KR102167792B1 - Composition for early predicting or diagnosing hypercalcemia in dog - Google Patents

Abstract

The present invention relates to a composition for early prediction or diagnosis of hypercalcemia in a dog. In the present invention, 10 SNPs that can identify individuals at high risk of developing hypercalcemia in a dog are selected so as to confirm a risk of developing hypercalcemia according to the genotype. A composition for prediction or diagnosis of hypercalcemia in a dog using the genotype can be usefully used to prepare special management for a dog having a risk of developing general weakness, fatigue, depression, consciousness disorders, high blood pressure, arrhythmia, pancreatitis or ulcers that may be caused by hypercalcemia or to select an excellent dog without the risk of developing diseases such as general weakness, fatigue, depression, consciousness disorder, high blood pressure, arrhythmia, pancreatitis or ulcers that can be caused by hypercalcemia by predicting important genetic information when breeding for reproduction is being performed.

Description

Composition for early predicting or diagnosing hypercalcemia in dog}

The present invention relates to a composition for early prediction or diagnosis of hypercalcemia in dogs.

Calcium is one of the important minerals in our body for bone formation, hormone secretion, muscle contraction, nerve and brain function regulation, and when calcium concentration rises above the normal range, it affects these functions. Hypercalcemia is a relatively common metabolic complication that can be life-threatening in severe cases, and refers to a blood calcium concentration of 10.5 mg/dL or higher or an ionized calcium of 4.2 mg/dL or higher.

Hypercalcemia can be broadly divided into parathyroid dependence and non-dependence. Parathyroid dependent hypercalcemia includes primary hyperparathyroidism, familial hypocalciuria hypercalcemia, and lithium poisoning. Independent hypercalcemia of the parathyroid gland includes hypercalcemia caused by malignant tumors, vitamin D poisoning, sarcoidosis (systemic inflammation of unknown cause), hyperthyroidism, vitamin A poisoning, side kidney (adrenal) function decline, thiazide, milk alkali syndrome. , Immobility, and kidney failure.

Among them, familial hypocalciuria hypercalcemia is caused by mutations in the calcium-sensing receptor gene of the parathyroid gland, kidneys, and other organs among families, and exhibits an autosomal dominant inheritance pattern.

Hypercalcemia can occur in dogs as well as humans (Can Vet J. 2006 Aug; 47(8): 819-821.). The clinical symptoms of hypercalcemia are non-specific and are similar to those of many diseases. Mild hypercalcemia is asymptomatic, but sensitive individuals complain of nausea, dehydration, polyuria, constipation, and loss of appetite. When the concentration of serum calcium increases by 12.0mg/㎗ or more, symptoms such as general weakness, fatigue, depression, consciousness disorder, high blood pressure, arrhythmia, pancreatitis or ulcers appear, and an increase of 15mg/㎗ or more can lead to loss of consciousness.

On the other hand, DNA testing for genetic diseases provides important information for early identification of key risk variants. Genetic diseases in dogs for which DNA tests are currently being used include dwarf development, degenerative retinal atrophy, epilepsy and malignant fever, and are continuously developed through molecular biological techniques.

In addition, a single nucleotide polymorphism for predicting the weight of a dog (Korean Patent No. 10-1816608), eating ability (Korean Patent No. 10-1823355), and tail shape (Korean Patent No. 10-1960427) has been disclosed, but to date No single polymorphism predicting hypercalcemia in dogs has been disclosed.

Therefore, the present inventors extracted DNA from the blood of 50 dogs, analyzed the SNP genotype using a 170K SNP chip for dogs, and analyzed the risk of hypercalcemia in dogs through a genome-wide association study (GWAS). The present invention was completed by selecting 10 SNPs that can be predicted early.

An object of the present invention is to provide a composition for predicting or diagnosing hypercalcemia in dogs, a kit for predicting or diagnosing hypercalcemia in dogs, or a method for predicting or diagnosing hypercalcemia in dogs using the same.

In order to achieve the above object, the present invention provides a single nucleotide polymorphism (SNP) in which the 61st base is A or C in the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And a SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10. It provides a composition for predicting or diagnosing hypercalcemia in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

In addition, the present invention provides a kit for predicting or diagnosing hypercalcemia in dogs comprising the composition.

