KR102194880B1 - SNP marker for prediction of dog's diabetes risk and prediction method using the same - Google Patents

SNP marker for prediction of dog's diabetes risk and prediction method using the same Download PDF

Info

Publication number
KR102194880B1
KR102194880B1 KR1020190126471A KR20190126471A KR102194880B1 KR 102194880 B1 KR102194880 B1 KR 102194880B1 KR 1020190126471 A KR1020190126471 A KR 1020190126471A KR 20190126471 A KR20190126471 A KR 20190126471A KR 102194880 B1 KR102194880 B1 KR 102194880B1
Authority
KR
South Korea
Prior art keywords
seq
base
snp
polynucleotide represented
dogs
Prior art date
Application number
KR1020190126471A
Other languages
Korean (ko)
Inventor
최봉환
박종은
박원철
박미림
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020190126471A priority Critical patent/KR102194880B1/en
Application granted granted Critical
Publication of KR102194880B1 publication Critical patent/KR102194880B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is to check the degree of diabetes according to a genotype by selecting 20 SNPs capable of discriminating individuals with high risk of diabetes in dogs, wherein a SNP composition for predicting the risk of diabetes in dogs using the same can be usefully used for preparing special management for dogs having risk of obesity, or selecting excellent dogs which do not have the risk of developing diseases such as cataract, chronic pancreatitis, nephropathy, neuropathy, and diabetic ketoacidosis which can be caused by diabetes by predicting important genetic information during crossbreeding for propagation.

Description

개의 당뇨 위험성 예측용 SNP 마커 및 이를 이용한 예측 방법{SNP marker for prediction of dog's diabetes risk and prediction method using the same}SNP marker for prediction of dog's diabetes risk and prediction method using the same}

본 발명은 개의 당뇨 위험성 예측용 SNP 마커 및 이를 이용한 예측 방법에 관한 것이다.The present invention relates to a SNP marker for predicting the risk of diabetes in dogs and a prediction method using the same.

당뇨병은 높은 혈당 수치가 오랜 기간 지속되는 대사 질환군을 지칭하는 것으로, 췌장이 충분한 인슐린을 만들어 내지 못하거나 몸의 세포가 만들어진 인슐린에 적절하게 반응하지 못하는 것이 원인이 된다. 인슐린 작용의 부족 등에 의한 만성 고혈당증은 여러 특징적인 대사 이상을 수반하는데, 인슐린은 주로 탄수화물 대사에 관여하므로, 당뇨병은 탄수화물 대사의 이상이 기본적인 문제이다. 그러나 이로 인해 체내의 모든 영양소 대사가 영향을 받게 되므로, 또한 총체적인 대사상의 질병이라고 할 수 있다. Diabetes mellitus refers to a group of metabolic diseases in which high blood sugar levels persist for a long period of time, and the cause is that the pancreas does not make enough insulin or the cells of the body do not respond properly to the insulin made. Chronic hyperglycemia due to lack of insulin action, etc., accompanies several characteristic metabolic abnormalities. Since insulin is mainly involved in carbohydrate metabolism, diabetes is a basic problem in carbohydrate metabolism. However, since this affects the metabolism of all nutrients in the body, it can also be called an overall metabolic disease.

진성당뇨병은 인슐린의 절대적 또는 상대적인 결핍으로 인하여 일어나는 대사성 질환으로 개에서 가장 흔히 발생하는 내분비성 질환이다. 개에서의 당뇨병 발병률은 100마리에서 500마리 중 한마리 꼴로 발생하는 것으로 알려져 있고 반려 동물의 노령화로 인해 그 발병률이 점점 증가하고 있는 추세이다(Nelson RW. Diabetes mellitus. In: Textbook of veterinary internal medicine, 6th ed. St. Louis: Elsevier Saunders, 2005: 1563-1591). 개에서는 인슐린 분비의 완벽한 결핍으로 인한 인슐린 의존형 당뇨병(insulin dependent diabetes mellitus, IDDM)이 대부분을 차지하고 치료를 위해 외인성 인슐린의 투여가 지속적으로 필요하다. 인슐린 치료가 적절하게 이루어지지 않는 경우 백내장, 만성췌장염, 신증, 신경병증, 당뇨병성 케톤산혈증 등 합병증의 발생 위험이 높아지게 된다.True diabetes is a metabolic disease caused by an absolute or relative deficiency of insulin, and is the most common endocrine disease in dogs. The incidence of diabetes in dogs is known to occur in about one in 100 to 500 dogs, and the incidence rate is gradually increasing due to the aging of companion animals (Nelson RW. Diabetes mellitus. In: Textbook of veterinary internal medicine, 6th ed. St. Louis: Elsevier Saunders, 2005: 1563-1591). In dogs, insulin dependent diabetes mellitus (IDDM), due to a complete lack of insulin secretion, accounts for the majority, and the administration of exogenous insulin is constantly required for treatment. If insulin treatment is not performed properly, the risk of complications such as cataract, chronic pancreatitis, nephropathy, neuropathy, and diabetic ketoacidemia increases.

한편, 유전 질환에 대한 DNA 시험은 주요 위험 변이체를 조기에 확인하는데 중요한 정보를 제공해준다. 현재 DNA 시험이 활용되고 있는 개의 유전질환으로는 왜소발육증, 퇴행성 망막위축증, 간질 및 악성 발열 등이 있으며, 분자생물학적 기법을 통해 지속적으로 개발되고 있다.On the other hand, DNA testing for genetic diseases provides important information for early identification of key risk variants. Genetic diseases in dogs for which DNA tests are currently being used include dwarf development, degenerative retinal atrophy, epilepsy and malignant fever, and are continuously developed through molecular biological techniques.

이에, 본 발명자들은 개 150두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 당뇨 위험도를 조기 예측 가능한 SNP 20개를 선별하여 본 발명을 완성하였다.Accordingly, the present inventors extracted DNA from the blood of 150 dogs, analyzed the SNP genotype using a 170K SNP chip for the dog, and analyzed the dog's diabetes risk through a genome-wide association study (GWAS). The present invention was completed by selecting 20 early predictable SNPs.

본 발명의 목적은 개의 당뇨 위험성 예측용 SNP 조성물, 이를 검출 또는 증폭할 수 있는 제제를 포함하는 조성물, 상기 조성물을 포함하는 개의 당뇨 위험성 예측용 키트 및 개의 당뇨 위험성 예측 방법을 제공하는 것이다. It is an object of the present invention to provide a SNP composition for predicting diabetes risk in dogs, a composition comprising an agent capable of detecting or amplifying the same, a kit for predicting diabetes risk in dogs comprising the composition, and a method for predicting diabetes risk in dogs.

상기 목적을 달성하기 위하여, 본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;(s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 당뇨 위험성 예측용 조성물을 제공한다. In order to achieve the above object, the present invention provides (a) single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 1; (b) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) a SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A or G; (g) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A or G; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 11 is A or C; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A or G; (s) the SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A or G; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It provides a composition for predicting the risk of diabetes in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

또한, 본 발명은 상기 조성물을 포함하는 개의 당뇨 위험성 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting the risk of diabetes in dogs comprising the composition.

또한, 본 발명은 상기 조성물을 포함하는 개의 당뇨 위험성 예측용 마이크로어레이를 제공한다.In addition, the present invention provides a microarray for predicting the risk of diabetes in dogs comprising the composition.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및 2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 당뇨 위험성 예측 방법을 제공한다.In addition, the present invention includes 1) any one or more polynucleotides selected from the group consisting of polynucleotides consisting of nucleotide sequences of SEQ ID NOs: 1 to 20 from DNA of a sample isolated from dogs, or SNPs of complementary polynucleotides thereof. Amplifying the desired region; And 2) determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP, providing a method for predicting the risk of diabetes in dogs.

본 발명은 개에서 당뇨의 위험성이 높은 개체를 판별할 수 있는 SNP 20개를 선별하여 해당 유전자형에 따른 당뇨 위험도를 확인한 것인 바, 이를 이용한 개의 당뇨 위험성 예측용 SNP 조성물은 당뇨병의 위험성을 갖는 개에 대한 특별한 관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 당뇨병에 의해 발생할 수 있는 백내장, 만성췌장염, 신증, 신경병증, 당뇨병성 케톤산혈증과 같은 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.The present invention is to check the diabetes risk according to the genotype by selecting 20 SNPs capable of discriminating individuals with high risk of diabetes in dogs, the SNP composition for predicting the risk of diabetes in dogs using this Preparing for special care for or breeding, predicts important genetic information, and does not have the risk of developing diseases such as cataract, chronic pancreatitis, nephropathy, neuropathy, diabetic ketoacidosis, which can be caused by diabetes. It can be usefully used to select excellent dogs.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;(s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 당뇨 위험성 예측용 조성물을 제공한다. The present invention includes (a) single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 1; (b) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) a SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A or G; (g) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A or G; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 11 is A or C; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A or G; (s) the SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A or G; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It provides a composition for predicting the risk of diabetes in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.The agent capable of detecting or amplifying the SNP may be a primer or a probe, and specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide including a site containing the SNP, or a It may be a primer capable of specifically amplifying a complementary polynucleotide.

상기 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프라이머는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. 또한, 상기 프라이머는 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소(예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자 및 화학그룹(예를 들어, 바이오틴) 등이 있다.The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

본 명세서에서 사용되는 용어 "프로브"는 DNA 또는 RNA와 특이적으로 결합할 수 있는 수개 내지 수백 개의 염기에 해당하는 핵산 단편을 의미하며, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브 또는 RNA 프로브 등의 형태로 제작될 수 있다.The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe, etc. may be produced.

상기 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프로브는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다.The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. Such a probe can be modified using a number of means known in the art as long as it exhibits an effect of detecting a site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent.

상기 프로브는 이의 5' 말단에 리포터가 추가로 더 접합될 수 있다. 상기 리포터는 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸로다민(tetramethylrhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 리포터로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다. The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine can be any one or more selected from the group consisting of However, any other known material that can be used as a reporter in the art can be used.

