859 0.621495 0.0001236 5 BICF2P308917 4.88528 1.28707 0.0001473 6 BICF2P1216748 2.90697 0.771972 0.0001661 7 BICF2P761195 2.34269 0.624582 0.0001763

Sequence information of 7 SNPs that can predict the risk of hip dislocation order
number SNP name chromosome Sequence variation region Hip dislocation
Risks
genotype One BICF2S2352810 4 TCAGCAGGTTGTGGTTCCGCTGAGAATTACGAGGGTGTCGGTGTCCACTTGCCCGATTTC [A/G] GGAGTTGCACGTAAGTGGTTTTGTAATAGAATAGAGAGAGGCACAAGCTCTTGATCTGAC G 2 BICF2S23531949 6 AATTTAGCTCTTCCTATCCTCCTCTACCTCTATAGCATAGTAAAGGACCTGAGATTAAAT [A/G] AGAAAAATTAGAAGTAACAAAAARCTGAAAWCATCAGGTCTGCAAAGACGTATATTAAAA A 3 BICF2P832958 4 CCTCTTCTTATGCACTTCCTTTGTTATAAACCCAGAGACTCGGATTCCAAAATCTTTATG [A/G] TGGATATTTACTCTTTGGATATCATAGCCGTCCTGGAGCTCCCAGAATATACATGAACAT G 4 BICF2P1205894 28 TGCCCTACCCTCTATTTTTCCAGCATTCCTCTTGCCAGTGCCAATGGTTTACTTCATTCA [A/G] GACCTCCTGCCTTGTGCACAGGGCAAAGGGTCTAGGACTGTAGAAAACACTTACCTTGAA G 5 BICF2P308917 4 GTGATAACGGTGATGCGGTTACGTAAGAACGAAAAAAAAAAAAAGTTTTGCCAGCTTTGT [A/C] AGATCGTTTGGAGTCCGAGATGCACTTGCAAAGGGCTCCTGCAGGTGCGGGGCGAGGGGG A 6 BICF2P1216748 18 AAGCCAGAGAGttttttgttttttgtttttttttttttttAGACATTCTTCTGAATCTGA [A/G] TGCCGGTGATGAACACAAAAATTGGATGCTTTTCTTCGTTTCTCCCCGCGGGGCCTGACA A 7 BICF2P761195 23 GGGTCACTTGGCCATGTACGGCTAGCTTATGGTTCAGATGGCCATCTCTTCCACACAACC [A/G] TTTGGTTCAGTAAGCAGGAAAGGCTTCTAGGTATGCTCTGTTTCTCTCCATGTCCAGAAA A

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for early predicting or diagnosing hip dysplasia in dog <130> 2018P-11-077 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S2352810 <400> 1 tcagcaggtt gtggttccgc tgagaattac gagggtgtcg gtgtccactt gcccgatttc 60 rggagttgca cgtaagtggt tttgtaatag aatagagaga ggcacaagct cttgatctga 120 c 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23531949 <400> 2 aatttagctc ttcctatcct cctctacctc tatagcatag taaaggacct gagattaaat 60 ragaaaaatt agaagtaaca aaaarctgaa awcatcaggt ctgcaaagac gtatattaaa 120 a 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P832958 <400> 3 cctcttctta tgcacttcct ttgttataaa cccagagact cggattccaa aatctttatg 60 rtggatattt actctttgga tatcatagcc gtcctggagc tcccagaata tacatgaaca 120 t 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1205894 <400> 4 tgccctaccc tctatttttc cagcattcct cttgccagtg ccaatggttt acttcattca 60 rgacctcctg ccttgtgcac agggcaaagg gtctaggact gtagaaaaca cttaccttga 120 a 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P308917 <400> 5 gtgataacgg tgatgcggtt acgtaagaac gaaaaaaaaa aaaagttttg ccagctttgt 60 magatcgttt ggagtccgag atgcacttgc aaagggctcc tgcaggtgcg gggcgagggg 120 g 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1216748 <400> 6 aagccagaga gttttttgtt ttttgttttt tttttttttt agacattctt ctgaatctga 60 rtgccggtga tgaacacaaa aattggatgc ttttcttcgt ttctccccgc ggggcctgac 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P761195 <400> 7 gggtcacttg gccatgtacg gctagcttat ggttcagatg gccatctctt ccacacaacc 60 rtttggttca gtaagcagga aaggcttcta ggtatgctct gtttctctcc atgtccagaa 120 a 121

Claims (11)

SNP (single nucleotide polymorphism, SNP) in which the 61st base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is A or G;
SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP whose 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; And
A composition for predicting or diagnosing hip dislocation of a dog, comprising an agent capable of detecting or amplifying SNP having a base 61 of A or G in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 7.
The composition for predicting or diagnosing hip dislocation of a dog according to claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
A kit for predicting or diagnosing hip dislocation, comprising the composition of claim 1.
1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 from the DNA of the sample isolated from the dog, and SEQ ID NO: 7 As a step of amplifying the site comprising the SNP of the polynucleotide of the base sequence or a complementary polynucleotide thereof
The SNP is the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 4, the base 61 of the polynucleotide consisting of the base sequence of SEQ ID NO: 6 , And the base nucleotide sequence of SEQ ID NO: 7, which is base 61; And
2) A method for predicting or diagnosing hip dislocation of a dog, comprising determining the base type of SNP at a site containing the amplified SNP.
delete The method according to claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is all A, or when the base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide. , It is determined that the dog's risk of hip dislocation is increased.
delete The method according to claim 4, when the SNP of the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is all G, or when a base complementary to the genotype is identified at a corresponding position of its complementary polynucleotide. , It is determined that the dog's risk of hip dislocation is increased.
delete The method according to claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is all A, or when the base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide. , It is determined that the dog's risk of hip dislocation is increased.
The method of claim 4, wherein the base No. 61 of the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is all A, or when the base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide. , It is judged that the dog's risk of hip dislocation is increased.

Images