In addition, the present invention relates to 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from dogs. , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, and sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or complementary Amplifying a portion of the polynucleotide containing the SNP,

The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of number 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 The step, which is base 61 of the polynucleotide consisting of the nucleotide sequence of; And

2) It provides a method for predicting or diagnosing hypercalcemia in dogs, comprising the step of determining a base type of SNP at a site containing the amplified SNP.

The present invention is to check the risk of hypercalcemia according to the genotype by selecting 10 SNPs capable of discriminating individuals with high risk of hypercalcemia in dogs, and the composition for predicting or diagnosing hypercalcemia in dogs using the same Preparing for special care for dogs at risk of general weakness, fatigue, depression, consciousness disorders, high blood pressure, arrhythmia, pancreatitis or ulcers that may occur, or predicting important genetic information when breeding for breeding to prevent hypercalcemia. It can be usefully used to select excellent dogs that do not have the risk of developing diseases such as systemic weakness, fatigue, depression, consciousness disorders, high blood pressure, arrhythmia, pancreatitis or ulcers.

Hereinafter, the present invention will be described in detail.

The present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or C in the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And a SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10. It provides a composition for predicting or diagnosing hypercalcemia in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

The agent capable of detecting or amplifying the SNP may be a primer or a probe, and specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide including a site containing the SNP, or a It may be a primer capable of specifically amplifying a complementary polynucleotide.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit the effect of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe, etc. may be produced.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. Such a probe can be modified using a number of means known in the art as long as it exhibits an effect of detecting a site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent.

The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine can be any one or more selected from the group consisting of However, any other known material that can be used as a reporter in the art can be used.

The probe may be further conjugated with a quencher to its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other known material that can be used as a quencher in the art may be used.

Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. Polymerases can be isolated from the bacteria themselves, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

In addition, the present invention provides a kit for predicting or diagnosing hypercalcemia in dogs, including the composition for predicting or diagnosing hypercalcemia in dogs.

The composition may have the characteristics as described above. In one example, the composition comprises a single nucleotide polymorphism (SNP) in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10.

In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically a probe capable of specifically binding to a site containing the SNP, a polynucleotide comprising a site containing the SNP Alternatively, it may be a primer capable of specifically amplifying its complementary polynucleotide.

The kit may be a PCR kit or a DNA analysis kit, but is not limited thereto.

The kit of the present invention can predict or diagnose hip dislocation of a dog by confirming the genotype of the SNP marker provided by the present invention through amplification using the above composition or by confirming the expression level of mRNA. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, the RT-PCR kit includes a tube or other suitable container, reaction buffer (pH and magnesium concentration varying) in addition to a primer pair specific for a polynucleotide containing the SNP-containing site or a complementary polynucleotide thereof. , Deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water, and sterile water. Meanwhile, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to prepare such a dried form, a drying step is required, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a combination thereof may be used.

In addition, the present invention relates to 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from dogs. , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, and sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or complementary Amplifying a portion of the polynucleotide containing the SNP,

The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of number 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 The step, which is base 61 of the polynucleotide consisting of the nucleotide sequence of; And

2) It provides a method for predicting or diagnosing hypercalcemia in dogs, comprising the step of determining a base type of SNP at a site containing the amplified SNP.

The step of amplifying the site containing the SNP of step 1) may be performed by any method known to those skilled in the art. For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), self-maintaining sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA) can be used.

The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) includes sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele hybridization techniques. (dynamic allelespecific hybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assay), etc. May be, but is not limited thereto.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 or its complementary polynucleotide, is all C. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide composed of the base sequence of column number 2 or the complementary polynucleotide thereof, is all A. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 or its complementary polynucleotide, is all G. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or its complementary polynucleotide, is all G. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 or its complementary polynucleotide, is all C. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 or its complementary polynucleotide, is all G. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or its complementary polynucleotide, is all A. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 or the complementary polynucleotide thereof, is all G. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or its complementary polynucleotide, is all G. can do.

In the method for predicting or diagnosing hypercalcemia in dogs, it is determined that the risk of hypercalcemia in dogs is increased when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 or its complementary polynucleotide, is all G. can do.