상기 프로브는 이의 3' 말단에 소광자가 추가로 더 접합될 수 있다. 상기 소광자는 TAMRA, BHQ(black hole quencher) 1, BHQ2, BHQ3, NFQ(nonfluorescent quencher), 답실(dabcyl), Eclipse, DDQ(deep dark quencher), 블랙베리 퀸처(Blackberry Quencher), 아이오와 블랙(Iowa black)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 소광자로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다.The probe may be further conjugated with a quencher to its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other known material that can be used as a quencher in the art may be used.

상기 SNP를 검출 또는 증폭할 수 있는 제제에는 역전사 중합효소, DNA 중합효소, Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP가 포함될 수 있다. 역전사된 cDNA를 증폭하기 위하여 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, DNA 중합효소의 예로 E.coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 또는 박테리오파지 T7 DNA 중합효소가 있다. 중합효소는 박테리아 그 자체로부터 분리하거나 상업적으로 구입하거나 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다.Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. The polymerase can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

또한, 본 발명은 상기 개의 당뇨 위험성 예측용 조성물을 포함하는 개의 당뇨 위험성 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting the risk of diabetes in dogs comprising the composition for predicting the risk of diabetes in dogs.

상기 조성물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;(s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는 것일 수 있다.The composition may have the characteristics as described above. For example, the present invention includes (a) a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 1; (b) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) a SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A or G; (g) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A or G; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 11 is A or C; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A or G; (s) the SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A or G; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It may include an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

또한, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically a probe capable of specifically binding to a site containing the SNP, a polynucleotide comprising a site containing the SNP Alternatively, it may be a primer capable of specifically amplifying its complementary polynucleotide.

상기 키트는 PCR 키트, DNA 분석용 키트일 수 있으나, 이에 제한되지 않는다.The kit may be a PCR kit or a DNA analysis kit, but is not limited thereto.

본 발명의 키트는 상기 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 유전자형을 증폭을 통해 확인하거나, 또는 mRNA의 발현 수준을 확인함으로써 개의 당뇨 위험성을 예측할 수 있다. 본 발명에서 제공하는 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다.The kit of the present invention can predict the risk of diabetes in dogs by confirming the genotype of the SNP marker provided by the present invention through amplification using the above composition, or by confirming the expression level of mRNA. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

예를 들어, RT-PCR 키트는, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드에 대한 특이적인 프라이머 쌍 이외에도 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오티드(dNTPs), Taq-폴리머라제 및 역전사 효소와 같은 효소, DNase 억제제, RNase 억제제, DEPC-수(DEPC-water) 및 멸균수 등을 포함할 수 있다. 한편, 키트에 포함되는 성분들은 액상 형태로 제조될 수도 있고, 포함 성분들의 자유도를 낮추어 제품의 안정성을 제고하기 위해 건조된 형태로 제조될 수도 있다. 이러한 건조된 형태로의 제조를 위해서는 건조 단계의 적용이 필요하고, 이때 가온건조, 자연건조, 감압건조, 동결건조 또는 이들의 복합 공정이 사용될 수 있다.For example, the RT-PCR kit includes a tube or other suitable container, reaction buffer (pH and magnesium concentration varying) in addition to a primer pair specific for a polynucleotide containing the SNP-containing site or a complementary polynucleotide thereof. , Deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water, and sterile water. Meanwhile, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to prepare such a dried form, a drying step is required, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a combination thereof may be used.

또한, 본 발명은 상기 개의 당뇨 위험성 예측용 조성물을 포함하는 개의 당뇨 위험성 예측용 마이크로어레이를 제공한다.In addition, the present invention provides a microarray for predicting the risk of diabetes in dogs comprising the composition for predicting the risk of diabetes in dogs.

본 발명에 있어 마이크로어레이란 기판상에 폴리뉴클레오티드의 그룹이 높은 밀도로 고정화되어 있는 것으로서, 상기 폴리뉴클레오티드 그룹은 각각 일정한 영역에 고정화되어 있는 마이크로어레이를 의미한다. 이러한 마이크로어레이는 당업계에 잘 알려져 있다. In the present invention, a microarray refers to a microarray in which a group of polynucleotides is immobilized on a substrate at a high density, and each of the polynucleotide groups is immobilized in a certain region. Such microarrays are well known in the art.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및 2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 당뇨 위험성 예측 방법을 제공한다. In addition, the present invention includes 1) any one or more polynucleotides selected from the group consisting of polynucleotides consisting of nucleotide sequences of SEQ ID NOs: 1 to 20 from DNA of a sample isolated from dogs, or SNPs of complementary polynucleotides thereof. Amplifying the desired region; And 2) determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP, providing a method for predicting the risk of diabetes in dogs.

상기 단계 1)의 SNP를 포함하는 부위를 증폭시키는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 예를 들면, 표적 핵산을 PCR을 통하여 증폭하고 이를 정제하여 얻을 수 있다. 그 외 리가제 연쇄 반응(LCR)(Wu 및 Wallace, Genomics 4, 560(1989), Landegren 등, Science 241, 1077(1988)), 전사증폭(transcription amplification)(Kwoh 등, ProcNatlAcad Sci USA 86, 1173(1989)), 자가유지 서열 복제(Guatelli 등, ProcNatl Acad Sci USA 87, 1874(1990)) 및 핵산에 근거한 서열 증폭(NASBA)이 사용될 수 있다.The step of amplifying the site containing the SNP of step 1) may be performed by any method known to those skilled in the art. For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), self-maintaining sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA) can be used.

상기 단계 2)의 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계는 서열분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화 기법(dynamic allelespecifichybridization, DASH), PCR 연장 분석, PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예를 들면, Sequenom의 MassARRAY 시스템), 미니-시퀀싱(minisequencing) 방법, Bio-Plex 시스템(BioRad), CEQ and SNPstream 시스템(Beckman), Molecular Inversion Probe 어레이 기술(예를 들면, Affymetrix GeneChip), 및 BeadArray Technologies(예를 들면, Illumina GoldenGate 및 Infinium 분석법) 등을 이용하여 수행될 수 있으나, 이에 제한되지는 않는다. The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) includes sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele hybridization techniques. (dynamic allelespecific hybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assay), etc. May be, but is not limited thereto.

상기 개의 당뇨 위험성 예측 방법에 있어서, 서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 6로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C인 경우; 및 서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 및 서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 로 이루어진 그룹에서 선택되는 적어도 하나에 해당하면 당뇨 위험성이 높은 것으로 판단할 수 있다. In the method for predicting the risk of diabetes in dogs, when the 61st base in the polynucleotide represented by SEQ ID NO: 1 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 2 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 3 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 4 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 5 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 6 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 8 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 9 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 11 is C; And when the 61st base in the polynucleotide represented by SEQ ID NO: 12 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 13 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 14 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 15 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 16 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 17 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A; And when the 61st base in the polynucleotide represented by SEQ ID NO: 20 is G; If it corresponds to at least one selected from the group consisting of, it can be determined that the risk of diabetes is high.

본 발명의 구체적인 실시예에서, 본 발명자들은 개 150두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 당뇨 위험성을 조기 예측 가능한 SNP 20개를 선별하였다(표 1 내지 표 4 참조).In a specific embodiment of the present invention, the present inventors extract DNA from the blood of 150 dogs, then analyze the SNP genotype using a 170K SNP chip for the dog, and analyze the full-length genome association (Genome-wide association study, GWAS). 20 SNPs capable of early predicting the risk of diabetes in dogs were selected through (see Tables 1 to 4).

따라서, 본 발명에 따른 개에서 당뇨의 위험성이 높은 개체를 판별할 수 있는 SNP 조성물, 이를 포함하는 개의 당뇨 위험성 예측용 키트, 또는 이를 이용한 개의 당뇨 위험성 예측 방법은 당뇨병의 위험성을 갖는 개에 대한 특별한 관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 당뇨병에 의해 발생할 수 있는 백내장, 만성췌장염, 신증, 신경병증, 당뇨병성 케톤산혈증과 같은 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.Therefore, the SNP composition capable of discriminating individuals with high risk of diabetes in dogs according to the present invention, a kit for predicting diabetes risk in dogs including the same, or a method for predicting diabetes risk in dogs using the same is a special method for dogs having diabetes risk Predicting important genetic information when preparing for management or breeding for breeding, it is possible to protect excellent dogs without the risk of developing diseases such as cataract, chronic pancreatitis, nephropathy, neuropathy, diabetic ketoacidemia, which can be caused by diabetes. It can be usefully used for selection.

이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by examples and experimental examples.

단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해서 한정되는 것은 아니다.However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<실시예 1> 개에 대한 SNP 유전자형 분석<Example 1> SNP genotyping analysis of dogs

개 150두의 혈액으로부터 DNA 정제 키트(Wizard Genomic DNA Purification Kit, Promega, 미국)를 이용하여 각각 DNA를 추출한 후, 개에 대한 170K SNP 칩(CanineHD BeadChip, Illumina, 미국)을 이용하여 SNP 유전자형을 분석하였다.DNA was extracted from the blood of 150 dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then SNP genotype was analyzed using 170K SNP chip (CanineHD BeadChip, Illumina, USA) for dogs. I did.

<1-1> 1일차: 증폭(Amplification)<1-1> Day 1: Amplification

MSA3 바코드를 붙인 96-웰 0.8 ㎖ MIDI 플레이트(이하, 'MSA3 플레이트')에 웰 당 20 ㎕의 MA1을 넣고, 개 150두의 혈액으로부터 추출한 각 DNA를 웰 당 4 ㎕씩 넣은 후, DNA ID 및 옮긴 MSA3 플레이트의 위치를 기록해두었다. 이후, 각 웰 당 4 ㎕의 0.1 N NaOH를 넣고, 96-웰 덮개(96 well cap mat)로 플레이트를 덮은 후 1,600 rpm에서 1분 동안 흔들어 섞어주고(vortexing), 280 × g에서 1분간 원심분리하였다. 이후, 10분 동안 실온에서 반응시킨 후, 웰 당 34 ㎕의 MA2를 넣고, 38 ㎕의 MSM을 넣은 후, 96-웰 덮개를 덮고 280 × g에서 1분간 원심분리하였다. 37℃의 오븐(Illumina Hybridization oven)에서 20 내지 24시간 동안 반응시켜 시료를 증폭시켰다.20 µl of MA1 per well was added to a 96-well 0.8 ml MIDI plate (hereinafter referred to as'MSA3 plate') with MSA3 barcodes attached, and 4 µl of each DNA extracted from the blood of 150 dogs was added per well, and then DNA ID and The location of the transferred MSA3 plate was recorded. Thereafter, 4 µl of 0.1 N NaOH was added to each well, and after covering the plate with a 96-well cover (96 well cap mat), shake it at 1,600 rpm for 1 minute (vortexing), and centrifuge at 280 × g for 1 minute. I did. Thereafter, after reacting at room temperature for 10 minutes, 34 µl of MA2 was added per well, 38 µl of MSM was added, and then the 96-well cover was covered and centrifuged at 280 × g for 1 minute. Samples were amplified by reacting for 20 to 24 hours in a 37°C oven (Illumina Hybridization oven).

<1-2> 2일차: 조각(Fragment)<1-2> Day 2: Fragment

상기 실시예 1-1의 MSA3 플레이트를 오븐에서 꺼내 50 × g에서 1분간 원심분리하고, 각 웰 당 25 ㎕의 FMS를 넣은 후, 덮개로 플레이트를 덮어 1,600 rpm에서 1분간 흔들어 섞어주었다(vortexing). 이후, 플레이트를 50 × g에서 1분간 원심분리하고, 37℃ 히트 블록(heat block)에서 1시간 동안 반응시켰다.The MSA3 plate of Example 1-1 was taken out of the oven and centrifuged at 50 × g for 1 minute, and 25 μl of FMS was added to each well, and then the plate was covered with a cover and shaken at 1,600 rpm for 1 minute (vortexing). . Thereafter, the plate was centrifuged at 50 × g for 1 minute, and reacted in a 37° C. heat block for 1 hour.

<1-3> 2일차: 침전(Precipitation)<1-3> Day 2: Precipitation

상기 실시예 1-2의 플레이트에 각 웰 당 25 ㎕의 PM1을 넣은 후, 덮개를 덮고, 1,600 rpm에서 1분간 원심분리한 후, 37℃ 오븐에서 5분간 반응시켰다. 플레이트를 50 × g에서 1분간 원심분리한 후, 덮개를 벗기고, 각 웰 당 155 ㎕의 2-프로판올(2-propanol)을 넣었다. 새로운 96-웰 덮개로 플레이트를 덮고 10번 뒤집어 혼합한 뒤, 4℃에서 30분 동안 보관하였다. 이후, 4℃, 3,000 rpm에서 20분 동안 원심분리 후, 플레이트 덮개를 제거하고 빠르게 뒤집어 상층액을 버렸다. 키친타올에 10회 정도 가볍게 두드려 남아있는 상층액을 제거하고, 뒤집어진 플레이트를 그대로 튜브 렉에 올려놓고 1시간 동안 자연 건조시켜 DNA 침전만 남도록 하였다.After adding 25 µl of PM1 per well to the plate of Example 1-2, the cover was covered, centrifuged at 1,600 rpm for 1 minute, and reacted in an oven at 37° C. for 5 minutes. After centrifuging the plate at 50 × g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, inverted 10 times, mixed, and stored at 4° C. for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and quickly turned over to discard the supernatant. The remaining supernatant was removed by tapping lightly on a kitchen towel about 10 times, and the inverted plate was placed on a tube rack and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> 2일차: 재현탁(Resuspend)<1-4> Day 2: Resuspend

상기 실시예 1-3의 DNA 침전이 들어있는 플레이트에 웰 당 23 ㎕의 RA1을 넣고, 남은 RA1은 추후 염색(XStain HD Bead Chip)을 위해 냉동보관하였다. 플레이트에 호일 실(foil seal)을 올리고, 히트-실러 블록(heat-sealer block)을 5초 동안 눌러 밀봉하였다. 밀봉한 플레이트를 48℃의 오븐에서 1시간 동안 반응시킨 후, 1,800 rpm에서 1분간 흔들어 섞어주었고(vortexing), 280 × g에서 1분간 원심분리하였다.23 µl of RA1 per well was added to the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for later staining (XStain HD Bead Chip). A foil seal was put on the plate, and a heat-sealer block was pressed for 5 seconds to seal. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken at 1,800 rpm for 1 minute and mixed (vortexing), followed by centrifugation at 280 × g for 1 minute.

<1-5> 2일차: 혼성화(Hybridazation)<1-5> Day 2: Hybridization

상기 실시예 1-4의 플레이트를 95℃ 히트 블록(Heat block)에 넣어 20분 동안 DNA 시료를 변성시켰다(denaturation). 이후, 플레이트를 실온에 30분 동안 두고 식히는 동안 혼성화 챔버(HybChamber)에 가스킷(gaskets)을 끼우고, 혼성화 챔버에 있는 8개의 버퍼 리저버(humidifying buffer reservoir)에 각 400 ㎕의 PB2를 넣고, 뚜껑을 닫아 실온에 두었다. 실온에서 식힌 DNA가 담긴 MSA3 플레이트를 280 × g에서 1분간 원심분리하였다. 냉장 보관하던 SNP 칩을 하나씩 꺼내 준비하고, 혼성화 챔버 인서트(insert)의 바코드 모양과 칩의 바코드 부분을 맞추어 놓은 후, 멀티채널 피펫으로 식힌 DNA 시료를 각 15 ㎕씩 칩의 양쪽 부분으로 로딩(loading)하였다. 각 칩의 시료 로딩이 끝나는 대로 혼성화 챔버에 넣고 다음 칩도 같은 방법으로 반복하였다. 챔버가 모두 채워지면 챔버 뚜껑을 닫고 48℃의 오븐에 넣고 속도를 5로 설정하여 16 내지 24시간 동안 반응시켰다.The plate of Example 1-4 was placed in a 95° C. heat block to denature the DNA sample for 20 minutes (denaturation). Then, leave the plate at room temperature for 30 minutes and insert gaskets into the hybridization chamber (HybChamber) while cooling, add 400 μl of PB2 to each of the eight humidifying buffer reservoirs in the hybridization chamber, and remove the lid. Closed and placed at room temperature. MSA3 plate containing DNA cooled at room temperature was centrifuged at 280 × g for 1 minute. Take out and prepare refrigerated SNP chips one by one, align the barcode shape of the hybridization chamber insert with the barcode part of the chip, and then load the DNA sample cooled with a multi-channel pipette into both parts of the chip by 15 µl each. ). As soon as the sample loading of each chip was finished, it was placed in the hybridization chamber and the next chip was repeated in the same manner. When the chamber was all filled, the chamber lid was closed, placed in an oven at 48° C., and the rate was set to 5 to react for 16 to 24 hours.

<1-6> 3일차: 세척(Washing bead chips)<1-6> Day 3: Washing bead chips

상기 실시예 1-5의 혼성화 챔버를 오븐에서 꺼내고, 챔버 속의 인서트를 하나씩 꺼내, 칩에 붙어 있는 실(seal)을 잡아당겨 제거한 후, 실이 제거된 칩을 세척 렉(wash rack)에 꽂아 WB1이 담긴 세척 디쉬(wash dish)에 담갔다. 모든 칩이 WB1에 담긴 후 세척 렉을 디쉬에서 1분 동안 뺐다 넣었다 하면서 씻어주었고, PB1이 들어 있는 다른 세척 디쉬에 렉을 옮겨 1분 동안 뺐다 넣었다 하면서 씻어주었다. 세척이 끝난 후, 비드칩 얼라인먼트 픽스쳐(Multi-sample BeadChips Alignment fixture)에 백 프레임(back frame)을 올리고, 바코드 방향에 맞추어 칩을 한 장씩 올린 후, 흰색 부분과 분리한 투명한 부분의 스페이스를 얼라인먼트 픽스쳐의 윗부분과 아랫부분에 맞추어 끼웠다. 스페이스를 올린 후, 바코드가 없는 칩의 윗부분에 얼라인먼트 바(alignment bar)를 올리고, 유리판의 끝이 바에 닿도록 유리판을 덮은 후, 클립을 끼워 챔버 어셈블리(Flow-through chamber assembly)를 완성하였다. 얼라인먼트 바를 제거하고, 챔버 어셈블리 양끝의 스페이스 부분을 가위로 잘라주었다.The hybridization chamber of Example 1-5 was taken out of the oven, the inserts in the chamber were taken out one by one, and the seal attached to the chip was pulled to remove it, and then the chip from which the seal was removed was inserted into a wash rack, and WB1 It was immersed in a wash dish. After all the chips were immersed in WB1, the washing rack was removed from the dish for 1 minute and washed, and the rack was moved to another washing dish containing PB1, and the rack was removed and placed for 1 minute. After washing, place the back frame on the Multi-sample BeadChips Alignment fixture, put the chip one by one according to the barcode direction, and then align the space of the transparent part separated from the white part. It was fitted to the top and bottom of the. After raising the space, an alignment bar was placed on the upper part of the chip without the barcode, the glass plate was covered so that the end of the glass plate touched the bar, and the flow-through chamber assembly was completed by inserting a clip. The alignment bar was removed, and spaces at both ends of the chamber assembly were cut with scissors.

<1-7> 3일차: 염색(XStain Beadchips)<1-7> Day 3: Dyeing (XStain Beadchips)

챔버 렉의 온도를 44℃로 맞춘 후, 상기 실시예 1-6의 챔버 어셈블리를 챔버 렉에 끼웠다. 각 칩에 150 ㎕의 RA1을 넣고 30초 동안 반응시키는 과정을 6번 반복한 후, 450 ㎕의 XC1, 450 ㎕의 XC2 및 200 ㎕의 TEM을 순차적으로 각 칩에 넣고 각각 10분씩 반응시켰다. 450 ㎕의 95% 포름아미드(formamide)/1mM EDTA(ethylenediaminetetraacetic acid)를 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 5분 동안 반응시켰다. LTM 튜브의 라벨에 적혀 있는 온도를 확인하고 해당 온도로 챔버 렉의 온도를 바꾸고, 450 ㎕의 XC3을 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 상기 설정한 챔버 렉의 온도에 도달할 때까지 기다렸다. 이후, 하기 표 1의 A - B - A - B - A의 순서로 각 칩에 시약을 넣고 반응시켰다.After adjusting the temperature of the chamber rack to 44° C., the chamber assembly of Example 1-6 was fitted to the chamber rack. 150 µl of RA1 was added to each chip and the reaction for 30 seconds was repeated 6 times, and then 450 µl of XC1, 450 µl of XC2, and 200 µl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 µl of 95% formamide/1mM ethylenediaminetetraacetic acid (EDTA) was added to each chip and reacted for 1 minute, and then the same was added again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, put 450 µl of XC3 into each chip and react for 1 minute, then put it the same again and put the set temperature of the chamber rack Waited until it reached. Thereafter, reagents were added to each chip in the order of A-B-A-B-A in Table 1 and reacted.