In a specific embodiment of the present invention, the present inventors extract DNA from the blood of 50 dogs, then analyze the SNP genotype using a 170K SNP chip for dogs, and analyze the full-length genome association (Genome-wide association study, GWAS). Through this, 10 SNPs capable of early predicting the risk of hypercalcemia in dogs were selected (see Tables 1 to 5).

Therefore, the composition for predicting or diagnosing hypercalcemia in dogs according to the present invention, a kit for diagnosing hypercalcemia in dogs including the same, or a method for predicting or diagnosing hypercalcemia in dogs using the same, systemic weakness, fatigue, depression, consciousness disorders that may occur due to hypercalcemia Preparing for special care for dogs at risk of hypertension, arrhythmia, pancreatitis or ulcers, or predicting important genetic information when breeding for breeding, systemic weakness, fatigue, depression, and consciousness that may be caused by hypercalcemia It can be usefully used to select excellent dogs who do not have the risk of developing diseases such as disorders, high blood pressure, arrhythmia, pancreatitis or ulcers.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following examples and experimental examples are only illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<Example 1> SNP genotyping analysis of dogs

DNA was extracted from the blood of 50 dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then SNP genotype was analyzed using 170K SNP chip (CanineHD BeadChip, Illumina, USA) for dogs. I did.

<1-1> Day 1: Amplification

Add 20 µl of MA1 per well to a 96-well 0.8 ml MIDI plate (hereinafter referred to as'MSA3 plate') with MSA3 barcodes, and 4 µl of each DNA extracted from the blood of 50 dogs per well, and then DNA ID and The location of the transferred MSA3 plate was recorded. Thereafter, 4 µl of 0.1 N NaOH was added to each well, and after covering the plate with a 96-well cover (96 well cap mat), shake it at 1,600 rpm for 1 minute (vortexing), and centrifuge at 280 × g for 1 minute. I did. Thereafter, after reacting at room temperature for 10 minutes, 34 µl of MA2 was added per well, 38 µl of MSM was added, and then the 96-well cover was covered and centrifuged at 280 × g for 1 minute. Samples were amplified by reacting for 20 to 24 hours in a 37°C oven (Illumina Hybridization oven).

<1-2> Day 2: Fragment

The MSA3 plate of Example 1-1 was taken out of the oven and centrifuged at 50 × g for 1 minute, and 25 μl of FMS was added to each well, and then the plate was covered with a cover and shaken at 1,600 rpm for 1 minute (vortexing). . Thereafter, the plate was centrifuged at 50 × g for 1 minute, and reacted in a 37° C. heat block for 1 hour.

<1-3> Day 2: Precipitation

After adding 25 µl of PM1 per well to the plate of Example 1-2, the cover was covered, centrifuged at 1,600 rpm for 1 minute, and reacted in an oven at 37° C. for 5 minutes. After centrifuging the plate at 50 × g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, inverted 10 times, mixed, and stored at 4° C. for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and quickly turned over to discard the supernatant. The remaining supernatant was removed by tapping lightly on a kitchen towel about 10 times, and the inverted plate was placed on a tube rack and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> Day 2: Resuspend

23 µl of RA1 per well was added to the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for later staining (XStain HD Bead Chip). A foil seal was put on the plate, and a heat-sealer block was pressed for 5 seconds to seal. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken at 1,800 rpm for 1 minute and mixed (vortexing), followed by centrifugation at 280 × g for 1 minute.

<1-5> Day 2: Hybridization

The plate of Example 1-4 was placed in a 95° C. heat block to denature the DNA sample for 20 minutes (denaturation). Then, leave the plate at room temperature for 30 minutes and insert gaskets into the hybridization chamber (HybChamber) while cooling, add 400 μl of PB2 to each of the eight humidifying buffer reservoirs in the hybridization chamber, and remove the lid. Closed and placed at room temperature. MSA3 plate containing DNA cooled at room temperature was centrifuged at 280 × g for 1 minute. Take out and prepare refrigerated SNP chips one by one, align the barcode shape of the hybridization chamber insert with the barcode part of the chip, and then load the DNA sample cooled with a multi-channel pipette into both parts of the chip by 15 µl each. ). As soon as the sample loading of each chip was finished, it was placed in the hybridization chamber and the next chip was repeated in the same manner. When the chamber was all filled, the chamber lid was closed, placed in an oven at 48° C., and the rate was set to 5 to react for 16 to 24 hours.