세트set 순서order 각 칩에 넣는 시약Reagents for each chip 시약 넣은 후 반응시간Reaction time after adding reagent AA 1One 250 ㎕의 LTM250 μl LTM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 minute 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes BB 1One 250 ㎕의 ATM250 μl of ATM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 minute 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes

상기 반응 종료 후, 즉시 챔버 어셈블리에서 챔버 렉을 분리하고 실온의 실험 테이블로 옮겨 평평하게 꺼내 두었다. 310 ㎖의 PB1을 세척 용기에 넣고 염색용 렉을 용기 안에 담가 두었다. 기구를 이용하여 챔버 렉의 클립을 벗기고 유리 블록을 들어서 제거한 후, 칩의 비드(bead) 부분을 건드리지 않도록 하면서 스페이스를 제거하였다. 칩에 붙였던 부착물을 모두 제거한 후, PB1에 담겨 있는 염색용 렉(staining rack)에 꽂아 PB1에 담가 두었다. 모든 칩을 순차적으로 상기와 동일하게 처리하였다. 염색용 렉을 천천히 10번 정도 위 아래로 움직여 칩을 담금질한 후, 5분 동안 담가두었다가 다른 세척용 용기에 XC4 310 ㎖을 채우고 상기와 동일하게 칩을 담금질한 후 5분 동안 담가두었다. 이후, 염색용 렉을 꺼내고 집게를 이용하여 칩을 조심스럽게 꺼내 튜브 렉 위에 올려두었다. 칩을 올린 튜브 렉을 진공 건조기에 넣고 508 mmHg(0.68 bar)의 진공 상태로 55분 동안 건조시켰다. 에탄올에 적신 티슈(KIMWIPES)를 이용하여 비드 부분을 건드리지 않도록 주의하면서 건조된 칩의 가장자리를 닦아주었다. 실험이 완료된 비드 칩은 72시간 이내에 스캐너를 이용하여 이미지화시켰다.Immediately after completion of the reaction, the chamber rack was removed from the chamber assembly, transferred to a room temperature experiment table, and placed flat. 310 ml of PB1 was put in a washing container, and the rack for dyeing was immersed in the container. After removing the clip of the chamber rack using a tool and lifting the glass block, the space was removed while not touching the bead part of the chip. After removing all the attachments attached to the chip, it was inserted into the staining rack contained in PB1 and immersed in PB1. All chips were sequentially treated in the same manner as above. The dyeing rack was slowly moved up and down about 10 times to quench the chips, and then soaked for 5 minutes. Then, 310 ml of XC4 was filled in another container for washing, and the chips were quenched in the same manner as above, and then soaked for 5 minutes. Thereafter, the dyeing rack was taken out, and the chips were carefully removed using forceps and placed on the tube rack. The tube rack on which the chips were loaded was placed in a vacuum dryer and dried for 55 minutes in a vacuum of 508 mmHg (0.68 bar). Using a tissue soaked in ethanol (KIMWIPES), the edge of the dried chip was wiped while being careful not to touch the bead. The bead chip after the experiment was completed was imaged using a scanner within 72 hours.

<실험예 1> 개의 당뇨 위험도를 조기 예측 가능한 20개 SNP의 선별<Experimental Example 1> Selection of 20 SNPs capable of early predicting the risk of diabetes in dogs

개 150두에 대한 고밀도 SNP 170K 칩 분석 및 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 수행하였다.A high-density SNP 170K chip analysis and a genome-wide association study (GWAS) were performed for 150 dogs.

구체적으로, 상기 실시예 1에서 얻은 이미지를 분석하여 개 150 두의 유전자형을 분석하였다. 이후, 전장유전체 유전자형 데이터 품질관리(quality control, QC) 및 데이터베이스 구축을 위하여 SNP를 필터링하여 하디-와인버그 평형(Hardy-Weinberg equilibrium, HWE) 검사 및 MAF(minor allele frequency)에 대해 R/SNPassoc 패키지의 chi-square 검정을 실시하여, 조건에 부적합한 유전자들을 제외하였다(HWE p < 0.001, MAF < 0.001). Specifically, by analyzing the image obtained in Example 1, the genotype of 150 dogs was analyzed. Thereafter, for quality control (QC) of full-length genotype data and database construction, the SNP was filtered to test Hardy-Weinberg equilibrium (HWE) and the R/SNPassoc package for minor allele frequency (MAF). A chi-square test was performed to exclude genes unsuitable for the condition (HWE p <0.001, MAF <0.001).

개 150두에 대한 혈액을 채취하여 반려견 전용 혈당 측정기(Catalyst Dx® Chemistry Analyzer; IDEXX BioResearch)를 사용하여 개의 나이, 성별, 품종을 기록하고 공복의 혈당수치를 측정하였다. 정상적인 개의 공복의 혈당수치는 80 내지 120mg/㎗이다.Blood sampling for dog 150 and two canine companion dedicated blood glucose meter; recorded using (Catalyst Dx ® Chemistry Analyzer IDEXX BioResearch ) of age, sex, breed, and to measure the fasting blood glucose levels. The normal fasting blood sugar level of a dog is 80 to 120 mg/dL.

이후, 상기 개 150 두의 공복의 혈당수치 위험성을 하기 일반식 1로 점수화하여 유전자형 별로 혈당수치의 표현형 수치를 계산하였다. 전장유전체 연관성 분석을 통하여 SNP 칩으로부터 분석한 유전자형에 따른 혈당수치 위험도와의 관련성 정도를 계산하고, Single marker regression에 대한 R-통계 패키지를 이용하여 혈당수치 위험성과 각 SNP 마커와의 상가적 유전효과(additive effect)를 분석하여 유의한 SNP를 탐색하였다.Thereafter, the risk of fasting blood glucose levels of 150 dogs was scored by the following General Formula 1 to calculate the phenotypic value of the blood glucose level for each genotype. Calculate the degree of correlation with the risk of blood glucose level according to the genotype analyzed from the SNP chip through full-length genetic correlation analysis, and use the R-statistics package for single marker regression to determine the risk of blood glucose level and additive genetic effect with each SNP marker. (additive effect) was analyzed to search for a significant SNP.

[일반식 1][General Formula 1]

y = μ + Sexi + SNPj + eij y = μ + Sex i + SNP j + e ij

(상기 일반식 1에서, y는 혈당수치, μ는 전체 평균, Sexi는 유전자형 효과(i=암컷, 수컷 및 중성화된 수컷), SNPj는 유전자형 효과(j=AA, AB, BB), eij는 임의오차, N~(0, σ2 e))(In the general formula 1, y is the blood glucose level, μ is the overall average, Sex i is the genotypic effect (i = female, male and neutralized male), SNP j is the genotypic effect (j = AA, AB, BB), e ij is a random error, N~(0, σ 2 e ))

유전체전장 연관분석(genome wide association test)과 같은 다중분석(multiple testing)의 문제점인 임의 발생 오류로 인한 오류 검정(False Positive)을 위하여 10,000번의 permutation test를 수행하여 0.1% 수준으로 genome-wise P-값을 계산하였다.For the false positive, which is a problem of multiple testing, such as the genome wide association test, 10,000 permutation tests were performed and the genome-wise P- The value was calculated.

그 결과, 개의 혈당수치 위험도를 조기 예측할 수 있는 20개의 SNP를 선별하였고, 선별한 각 표현형 수치들의 평균 및 표준편차(Standard Deviation,SD)를 구하고, 각 표준편차를 유전자형별 개수의 제곱으로 나누어 표준오차(Standard error, SE)를 계산하였다(표 2 내지 표 4). 각 표현형 별로 평균값이 높을수록 당뇨 위험도가 높음을 의미한다. As a result, 20 SNPs that can predict the risk of blood glucose levels in dogs were selected, the mean and standard deviation (SD) of each selected phenotype were calculated, and each standard deviation was divided by the square of the number of genotypes. The error (Standard error, SE) was calculated (Tables 2 to 4). The higher the average value for each phenotype, the higher the risk of diabetes.

<개의 당뇨 위험도를 조기 예측할 수 있는 20개 SNP의 통계분석><Statistical analysis of 20 SNPs that can predict early diabetes risk in dogs> 번호number SNP
단일염기변이 이름SNP
Single base variant name Chr
염색체Chr
chromosome bp(위치)bp (location) A1A1 A2A2 유전자빈도Gene frequency 베타통계량Beta statistics 표준오차Standard error p(확률값)p (probability value) 1One BICF2P1418953BICF2P1418953 2525 2741688727416887 AA GG 0.075 0.075 30.571 30.571 6.226 6.226 9.09E-079.09E-07 22 BICF2P563884BICF2P563884 55 97459929745992 GG AA 0.170 0.170 19.547 19.547 4.334 4.334 6.48E-066.48E-06 33 BICF2G630121162BICF2G630121162 1212 6052954560529545 GG AA 0.045 0.045 32.800 32.800 7.490 7.490 1.19E-051.19E-05 44 BICF2S22931998BICF2S22931998 55 97532139753213 GG AA 0.215 0.215 17.507 17.507 4.070 4.070 1.70E-051.70E-05 55 BICF2G630326422BICF2G630326422 2222 2936695329366953 CC AA 0.155 0.155 -18.909 -18.909 4.569 4.569 3.49E-053.49E-05 66 BICF2P634903BICF2P634903 3030 1365021913650219 GG AA 0.485 0.485 -13.087 -13.087 3.170 3.170 3.64E-053.64E-05 77 BICF2G630452599BICF2G630452599 3434 3598419235984192 AA GG 0.070 0.070 24.614 24.614 5.970 5.970 3.74E-053.74E-05 88 BICF2P1180786BICF2P1180786 2626 3246276432462764 AA GG 0.210 0.210 16.280 16.280 3.965 3.965 4.03E-054.03E-05 99 BICF2P880291BICF2P880291 55 97757919775791 GG AA 0.195 0.195 16.587 16.587 4.113 4.113 5.52E-055.52E-05 1010 BICF2G630454217BICF2G630454217 3434 3452302834523028 AA GG 0.180 0.180 16.378 16.378 4.160 4.160 8.24E-058.24E-05 1111 BICF2P85249BICF2P85249 3535 2471553124715531 CC AA 0.100 0.100 22.060 22.060 5.636 5.636 9.07E-059.07E-05 1212 BICF2G630361659BICF2G630361659 33 9389776493897764 AA GG 0.060 0.060 26.128 26.128 6.747 6.747 0.0001080.000108 1313 BICF2G630241963BICF2G630241963 55 7023588170235881 AA CC 0.095 0.095 22.015 22.015 5.734 5.734 0.0001230.000123 1414 BICF2P807794BICF2P807794 3535 2470521524705215 AA GG 0.065 0.065 25.030 25.030 6.554 6.554 0.0001340.000134 1515 BICF2P1167120BICF2P1167120 2020 4863705348637053 GG AA 0.520 0.520 -12.200 -12.200 3.200 3.200 0.0001370.000137 1616 BICF2G630459410BICF2G630459410 3434 2901586829015868 AA GG 0.135 0.135 17.276 17.276 4.542 4.542 0.0001430.000143 1717 BICF2P635007BICF2P635007 3030 1362976813629768 GG AA 0.465 0.465 -12.059 -12.059 3.181 3.181 0.000150.00015 1818 TIGRP2P108218_rs8591275TIGRP2P108218_rs8591275 88 1882956318829563 AA GG 0.085 0.085 20.172 20.172 5.332 5.332 0.0001550.000155 1919 BICF2P366353BICF2P366353 88 1884567718845677 AA GG 0.085 0.085 20.172 20.172 5.332 5.332 0.0001550.000155 2020 BICF2P64084BICF2P64084 2121 5270694052706940 GG AA 0.305 0.305 11.996 11.996 3.201 3.201 0.0001790.000179

<개의 당뇨 위험도를 조기예측 가능한 SNP의 염기서열 정보><Sequence information of SNP that can predict the risk of diabetes early in dogs> 번호number 단일염기다형 이름Monobase polymorphic name 염색체chromosome 염기서열변이영역Base sequence variation region 당뇨 위험성
유전자형Diabetes risk
genotype 1One BICF2P1418953BICF2P1418953 2525 CAAATATTCAATTAATCAGTGAGCATGGCAATTGTTTTTTCTCTCTTACACGCCTCTCAG[A/G]TTTTTGTCTTCTCTTCCCGCACACCAAGAGAGTCTTTACTGAAGTTCTCTCACCTGGACACAAATATTCAATTAATCAGTGAGCATGGCAATTGTTTTTTCTCTCTTACACGCCTCTCAG[A/G]TTTTTGTCTTCTCTTCCCGCACACCAAGAGAGTCTTTACTGAAGTTCTCTCACCTGGACA AA 22 BICF2P563884BICF2P563884 55 GAGAAATAAGAGAAGTCATAATTGAATAATCTGCAACCAGCAGTTATTATCTGGGTTACA[A/G]GCTTTCCTCGGGTACCTTCCTGCCAGATGGGGGTATAAATAGACATGTGCTCTGGGAAAAGAGAAATAAGAGAAGTCATAATTGAATAATCTGCAACCAGCAGTTATTATCTGGGTTACA[A/G]GCTTTCCTCGGGTACCTTCCTGCCAGATGGGGGTATAAATAGACATGTGCTCTGGGAAAA GG 33 BICF2G630121162BICF2G630121162 1212 TTAGATAACAGGCTTTTAAAATCTTTACAGTACACATCATTTCCTAGTGTTGCCAGATAT[A/G]GAAGCCCTTCCGCATTTGTGTTCTGTTTGGGCTGATTTGCCTGCATAAAATTCATGGAATTTAGATAACAGGCTTTTAAAATCTTTACAGTACACATCATTTCCTAGTGTTGCCAGATAT[A/G]GAAGCCCTTCCGCATTTGTGTTCTGTTTGGGCTGATTTGCCTGCATAAAATTCATGGAAT GG 44 BICF2S22931998BICF2S22931998 55 TAGCCTCTGCAGAGTCAACCATATTCATCACAGATAATGGGCACGTATAAGGAAGGCCTA[A/G]GAGCTGTAGCAAGGGAGGGCCCACTGAACAGGGCAGGGCCTGTTCGGTCTACTGCCTTCATAGCCTCTGCAGAGTCAACCATATTCATCACAGATAATGGGCACGTATAAGGAAGGCCTA[A/G]GAGCTGTAGCAAGGGAGGGCCCACTGAACAGGGCAGGGCCTGTTCGGTCTACTGCCTTCA GG 55 BICF2G630326422BICF2G630326422 2222 TGAGTATTATCTAGGAGATACATGATACTGAGCTAACTATTGGGGGAATGAGGATGTAGG[A/C]CATATAAAATTCCATAGCCAATCTGGAAAGACAGCTTAAATGTATTATTGGGTAATTCCTTGAGTATTATCTAGGAGATACATGATACTGAGCTAACTATTGGGGGAATGAGGATGTAGG[A/C]CATATAAAATTCCATAGCCAATCTGGAAAGACAGCTTAAATGTATTATTGGGTAATTCCT AA 66 BICF2P634903BICF2P634903 3030 TTGACTTACCCGCTGCTTATCGGGGTCCACAAAGCGGATCCCAAAGTAGTCTTTCTCAAG[A/G]AGGTTCAGGTGGTGGCAAAGAAGGTCAAACAGGTACTGGCCTTTGGCATCTCTCTGCAAATTGACTTACCCGCTGCTTATCGGGGTCCACAAAGCGGATCCCAAAGTAGTCTTTCTCAAG[A/G]AGGTTCAGGTGGTGGCAAAGAAGGTCAAACAGGTACTGGCCTTTGGCATCTCTCTGCAAA GG 77 BICF2G630452599BICF2G630452599 3434 TGTAAAGAGAATTAAACGATTAGTTATCTTTCATTTCTCTTGCCTTCTGCATCTTCCTCC[A/G]TCACCTCTTGTGTGACAGTATTCAATGTCATCTGCATTTGCAGGGCTATCCCTTAAAGCTTGTAAAGAGAATTAAACGATTAGTTATCTTTCATTTCTCTTGCCTTCTGCATCTTCCTCC[A/G]TCACCTCTTGTGTGACAGTATTCAATGTCATCTGCATTTGCAGGGCTATCCCTTAAAGCT AA 88 BICF2P1180786BICF2P1180786 2626 CAAAGCTCCTCCCCAAGAAACAGCTGGCGCTTTCTCAGAAGACCTCAATCAAAAAGGCTT[A/G]TCTTCAACCTTGCTTGATCTTGCCCAGGGCCAGAAGCCTCTCTCTGAGGAGGATCTGCCCCAAAGCTCCTCCCCAAGAAACAGCTGGCGCTTTCTCAGAAGACCTCAATCAAAAAGGCTT[A/G]TCTTCAACCTTGCTTGATCTTGCCCAGGGCCAGAAGCCTCTCTCTGAGGAGGATCTGCCC AA 99 BICF2P880291BICF2P880291 55 CCACCTCCAGGCCACTCGTGAAGCTACAGCTAGGTTTCAGATTTCTGGATTCAAGATTTG[A/G]ATTTTAAAATAACATAAAATTATTGGGTTCTAAAATAAYGATGAGCATCAAAGGCTATGACCACCTCCAGGCCACTCGTGAAGCTACAGCTAGGTTTCAGATTTCTGGATTCAAGATTTG[A/G]ATTTTAAAATAACATAAAATTATTGGGTTCTAAAATAAYGATGAGCATCAAAGGCTATGA AA 1010 BICF2G630454217BICF2G630454217 3434 CCACCTCCAGGCCACTCGTGAAGCTACAGCTAGGTTTCAGATTTCTGGATTCAAGATTTG[A/G]ATTTTAAAATAACATAAAATTATTGGGTTCTAAAATAAYGATGAGCATCAAAGGCTATGACCACCTCCAGGCCACTCGTGAAGCTACAGCTAGGTTTCAGATTTCTGGATTCAAGATTTG[A/G]ATTTTAAAATAACATAAAATTATTGGGTTCTAAAATAAYGATGAGCATCAAAGGCTATGA AA 1111 BICF2P85249BICF2P85249 3535 TTTCCTTCTGTTTCTTGCTGGTCCTTTGGTGTAACAAACTCTTACCCCACTCTCTGCACC[A/C]CCAATGCCGAGTACAGTGACTGGCAGGATGCRGGCTTCCACAAATGTATGCCACATCAATTTTCCTTCTGTTTCTTGCTGGTCCTTTGGTGTAACAAACTCTTACCCCACTCTCTGCACC[A/C]CCAATGCCGAGTACAGTGACTGGCAGGATGCRGGCTTCCACAAATGTATGCCACATCAAT CC 1212 BICF2G630361659BICF2G630361659 33 TCAGGGCATTTTGTCCATTTGCTTTGATCGTGAGCTGGCCCTCGTTCATTTGCTGCTTCA[A/G]AGAAGGTTTAATGGGAGAGTCTCAGTCACCCTGATCCTCTTTACCTGACAAATTAGGGTATCAGGGCATTTTGTCCATTTGCTTTGATCGTGAGCTGGCCCTCGTTCATTTGCTGCTTCA[A/G]AGAAGGTTTAATGGGAGAGTCTCAGTCACCCTGATCCTCTTTACCTGACAAATTAGGGTA AA 1313 BICF2G630241963BICF2G630241963 55 GGGACCGCGGCTTGACCCTAACCTATCATATTGTTATACGGCGGGACAAGGAGCTGCTCG[A/C]GGAATTTGGGCTCTGCGGTTGGGGGCCTCGGTGCCCTTGCCAGGCTGCCCCCCGCCTGGGGGGACCGCGGCTTGACCCTAACCTATCATATTGTTATACGGCGGGACAAGGAGCTGCTCG[A/C]GGAATTTGGGCTCTGCGGTTGGGGGCCTCGGTGCCCTTGCCAGGCTGCCCCCCGCCTGGG AA 1414 BICF2P807794BICF2P807794 3535 ATCMGGTTCTTCTGAATCCATCCTAATTTACCACCTGTGTACCCTGATATATGACCCTGT[A/G]ATTATCCCATTTCTGATGTCTTTCCCACACTGCAATAGCTTATTGGTCTCCTCTTTGACTATCMGGTTCTTCTGAATCCATCCTAATTTACCACCTGTGTACCCTGATATATGACCCTGT[A/G]ATTATCCCATTTCTGATGTCTTTCCCACACTGCAATAGCTTATTGGTCTCCTCTTTGACT AA 1515 BICF2P1167120BICF2P1167120 2020 ATTTAGTAAGAATGTATTGTACAATGCACCGAAAAGGCAGTTTGGGAGCCGAGAGCACTC[A/G]AACCTGAACGTGGGAAGAGGCTCACGGATATGTTTGCTGTGCAGCAGCATATTTAGTGAGATTTAGTAAGAATGTATTGTACAATGCACCGAAAAGGCAGTTTGGGAGCCGAGAGCACTC[A/G]AACCTGAACGTGGGAAGAGGCTCACGGATATGTTTGCTGTGCAGCAGCATATTTAGTGAG GG 1616 BICF2G630459410BICF2G630459410 3434 ATGCAAAGATGAGAGATTAGACAGATCGGTGCAAGGATGCAAAGATGAGAGATTTCAACA[A/G]CTTTTCAGGAAATCTTTCTGGACTGATTAGTTTAAGTGTCTGACATGGAAAATATCAGAAATGCAAAGATGAGAGATTAGACAGATCGGTGCAAGGATGCAAAGATGAGAGATTTCAACA[A/G]CTTTTCAGGAAATCTTTCTGGACTGATTAGTTTAAGTGTCTGACATGGAAAATATCAGAA AA 1717 BICF2P635007BICF2P635007 3030 ACATAGATGAAAGCAAGATGCAGAGCAGGCTATGAAGATCCCAGAAAGCCAGAGATCAGT[A/G]CTGGAGCTAAGGCTAGCTGACTCTGGAACTCTCTTCAGTTCTATGCAGGCCTCCTGCAGAACATAGATGAAAGCAAGATGCAGAGCAGGCTATGAAGATCCCAGAAAGCCAGAGATCAGT[A/G]CTGGAGCTAAGGCTAGCTGACTCTGGAACTCTCTTCAGTTCTATGCAGGCCTCCTGCAGA GG 1818 TIGRP2P108218_rs8591275TIGRP2P108218_rs8591275 88 GACCAAGGAATGTAAAAAGAGAATAACTGCAGAAGAAATGAATGCAGTGATAGAAGAGCG[A/G]GATGCTGCTTTGTCTCAGGTAACTGCATGGATCCGTAAAAGCATTTTCCCCCATTTCTTTGACCAAGGAATGTAAAAAGAGAATAACTGCAGAAGAAATGAATGCAGTGATAGAAGAGCG[A/G]GATGCTGCTTTGTCTCAGGTAACTGCATGGATCCGTAAAAGCATTTTCCCCCATTTCTTT AA 1919 BICF2P366353BICF2P366353 88 TGAATAAAGTGTCCTAGCACTTTGGATTAAAAAGACAAGTACCCTCTGTGAATGATATAC[A/G]CAGATCTTTACATTCCTCCTGAAATATCTGTGTGAGCAGGGCAAATAAGCTATCTATTTGTGAATAAAGTGTCCTAGCACTTTGGATTAAAAAGACAAGTACCCTCTGTGAATGATATAC[A/G]CAGATCTTTACATTCCTCCTGAAATATCTGTGTGAGCAGGGCAAATAAGCTATCTATTTG AA 2020 BICF2P64084BICF2P64084 2121 TTTCCAATTCCACAATCCTTCACAATAGAATTAAAAGTGAAGTGTGTGGGCGGGACTCAC[A/G]ATCTTGTCATTCAAATGGTGAAACCAATATCAAATTATTACCTTATGGGGGGAAAAAAAGTTTCCAATTCCACAATCCTTCACAATAGAATTAAAAGTGAAGTGTGTGGGCGGGACTCAC[A/G]ATCTTGTCATTCAAATGGTGAAACCAATATCAAATTATTACCTTATGGGGGGAAAAAAAG GG