<1-6> Day 3: Washing bead chips

The hybridization chamber of Example 1-5 was taken out of the oven, the inserts in the chamber were taken out one by one, and the seal attached to the chip was pulled to remove it, and then the chip from which the seal was removed was inserted into a wash rack, and WB1 It was immersed in a wash dish. After all the chips were immersed in WB1, the washing rack was removed from the dish for 1 minute and washed, and the rack was moved to another washing dish containing PB1, and the rack was removed and placed for 1 minute. After washing, place the back frame on the Multi-sample BeadChips Alignment fixture, put the chip one by one according to the barcode direction, and then align the space of the transparent part separated from the white part. It was fitted to the top and bottom of the. After raising the space, an alignment bar was placed on the upper part of the chip without the barcode, the glass plate was covered so that the end of the glass plate touched the bar, and the flow-through chamber assembly was completed by inserting a clip. The alignment bar was removed, and spaces at both ends of the chamber assembly were cut with scissors.

<1-7> Day 3: Dyeing (XStain Beadchips)

After adjusting the temperature of the chamber rack to 44° C., the chamber assembly of Example 1-6 was fitted to the chamber rack. 150 µl of RA1 was added to each chip and the reaction for 30 seconds was repeated 6 times, and then 450 µl of XC1, 450 µl of XC2, and 200 µl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 µl of 95% formamide/1mM ethylenediaminetetraacetic acid (EDTA) was added to each chip and reacted for 1 minute, and then the same was added again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, put 450 µl of XC3 into each chip and react for 1 minute, then put it the same again and put the set temperature of the chamber rack Waited until it reached. Thereafter, reagents were added to each chip in the order of A-B-A-B-A in Table 1 and reacted.

set order Reagents for each chip Reaction time after adding reagent A One 250 μl LTM 10 minutes 2 450 μl of XC3 1 min 3 450 μl of XC3 5 minutes B One 250 μl of ATM 10 minutes 2 450 μl of XC3 1 min 3 450 μl of XC3 5 minutes

Immediately after completion of the reaction, the chamber rack was removed from the chamber assembly, transferred to a room temperature experiment table, and placed flat. 310 ml of PB1 was put in a washing container, and the rack for dyeing was immersed in the container. After removing the clip of the chamber rack using a tool, lifting the glass block and removing it, the space was removed while not touching the bead portion of the chip. After removing all the attachments attached to the chip, it was placed in a staining rack contained in PB1 and immersed in PB1. All chips were sequentially treated in the same manner as above. The dyeing rack was slowly moved up and down about 10 times to quench the chips, and then soaked for 5 minutes. Then, 310 ml of XC4 was filled in another container for washing, and the chips were quenched in the same manner as above, and then soaked for 5 minutes. Thereafter, the dyeing rack was taken out, and the chips were carefully removed using forceps and placed on the tube rack. The tube rack on which the chips were loaded was placed in a vacuum dryer and dried for 55 minutes in a vacuum of 508 mmHg (0.68 bar). Using a tissue soaked in ethanol (KIMWIPES), the edge of the dried chip was wiped while being careful not to touch the bead. The bead chip after the experiment was completed was imaged using a scanner within 72 hours.

<Experimental Example 1> Selection of 10 SNPs capable of early predicting the risk of hypercalcemia in dogs

A high-density SNP 170K chip analysis and a genome-wide association study (GWAS) were performed for 50 dogs.

Specifically, by analyzing the image obtained in Example 1, the genotype of 50 dogs was analyzed. Thereafter, for quality control (QC) of full-length genotype data and database construction, the SNP was filtered to test Hardy-Weinberg equilibrium (HWE) and the R/SNPassoc package for minor allele frequency (MAF). A chi-square test was performed to exclude genes unsuitable for the condition (HWE p <0.001, MAF <0.001).

Blood was collected from 50 dogs, and the age, sex, and breed of dogs were recorded using a blood calcium analyzer (Catalyst Dx® Chemistry Analyzer; IDEXX BioResearch) for dogs, and blood calcium levels were measured. A normal dog's blood calcium level is 7.9 to 12.0mg/㎗, and if the blood calcium level is 12.0mg/㎗ or more, it is usually diagnosed as high in blood calcium at veterinary hospitals (http://animal.ndsl.kr/renew/sub_db_list01_view.php ?num=87).

Thereafter, the risk of the blood calcium level of the 50 dogs was scored by the following general formula 1 to calculate the phenotypic value of the blood calcium level for each genotype. The degree of correlation between the risk of calcium levels in blood according to the genotype analyzed from the SNP chip is calculated through full-length genetic correlation analysis, and the relationship between the risk of calcium levels in the blood and each SNP marker using the R-statistics package for single marker regression Significant SNPs were searched by analyzing the additive effect.

[General Formula 1]

y = μ + Sex _i + SNP _j + e _ij

(In the general formula 1, y is the level of calcium in the blood, μ is the overall mean, Sex _i is the genotypic effect (i = female, male and neutralized male), SNP _j is the genotypic effect (j = AA, AB, BB), e _{ij is a} random error, N~(0, σ ² _e ))

For the false positive, which is a problem of multiple testing, such as the genome wide association test, 10,000 permutation tests were performed and the genome-wise P- The value was calculated.

As a result, 10 SNPs that can predict the risk of blood calcium levels in dogs early were selected, the mean and standard deviation (SD) of each selected phenotype value were calculated, and each standard deviation was divided by the square of the number of genotypes. Standard error (SE) was calculated (Tables 2 to 5). The higher the average value for each phenotype, the higher the blood calcium level.

<Statistical analysis of 10 SNPs that can predict the risk of blood calcium levels in dogs early (1)> number SNP name chromosome bp (location) A1 A2 Gene frequency One BICF2P106457 28 38778959 A C 0.47 2 BICF2P1339748 28 35278015 A G 0.36 3 BICF2G630264876 28 37694332 A G 0.49 4 BICF2G630652768 21 19402654 A G 0.38 5 BICF2P514889 28 36527700 C A 0.50 6 BICF2G630254666 19 51719005 G A 0.44 7 BICF2G630254665 19 51719273 A G 0.44 8 BICF2S23040239 33 23842648 G A 0.22 9 BICF2P560100 28 37708544 A G 0.47 10 BICF2G630255194 19 51187796 G A 0.46

<Statistical analysis of 10 SNPs that can predict early risk of blood calcium levels in dogs (2)> number SNP name Beta statistics Standard error (SE) P (probability value) One BICF2P106457 -0.58706 0.19135 0.00216 2 BICF2P1339748 0.70697 0.24507 0.00392 3 BICF2G630264876 -0.56879 0.20624 0.00582 4 BICF2G630652768 -0.52702 0.19211 0.00608 5 BICF2P514889 0.56647 0.20770 0.00638 6 BICF2G630254666 0.50497 0.18819 0.00729 7 BICF2G630254665 0.50497 0.18819 0.00729 8 BICF2S23040239 0.646109 0.242857 0.0078 9 BICF2P560100 -0.528992 0.198845 0.00781 10 BICF2G630255194 0.50092 0.18847 0.00786

Sequence number SNP name chromosome Base sequence variation region Blood calcium level risk genotype One BICF2P106457 28 ATGAAGGTTCTAGCTCTCGCTCCCCAACAGCAAAAGAGAGCAGAACGAAGCAGGGTGCTT [A/C] AAGAACTTGAGACCCTGTAAACAAGTTGGGAGCCTTAAAGATTTCATGCCAACTTTGATC C 2 BICF2P1339748 28 GCTATTTCCTCTGCTTAAAGCAGTGATTCCACTCTTCGTGGAATGAGGAACAGATAAACC [A/G] GCCTCTGCAGCAGAGATTTCTCTACCTTTGCTTGACCCCCCAAAACTCACCTCCTCAAAA A 3 BICF2G630264876 28 AGTTGGTTATTGAAGCATTGCTATAATCTACTGTCTTTATCTTTTGCCGGATTTTTAAAG [A/G] GGTATTTTATTGCCTGTCATTACTGTTCACAGTAGCTTCTGGGCACTGTCATTCCACCAG G 4 BICF2G630652768 21 TATTCCCTTGAAGTAAACTATTCACCCATGTGTGGTAAACAGAACCAAAGCAGCTGCTTC [A/G] GGGTGAGCCAACAGTACCATTTATTCACCATCAGGTTCCCTAGGATTCTGTAGGTAGCAA G 5 BICF2P514889 28 CCCGCTTGCCTGTGGATGTGACCTCCGCTGAGCGTGGTTCAGGGTGGCACGAACCCACGC [A/C] GAGATGAGAGGAGGTACAATTGTTCSCCCAGACCCGTGCTCAGCATCTCGTGAGCACTCC C 6 BICF2G630254666 19 AGTTGTGGGATCTTTCCAGTTATTTCCTCCTTCTCATTTCCCTCCCCTTTTGTAATATGT [A/G] GACGATTTCATTTACAGGGCTGCCTAGGAAAGATCAGTCATGAAATGATTGTGGTTGTTG G 7 BICF2G630254665 19 AAGAAATGTGAAAGGGGTATCTCTCTCTTCAGTCCAAGAACCAGTGAAAGTTAACATG [A/G] TAGAAGGGATCCAAAGYTAATACTCACTTCAATATAAACTACAAACCTGTCACGTTCTCA A 8 BICF2S23040239 33 ACCTGCAGCACGTGGCCAGATGCAAGAACAGTTTCATTCCCACTTAAAAACAGGATTTTG [A/G] TTGCAGCTGCTACAGTCAGATATAATGTGTACCTGATCCCTATTCTGCTCTAAAATTCTA G 9 BICF2P560100 28 AGCCTGATGGTGGCATCAGCCAGGGACAGTGAGTGGTAAATAGGCAGCTTTGGATTGGAA [A/G] CTGCCATTCCAGTGGGAAACGTGGTGGGAGCACTGAACAAATGGAACATTTGTGAAGTGA G 10 BICF2G630255194 19 CTTATTTTCAGATGCAACTATGGAGGAAAAAATAAGCTTCTTATTTACAAAAGGATGAAA [A/G] TAAATCACTTTGTTTTCTTGATGGCCAGTTGTGTGGTTAAGCAGAAAAGCTATGTTATTA G

<Mean and standard error values for each genotype associated with the risk of blood calcium levels in dogs> Sequence number SNP name chromosome Item Genotype-1 Genotype-2 Genotype-3 One BICF2P106457 28 Variation (number of individuals) AA(10) AC(27) CC(13) Average 7.55 8.26 8.66 Standard error 0.46 0.15 0.19 2 BICF2P1339748 28 Variation (number of individuals) AA(2) AG(32) GG(16) Average 9.05 8.33 7.91 Standard error 0.45 0.15 0.30 3 BICF2G630264876 28 Variation (number of individuals) AA(10) AG(29) GG(11) Average 7.68 8.31 8.47 Standard error 0.42 0.16 0.27 4 BICF2G630652768 21 Variation (number of individuals) AA(7) AG(24) GG(19) Average 7.56 8.15 8.56 Standard error 0.59 0.19 0.15 5 BICF2P514889 28 Variation (number of individuals) AA(10) AC(30) CC(10) Average 7.60 8.29 8.64 Standard error 0.40 0.16 0.28 6 BICF2G630254666 19 Variation (number of individuals) AA(15) AG(26) GG(9) Average 7.71 8.28 8.90 Standard error 0.33 0.14 0.26 7 BICF2G630254665 19 Variation (number of individuals) AA(9) AG(26) GG(15) Average 8.90 8.28 7.71 Standard error 0.26 0.14 0.33 8 BICF2S23040239 33 Variation (number of individuals) AA(29) AG(20) GG(0) Average 8.01 8.47 9.50 Standard error 0.20 0.16 0.00 9 BICF2P560100 28 Variation (number of individuals) AA(14) AG(26) GG(10) Average 7.68 8.29 8.50 Standard error 0.42 0.17 0.23 10 BICF2G630255194 19 Variation (number of individuals) AA(10) AG(27) GG(13) Average 7.68 8.25 8.90 Standard error 0.35 0.13 0.23

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for early predicting or diagnosing hypercalcemia in dog <130> 2019P-09-008 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P106457 <220> <221> variation <222> (61) <223> n is A or C <400> 1 atgaaggttc tagctctcgc tccccaacag caaaagagag cagaacgaag cagggtgctt 60 naagaacttg agaccctgta aacaagttgg gagccttaaa gatttcatgc caactttgat 120 c 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1339748 <220> <221> variation <222> (61) <223> n is A or G <400> 2 gctatttcct ctgcttaaag cagtgattcc actcttcgtg gaatgaggaa cagataaacc 60 ngcctctgca gcagagattt ctctaccttt gcttgacccc ccaaaactca cctcctcaaa 120 a 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630264876 <220> <221> variation <222> (61) <223> n is A or G <400> 3 agttggttat tgaagcattg ctataatcta ctgtctttat cttttgccgg atttttaaag 60 nggtatttta ttgcctgtca ttactgttca cagtagcttc tgggcactgt cattccacca 120 g 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630652768 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tattcccttg aagtaaacta ttcacccatg tgtggtaaac agaaccaaag cagctgcttc 60 ngggtgagcc aacagtacca tttattcacc atcaggttcc ctaggattct gtaggtagca 120 a 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P514889 <220> <221> variation <222> (61) <223> n is A or C <400> 5 cccgcttgcc tgtggatgtg acctccgctg agcgtggttc agggtggcac gaacccacgc 60 ngagatgaga ggaggtacaa ttgttcsccc agacccgtgc tcagcatctc gtgagcactc 120 c 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630254666 <220> <221> variation <222> (61) <223> n is A or G <400> 6 agttgtggga tctttccagt tatttcctcc ttctcatttc cctccccttt tgtaatatgt 60 ngacgatttc atttacaggg ctgcctagga aagatcagtc atgaaatgat tgtggttgtt 120 g 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630254665 <220> <221> variation <222> (61) <223> n is A or G <400> 7 aagaaatgtg aaaggggtat ctctctctct tcagtccaag aaccagtgaa agttaacatg 60 ntagaaggga tccaaagyta atactcactt caatataaac tacaaacctg tcacgttctc 120 a 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23040239 <220> <221> variation <222> (61) <223> n is A or G <400> 8 acctgcagca cgtggccaga tgcaagaaca gtttcattcc cacttaaaaa caggattttg 60 nttgcagctg ctacagtcag atataatgtg tacctgatcc ctattctgct ctaaaattct 120 a 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P560100 <220> <221> variation <222> (61) <223> n is A or G <400> 9 agcctgatgg tggcatcagc cagggacagt gagtggtaaa taggcagctt tggattggaa 60 nctgccattc cagtgggaaa cgtggtggga gcactgaaca aatggaacat ttgtgaagtg 120 a 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630255194 <220> <221> variation <222> (61) <223> n is A or G <400> 10 cttattttca gatgcaacta tggaggaaaa aataagcttc ttatttacaa aaggatgaaa 60 ntaaatcact ttgttttctt gatggccagt tgtgtggtta agcagaaaag ctatgttatt 120 a 121

Claims (14)

Single nucleotide polymorphism (SNP) in which the 61st base is A or C in the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10;
A composition for predicting or diagnosing hypercalcemia in dogs, including an agent capable of detecting or amplifying.
The composition for predicting or diagnosing hypercalcemia of a dog according to claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
A kit for predicting or diagnosing hypercalcemia in dogs, comprising the composition of claim 1.
1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and Polynucleotide consisting of nucleotide sequence, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 6, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 7, nucleotide sequence of SEQ ID NO: 8 As a step of amplifying a site including a SNP of a polynucleotide consisting of, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 10 or a complementary polynucleotide thereof,
The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and SEQ ID NO: 10 The step, which is the 61st base of the polynucleotide consisting of the nucleotide sequence of; And
2) A method for predicting or diagnosing hypercalcemia in dogs, comprising the step of determining a base type of SNP at the site containing the amplified SNP.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is all C, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is all A, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is all C, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The method of claim 4, wherein when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, are all A, or when a base complementary to the genotype is identified at a corresponding position of a complementary polynucleotide thereof , To determine that the risk of hypercalcemia in dogs is increased.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercalcemia in dogs is increased.