<개의 당뇨 위험도와 연관된 유전자형별 평균치와 표준오차 값><Mean and standard error values for each genotype associated with diabetes risk in dogs> 번호number 단일염기다형 이름Monobase polymorphic name 염색체chromosome 항목Item 유전자형-1Genotype-1 유전자형-2Genotype-2 유전자형-3Genotype-3 1One BICF2P1418953BICF2P1418953 2525 변이(개체수)Variation (number of individuals) AA(1)AA(1) AG(17)AG(17) GG(132)GG(132) 평균Average 326.00 326.00 100.24 100.24 72.77 72.77 표준오차Standard error 326.00 326.00 15.33 15.33 4.86 4.86 22 BICF2P563884BICF2P563884 55 변이(개체수)Variation (number of individuals) AA(105)AA(105) AG(39)AG(39) GG(6)GG(6) 평균Average 72.74 72.74 84.36 84.36 117.83 117.83 표준오차Standard error 5.18 5.18 10.55 10.55 49.38 49.38 33 BICF2G630121162BICF2G630121162 1212 변이(개체수)Variation (number of individuals) AA(134)AA(134) AG(15)AG(15) GG(1)GG(1) 평균Average 77.62 77.62 60.53 60.53 326.00 326.00 표준오차Standard error 4.78 4.78 18.55 18.55 326.00 326.00 44 BICF2S22931998BICF2S22931998 55 변이(개체수)Variation (number of individuals) AA(89)AA(89) AG(50)AG(50) GG(11)GG(11) 평균Average 75.35 75.35 82.30 82.30 74.00 74.00 표준오차Standard error 5.45 5.45 9.11 9.11 31.29 31.29 55 BICF2G630326422BICF2G630326422 2222 변이(개체수)Variation (number of individuals) AA(109)AA(109) AC(35)AC(35) CC(6)CC(6) 평균Average 79.29 79.29 78.09 78.09 43.17 43.17 표준오차Standard error 6.09 6.09 8.69 8.69 19.67 19.67 66 BICF2P634903BICF2P634903 3030 변이(개체수)Variation (number of individuals) AA(52)AA(52) AG(64)AG(64) GG(34)GG(34) 평균Average 74.98 74.98 75.56 75.56 85.29 85.29 표준오차Standard error 10.35 10.35 6.87 6.87 7.79 7.79 77 BICF2G630452599BICF2G630452599 3434 변이(개체수)Variation (number of individuals) AA(2)AA(2) AG(15)AG(15) GG(133)GG(133) 평균Average 268.50 268.50 73.00 73.00 75.21 75.21 표준오차Standard error 57.50 57.50 14.58 14.58 4.89 4.89 88 BICF2P1180786BICF2P1180786 2626 변이(개체수)Variation (number of individuals) AA(12)AA(12) AG(41)AG(41) GG(97)GG(97) 평균Average 89.58 89.58 89.54 89.54 71.02 71.02 표준오차Standard error 31.56 31.56 9.02 9.02 5.37 5.37 99 BICF2P880291BICF2P880291 55 변이(개체수)Variation (number of individuals) AA(93)AA(93) AG(46)AG(46) GG(11)GG(11) 평균Average 78.00 78.00 77.54 77.54 74.00 74.00 표준오차Standard error 5.41 5.41 9.52 9.52 31.29 31.29 1010 BICF2G630454217BICF2G630454217 3434 변이(개체수)Variation (number of individuals) AA(6)AA(6) AG(46)AG(46) GG(99)GG(99) 평균Average 140.33 140.33 70.69 70.69 76.89 76.89 표준오차Standard error 43.30 43.30 9.71 9.71 5.34 5.34 1111 BICF2P85249BICF2P85249 3535 변이(개체수)Variation (number of individuals) AA(125)AA(125) AG(23)AG(23) CC(2)CC(2) 평균Average 72.46 72.46 97.87 97.87 163.00 163.00 표준오차Standard error 5.06 5.06 11.67 11.67 163.00 163.00 1212 BICF2G630361659BICF2G630361659 33 변이(개체수)Variation (number of individuals) AA(3)AA(3) AG(18)AG(18) GG(129)GG(129) 평균Average 108.67 108.67 70.50 70.50 77.83 77.83 표준오차Standard error 108.67 108.67 15.70 15.70 4.89 4.89 1313 BICF2G630241963BICF2G630241963 55 변이(개체수)Variation (number of individuals) AA(1)AA(1) AG(23)AG(23) GG(126)GG(126) 평균Average 326.00 326.00 93.48 93.48 72.69 72.69 표준오차Standard error 326.00 326.00 12.95 12.95 4.98 4.98 1414 BICF2P807794BICF2P807794 3535 변이(개체수)Variation (number of individuals) AA(2)AA(2) AG(15)AG(15) GG(133)GG(133) 평균Average 163.00 163.00 92.93 92.93 74.55 74.55 표준오차Standard error 163.00 163.00 15.68 15.68 4.90 4.90 1515 BICF2P1167120BICF2P1167120 2020 변이(개체수)Variation (number of individuals) AA(45)AA(45) AG(67)AG(67) GG(38)GG(38) 평균Average 77.44 77.44 73.94 73.94 84.11 84.11 표준오차Standard error 11.40 11.40 6.78 6.78 2.40 2.40 1616 BICF2G630459410BICF2G630459410 3434 변이(개체수)Variation (number of individuals) AA(4)AA(4) AG(29)AG(29) GG(117)GG(117) 평균Average 177.50 177.50 80.28 80.28 73.48 73.48 표준오차Standard error 50.62 50.62 11.72 11.72 5.16 5.16 1717 BICF2P635007BICF2P635007 3030 변이(개체수)Variation (number of individuals) AA(57)AA(57) AG(60)AG(60) GG(32)GG(32) 평균Average 72.53 72.53 80.20 80.20 84.03 84.03 표준오차Standard error 9.83 9.83 6.83 6.83 8.29 8.29 1818 TIGRP2P108218_rs8591275TIGRP2P108218_rs8591275 88 변이(개체수)Variation (number of individuals) AA(5)AA(5) AG(15)AG(15) GG(130)GG(130) 평균Average 125.20 125.20 91.53 91.53 74.12 74.12 표준오차Standard error 61.16 61.16 17.01 17.01 4.85 4.85 1919 BICF2P366353BICF2P366353 88 변이(개체수)Variation (number of individuals) AA(5)AA(5) AG(15)AG(15) GG(130)GG(130) 평균Average 125.20 125.20 91.53 91.53 74.12 74.12 표준오차Standard error 61.16 61.16 17.01 17.01 4.85 4.85 2020 BICF2P64084BICF2P64084 2121 변이(개체수)Variation (number of individuals) AA(84)AA(84) AG(43)AG(43) GG(24)GG(24) 평균Average 71.30 71.30 80.42 80.42 95.13 95.13 표준오차Standard error 5.90 5.90 9.34 9.34 16.30 16.30

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for prediction of dog's diabetes risk and prediction method using the same <130> 2019p-09-019 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1418953 <220> <221> variation <222> (61) <223> n is A or G <400> 1 caaatattca attaatcagt gagcatggca attgtttttt ctctcttaca cgcctctcag 60 ntttttgtct tctcttcccg cacaccaaga gagtctttac tgaagttctc tcacctggac 120 a 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P563884 <220> <221> variation <222> (61) <223> n is A or G <400> 2 gagaaataag agaagtcata attgaataat ctgcaaccag cagttattat ctgggttaca 60 ngctttcctc gggtaccttc ctgccagatg ggggtataaa tagacatgtg ctctgggaaa 120 a 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630121162 <220> <221> variation <222> (61) <223> n is A or G <400> 3 ttagataaca ggcttttaaa atctttacag tacacatcat ttcctagtgt tgccagatat 60 ngaagccctt ccgcatttgt gttctgtttg ggctgatttg cctgcataaa attcatggaa 120 t 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S22931998 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tagcctctgc agagtcaacc atattcatca cagataatgg gcacgtataa ggaaggccta 60 ngagctgtag caagggaggg cccactgaac agggcagggc ctgttcggtc tactgccttc 120 a 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630326422 <220> <221> variation <222> (61) <223> n is A or C <400> 5 tgagtattat ctaggagata catgatactg agctaactat tgggggaatg aggatgtagg 60 ncatataaaa ttccatagcc aatctggaaa gacagcttaa atgtattatt gggtaattcc 120 t 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P634903 <220> <221> variation <222> (61) <223> n is A or G <400> 6 ttgacttacc cgctgcttat cggggtccac aaagcggatc ccaaagtagt ctttctcaag 60 naggttcagg tggtggcaaa gaaggtcaaa caggtactgg cctttggcat ctctctgcaa 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630452599 <220> <221> variation <222> (61) <223> n is A or G <400> 7 tgtaaagaga attaaacgat tagttatctt tcatttctct tgccttctgc atcttcctcc 60 ntcacctctt gtgtgacagt attcaatgtc atctgcattt gcagggctat cccttaaagc 120 t 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1180786 <220> <221> variation <222> (61) <223> n is A or G <400> 8 caaagctcct ccccaagaaa cagctggcgc tttctcagaa gacctcaatc aaaaaggctt 60 ntcttcaacc ttgcttgatc ttgcccaggg ccagaagcct ctctctgagg aggatctgcc 120 c 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P880291 <220> <221> variation <222> (61) <223> n is A or G <400> 9 ccacctccag gccactcgtg aagctacagc taggtttcag atttctggat tcaagatttg 60 nattttaaaa taacataaaa ttattgggtt ctaaaataay gatgagcatc aaaggctatg 120 a 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630454217 <220> <221> variation <222> (61) <223> n is A or G <400> 10 ccacctccag gccactcgtg aagctacagc taggtttcag atttctggat tcaagatttg 60 nattttaaaa taacataaaa ttattgggtt ctaaaataay gatgagcatc aaaggctatg 120 a 121 <210> 11 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P85249 <220> <221> variation <222> (61) <223> n is A or C <400> 11 tttccttctg tttcttgctg gtcctttggt gtaacaaact cttaccccac tctctgcacc 60 nccaatgccg agtacagtga ctggcaggat gcrggcttcc acaaatgtat gccacatcaa 120 t 121 <210> 12 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630361659 <220> <221> variation <222> (61) <223> n is A or G <400> 12 tcagggcatt ttgtccattt gctttgatcg tgagctggcc ctcgttcatt tgctgcttca 60 nagaaggttt aatgggagag tctcagtcac cctgatcctc tttacctgac aaattagggt 120 a 121 <210> 13 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630241963 <220> <221> variation <222> (61) <223> n is A or C <400> 13 gggaccgcgg cttgacccta acctatcata ttgttatacg gcgggacaag gagctgctcg 60 nggaatttgg gctctgcggt tgggggcctc ggtgcccttg ccaggctgcc ccccgcctgg 120 g 121 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P807794 <220> <221> variation <222> (61) <223> n is A or G <400> 14 atcmggttct tctgaatcca tcctaattta ccacctgtgt accctgatat atgaccctgt 60 nattatccca tttctgatgt ctttcccaca ctgcaatagc ttattggtct cctctttgac 120 t 121 <210> 15 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1167120 <220> <221> variation <222> (61) <223> n is A or G <400> 15 atttagtaag aatgtattgt acaatgcacc gaaaaggcag tttgggagcc gagagcactc 60 naacctgaac gtgggaagag gctcacggat atgtttgctg tgcagcagca tatttagtga 120 g 121 <210> 16 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630459410 <220> <221> variation <222> (61) <223> n is A or G <400> 16 atgcaaagat gagagattag acagatcggt gcaaggatgc aaagatgaga gatttcaaca 60 ncttttcagg aaatctttct ggactgatta gtttaagtgt ctgacatgga aaatatcaga 120 a 121 <210> 17 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P635007 <220> <221> variation <222> (61) <223> n is A or G <400> 17 acatagatga aagcaagatg cagagcaggc tatgaagatc ccagaaagcc agagatcagt 60 nctggagcta aggctagctg actctggaac tctcttcagt tctatgcagg cctcctgcag 120 a 121 <210> 18 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P108218_rs8591275 <220> <221> variation <222> (61) <223> n is A or G <400> 18 gaccaaggaa tgtaaaaaga gaataactgc agaagaaatg aatgcagtga tagaagagcg 60 ngatgctgct ttgtctcagg taactgcatg gatccgtaaa agcattttcc cccatttctt 120 t 121 <210> 19 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P366353 <220> <221> variation <222> (61) <223> n is A or G <400> 19 tgaataaagt gtcctagcac tttggattaa aaagacaagt accctctgtg aatgatatac 60 ncagatcttt acattcctcc tgaaatatct gtgtgagcag ggcaaataag ctatctattt 120 g 121 <210> 20 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P64084 <220> <221> variation <222> (61) <223> n is A or G <400> 20 tttccaattc cacaatcctt cacaatagaa ttaaaagtga agtgtgtggg cgggactcac 60 natcttgtca ttcaaatggt gaaaccaata tcaaattatt accttatggg gggaaaaaaa 120 g 121 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for prediction of dog's diabetes risk and prediction method using the same <130> 2019p-09-019 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1418953 <220> <221> variation <222> (61) <223> n is A or G <400> 1 caaatattca attaatcagt gagcatggca attgtttttt ctctcttaca cgcctctcag 60 ntttttgtct tctcttcccg cacaccaaga gagtctttac tgaagttctc tcacctggac 120 a 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P563884 <220> <221> variation <222> (61) <223> n is A or G <400> 2 gagaaataag agaagtcata attgaataat ctgcaaccag cagttattat ctgggttaca 60 ngctttcctc gggtaccttc ctgccagatg ggggtataaa tagacatgtg ctctgggaaa 120 a 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630121162 <220> <221> variation <222> (61) <223> n is A or G <400> 3 ttagataaca ggcttttaaa atctttacag tacacatcat ttcctagtgt tgccagatat 60 ngaagccctt ccgcatttgt gttctgtttg ggctgatttg cctgcataaa attcatggaa 120 t 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S22931998 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tagcctctgc agagtcaacc atattcatca cagataatgg gcacgtataa ggaaggccta 60 ngagctgtag caagggaggg cccactgaac agggcagggc ctgttcggtc tactgccttc 120 a 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630326422 <220> <221> variation <222> (61) <223> n is A or C <400> 5 tgagtattat ctaggagata catgatactg agctaactat tgggggaatg aggatgtagg 60 ncatataaaa ttccatagcc aatctggaaa gacagcttaa atgtattatt gggtaattcc 120 t 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P634903 <220> <221> variation <222> (61) <223> n is A or G <400> 6 ttgacttacc cgctgcttat cggggtccac aaagcggatc ccaaagtagt ctttctcaag 60 naggttcagg tggtggcaaa gaaggtcaaa caggtactgg cctttggcat ctctctgcaa 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630452599 <220> <221> variation <222> (61) <223> n is A or G <400> 7 tgtaaagaga attaaacgat tagttatctt tcatttctct tgccttctgc atcttcctcc 60 ntcacctctt gtgtgacagt attcaatgtc atctgcattt gcagggctat cccttaaagc 120 t 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1180786 <220> <221> variation <222> (61) <223> n is A or G <400> 8 caaagctcct ccccaagaaa cagctggcgc tttctcagaa gacctcaatc aaaaaggctt 60 ntcttcaacc ttgcttgatc ttgcccaggg ccagaagcct ctctctgagg aggatctgcc 120 c 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P880291 <220> <221> variation <222> (61) <223> n is A or G <400> 9 ccacctccag gccactcgtg aagctacagc taggtttcag atttctggat tcaagatttg 60 nattttaaaa taacataaaa ttattgggtt ctaaaataay gatgagcatc aaaggctatg 120 a 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630454217 <220> <221> variation <222> (61) <223> n is A or G <400> 10 ccacctccag gccactcgtg aagctacagc taggtttcag atttctggat tcaagatttg 60 nattttaaaa taacataaaa ttattgggtt ctaaaataay gatgagcatc aaaggctatg 120 a 121 <210> 11 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P85249 <220> <221> variation <222> (61) <223> n is A or C <400> 11 tttccttctg tttcttgctg gtcctttggt gtaacaaact cttaccccac tctctgcacc 60 nccaatgccg agtacagtga ctggcaggat gcrggcttcc acaaatgtat gccacatcaa 120 t 121 <210> 12 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630361659 <220> <221> variation <222> (61) <223> n is A or G <400> 12 tcagggcatt ttgtccattt gctttgatcg tgagctggcc ctcgttcatt tgctgcttca 60 nagaaggttt aatgggagag tctcagtcac cctgatcctc tttacctgac aaattagggt 120 a 121 <210> 13 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630241963 <220> <221> variation <222> (61) <223> n is A or C <400> 13 gggaccgcgg cttgacccta acctatcata ttgttatacg gcgggacaag gagctgctcg 60 nggaatttgg gctctgcggt tgggggcctc ggtgcccttg ccaggctgcc ccccgcctgg 120 g 121 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P807794 <220> <221> variation <222> (61) <223> n is A or G <400> 14 atcmggttct tctgaatcca tcctaattta ccacctgtgt accctgatat atgaccctgt 60 nattatccca tttctgatgt ctttcccaca ctgcaatagc ttattggtct cctctttgac 120 t 121 <210> 15 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1167120 <220> <221> variation <222> (61) <223> n is A or G <400> 15 atttagtaag aatgtattgt acaatgcacc gaaaaggcag tttgggagcc gagagcactc 60 naacctgaac gtgggaagag gctcacggat atgtttgctg tgcagcagca tatttagtga 120 g 121 <210> 16 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630459410 <220> <221> variation <222> (61) <223> n is A or G <400> 16 atgcaaagat gagagattag acagatcggt gcaaggatgc aaagatgaga gatttcaaca 60 ncttttcagg aaatctttct ggactgatta gtttaagtgt ctgacatgga aaatatcaga 120 a 121 <210> 17 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P635007 <220> <221> variation <222> (61) <223> n is A or G <400> 17 acatagatga aagcaagatg cagagcaggc tatgaagatc ccagaaagcc agagatcagt 60 nctggagcta aggctagctg actctggaac tctcttcagt tctatgcagg cctcctgcag 120 a 121 <210> 18 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P108218_rs8591275 <220> <221> variation <222> (61) <223> n is A or G <400> 18 gaccaaggaa tgtaaaaaga gaataactgc agaagaaatg aatgcagtga tagaagagcg 60 ngatgctgct ttgtctcagg taactgcatg gatccgtaaa agcattttcc cccatttctt 120 t 121 <210> 19 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P366353 <220> <221> variation <222> (61) <223> n is A or G <400> 19 tgaataaagt gtcctagcac tttggattaa aaagacaagt accctctgtg aatgatatac 60 ncagatcttt acattcctcc tgaaatatct gtgtgagcag ggcaaataag ctatctattt 120 g 121 <210> 20 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P64084 <220> <221> variation <222> (61) <223> n is A or G <400> 20 tttccaattc cacaatcctt cacaatagaa ttaaaagtga agtgtgtggg cgggactcac 60 natcttgtca ttcaaatggt gaaaccaata tcaaattatt accttatggg gggaaaaaaa 120 g 121

Claims (6)

(a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP);
(b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP;
(f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP;
(l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP;
(n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및
(t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 당뇨 위험성 예측용 조성물.
(a) single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 1;
(b) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 2;
(c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3;
(d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4;
(e) a SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 5;
(f) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A or G;
(g) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A or G;
(h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8;
(i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9;
(j) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 10;
(k) a SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 11;
(l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12;
(m) SNP in which the 61st base is A or C in the polynucleotide represented by SEQ ID NO: 13;
(n) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 14;
(o) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 15;
(p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16;
(q) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 17;
(r) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 18;
(s) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 19; And
(t) SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 20 is A or G;
A composition for predicting the risk of diabetes in dogs, including an agent capable of detecting or amplifying.
 제1항에 있어서, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브인 것을 특징으로 하는, 개의 당뇨 위험성 예측용 조성물.
The composition for predicting diabetes risk of dogs according to claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
 제1항의 조성물을 포함하는 것을 특징으로 하는, 개의 당뇨 위험성 예측용 키트.
A kit for predicting the risk of diabetes in dogs, comprising the composition of claim 1.
 제1항의 조성물을 포함하는 것을 특징으로 하는, 개의 당뇨 위험성 예측용 마이크로어레이.
A microarray for predicting the risk of diabetes in dogs, characterized in that it comprises the composition of claim 1.
 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및
2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 당뇨 위험성 예측 방법.
1) amplifying a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1 to 20 from the DNA of a sample isolated from a dog or a region containing the SNP of a complementary polynucleotide thereof; And
2) A method for predicting the risk of diabetes in dogs comprising the step of determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP.
 제5항에 있어서,
서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 6로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C인 경우;
서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 및
서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
로 이루어진 그룹에서 선택되는 적어도 하나에 해당하면 당뇨 위험성이 높은 것으로 판단하는 방법.

The method of claim 5,
When the 61st base in the polynucleotide represented by SEQ ID NO: 1 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 2 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 3 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 4 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 5 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 6 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 8 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 9 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 11 is C;
When the 61st base in the polynucleotide represented by SEQ ID NO: 12 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 13 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 14 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 15 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 16 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 17 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A; And
When the 61st base in the polynucleotide represented by SEQ ID NO: 20 is G;
A method of determining that the risk of diabetes is high if it corresponds to at least one selected from the group consisting of.
KR1020190126471A 2019-10-11 2019-10-11 SNP marker for prediction of dog's diabetes risk and prediction method using the same KR102194880B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190126471A KR102194880B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's diabetes risk and prediction method using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190126471A KR102194880B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's diabetes risk and prediction method using the same

Publications (1)

Publication Number Publication Date
KR102194880B1 true KR102194880B1 (en) 2020-12-23

Family

ID=74088971

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190126471A KR102194880B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's diabetes risk and prediction method using the same

Country Status (1)

Country Link
KR (1) KR102194880B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017500022A (en) * 2013-11-25 2017-01-05 ヒルズ・ペット・ニュートリシャン・インコーポレーテッド Autoimmune symptoms in dogs and their diagnosis and treatment
KR20170056723A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's body weight and prediction method using the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017500022A (en) * 2013-11-25 2017-01-05 ヒルズ・ペット・ニュートリシャン・インコーポレーテッド Autoimmune symptoms in dogs and their diagnosis and treatment
KR20170056723A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's body weight and prediction method using the same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Animals (2020) 10(11):2071 *
Canine Genetics and Epidemiology (2014) 1:8* *
Journal of Heredity (2007) 98(5):518-525* *
Journal of Heredity (2019.10.07.) 110(7):793-800* *
The Veterinary Journal (2013) 195:139-147* *

Similar Documents

Publication Publication Date Title
EP2502994A1 (en) Primer set for amplification of mthfr gene, mthfr gene amplification reagent comprising same, and use of same
KR102124652B1 (en) Composition for early predicting or diagnosing anxiety disorder in dog
KR101450792B1 (en) Novel SNP marker for discriminating Black Coat Colour of Pig and use thereof
KR102194878B1 (en) Composition for early predicting or diagnosing mental stability in dog
US20090104612A1 (en) Detection of blood group genes
KR102124770B1 (en) Composition for early predicting or diagnosing hip dysplasia in dog
EP2584036B1 (en) Probes for identifying SULT1A1 gene polymorphisms, probe sets and reagents containing the same, and the uses thereof
KR102194880B1 (en) SNP marker for prediction of dog&#39;s diabetes risk and prediction method using the same
KR20200073407A (en) SNP Markers for discriminating quality of pig semen and their uses
KR102185440B1 (en) Composition for early predicting or diagnosing hypercholesterolemia in dog
KR102194881B1 (en) SNP marker for prediction of dog&#39;s obesity and prediction method using the same
KR102167792B1 (en) Composition for early predicting or diagnosing hypercalcemia in dog
KR102108737B1 (en) Composition for determining the color of a bovine including an agent capable of detecting or amplifying SNP
KR102470958B1 (en) Development of genetic markers for early prediction of weight of Jindo dogs
KR102470954B1 (en) Development of genetic markers for early prediction of body length of Jindo dogs
KR102470971B1 (en) Development of genetic markers for early prediction of body length vs. height ratio in Jindo dogs
KR102475364B1 (en) SNP marker for prediction of dog&#39;s environmental adaptability and prediction method using the same
KR102475362B1 (en) SNP marker for prediction of dog&#39;s activity and prediction method using the same
KR102194879B1 (en) SNP marker for prediction of dog&#39;s owner friendliness and prediction method using the same
KR102470966B1 (en) Development of genetic markers for early prediction of body height of Jindo dogs
KR102141607B1 (en) Composition for predicting or diagnosing progressive retinal atrophy in dog
KR101985659B1 (en) Method for identification of Baekwoo breed using single nucleotide polymorphism markers
JP2006254735A (en) Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes
KR102141604B1 (en) Composition for predicting or diagnosing luxating patella in dog
KR102182740B1 (en) Composition for identifying a bovine backfat thickness comprising an agent capable of detecting or amplifying a haplotype

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant