KR102194881B1 - SNP marker for prediction of dog's obesity and prediction method using the same - Google Patents

SNP marker for prediction of dog's obesity and prediction method using the same Download PDF

Info

Publication number
KR102194881B1
KR102194881B1 KR1020190126479A KR20190126479A KR102194881B1 KR 102194881 B1 KR102194881 B1 KR 102194881B1 KR 1020190126479 A KR1020190126479 A KR 1020190126479A KR 20190126479 A KR20190126479 A KR 20190126479A KR 102194881 B1 KR102194881 B1 KR 102194881B1
Authority
KR
South Korea
Prior art keywords
seq
base
snp
polynucleotide represented
obesity
Prior art date
Application number
KR1020190126479A
Other languages
Korean (ko)
Inventor
최봉환
박종은
박원철
차지혜
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020190126479A priority Critical patent/KR102194881B1/en
Application granted granted Critical
Publication of KR102194881B1 publication Critical patent/KR102194881B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is to check the degree of obesity according to a genotype by selecting 20 SNPs capable of discriminating individuals with high risk of obesity in dogs, wherein a SNP composition for predicting the risk of obesity in dogs using the same can be usefully used for preparing special management for dogs having risk of obesity, or selecting excellent dogs which do not have the risk of developing diseases which can be caused by obesity by predicting important genetic information during crossbreeding for propagation.

Description

개의 비만 위험성 예측용 SNP 마커 및 이를 이용한 예측 방법{SNP marker for prediction of dog's obesity and prediction method using the same}SNP marker for prediction of dog's obesity and prediction method using the same}

본 발명은 개의 비만 위험성 예측용 SNP 마커 및 이를 이용한 예측 방법에 관한 것이다.The present invention relates to a SNP marker for predicting the risk of obesity in dogs and a prediction method using the same.

일반적으로 비만(obesity)은 에너지 섭취량과 소비량의 불균형으로 체내에 지방이 과도하게 축적되어 건강에 부정적인 영향을 초래하는 상태로 정의하고 있다. 체중을 기준으로 정량적으로 평가하는 경우 해당 품종의 이상적인 체중에 비하여 30%를 초과하는 경우를 비만, 15% 이상을 과체중(overweight)으로 분류한다. 경제수준이 향상되면서 반려견의 식습관과 생활 및 운동행태, 거주환경 등이 변화됨에 따라 선진국에서는 반려견의 비만을 주요 건강문제로 다루어왔다. 미국, 영국, 프랑스, 호주 등에서 수행된 연구에 의하면 과체중을 포함한 비만의 유병률(prevalence)은 국가별로 상당한 차이를 보이고 있다. In general, obesity is defined as a condition that causes negative health effects due to excessive accumulation of fat in the body due to an imbalance between energy intake and consumption. In the case of quantitative evaluation based on body weight, those exceeding 30% of the ideal weight of the breed are classified as obesity, and 15% or more are classified as overweight. As the economic level has improved, dogs' eating habits, lifestyle and exercise behaviors, and living conditions have changed, and developed countries have treated dog obesity as a major health problem. Studies conducted in the United States, the United Kingdom, France, and Australia have shown that the prevalence of obesity including overweight varies considerably from country to country.

개에서 비만과 관련된 위험요인은 품종(유전적 소인), 연령, 성, 중성화, 내분비 질병 기왕력, 운동부족, 식습관 등과 관련이 있으며. 특히 중성화한 암컷에서 비만의 유병률이 상대적으로 높고, 연령이 증가할수록 유병률도 증가하는 경향이 있다. 비만은 사람과 유사하게 개에서도 당뇨병, 근골격계질환, 심혈관계질환, 수명단축 등 다양한 건강장애와 연관성이 높기 때문에 개의 비만은 만성질환 문제로 인식하고 있다. Risk factors associated with obesity in dogs are related to breed (genetic predisposition), age, sex, neuterization, history of endocrine diseases, lack of exercise, and diet. In particular, the prevalence of obesity is relatively high in neutralized females, and the prevalence tends to increase with age. Similar to humans, obesity is highly associated with various health disorders such as diabetes, musculoskeletal disorders, cardiovascular disease, and shortening of lifespan, so dogs are recognized as a chronic disease problem.

개의 비만을 분류하는 명확한 기준은 없지만 체내 지방과 근육의 양을 주관적이고 반정량적(semi-quantitative)으로 평가하는 지표인 신체점수(BCS)를 국제적으로 사용하고 있으며, 다양한 축종에 대한 BCS 프로토콜이 개발되어 있다. 비만의 판단기준과 관련하여 연구자별로 서로 다른 기준을 적용하거나 일부 국가에서는 새로운 기준을 개발하여 사용하는 등 BCS의 임상적 유용성이 다소 제한되는 단점도 있으나 반려동물 영양 상태의 적절성을 평가하는 수단으로는 여전히 유용하게 사용하고 있다(Holmes KL, Morris PJ, Abdulla Z, Hackett R, Rawlings JM. Risk factors associated with excess body weight in dogs in the UK. J Anim Physiol Anim Nutr 2007; 91: 166-167.).Although there is no clear standard for classifying obesity in dogs, the body score (BCS), an index that evaluates the amount of fat and muscle in the body subjectively and semi-quantitative, is internationally used, and BCS protocols for various breeds have been developed. Has been. Regarding the criteria for determining obesity, there are drawbacks that the clinical usefulness of BCS is somewhat limited, such as applying different criteria for each researcher or developing and using new criteria in some countries, but as a means to evaluate the appropriateness of the nutritional status of companion animals. Still useful (Holmes KL, Morris PJ, Abdulla Z, Hackett R, Rawlings JM. Risk factors associated with excess body weight in dogs in the UK. J Anim Physiol Anim Nutr 2007; 91: 166-167.).

한편, 유전 질환에 대한 DNA 시험은 주요 위험 변이체를 조기에 확인하는데 중요한 정보를 제공해준다. 현재 DNA 시험이 활용되고 있는 개의 유전질환으로는 왜소발육증, 퇴행성 망막위축증, 간질 및 악성 발열 등이 있으며, 분자생물학적 기법을 통해 지속적으로 개발되고 있다.On the other hand, DNA testing for genetic diseases provides important information for early identification of key risk variants. Genetic diseases in dogs for which DNA tests are currently being used include dwarf development, degenerative retinal atrophy, epilepsy and malignant fever, and are continuously developed through molecular biological techniques.

이에, 본 발명자들은 개 150두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 비만 위험성을 조기 예측 가능한 SNP 20개를 선별하여 본 발명을 완성하였다.Accordingly, the present inventors extracted DNA from the blood of 150 dogs, analyzed the SNP genotype using a 170K SNP chip for dogs, and analyzed the risk of obesity in dogs through a genome-wide association study (GWAS). The present invention was completed by selecting 20 early predictable SNPs.

본 발명의 목적은 개의 비만 위험성 예측용 SNP 조성물, 이를 검출 또는 증폭할 수 있는 제제를 포함하는 조성물, 상기 조성물을 포함하는 개의 비만 위험성 예측용 키트 및 개의 비만 위험성 예측 방법을 제공하는 것이다. It is an object of the present invention to provide a SNP composition for predicting the risk of obesity in dogs, a composition comprising an agent capable of detecting or amplifying the same, a kit for predicting the risk of obesity in a dog comprising the composition, and a method for predicting the risk of obesity in dogs.

상기 목적을 달성하기 위하여, 본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T 또는 A인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 비만 위험성 예측용 조성물을 제공한다. In order to achieve the above object, the present invention provides (a) single nucleotide polymorphism (SNP) in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 1; (b) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) SNP in which the 61st base is A or T in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 6; (g) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 7; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 11; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 18; (s) a SNP in which the 61st base is T or A in the polynucleotide represented by SEQ ID NO: 19; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It provides a composition for predicting the risk of obesity in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

또한, 본 발명은 상기 조성물을 포함하는 개의 비만 위험성 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting the risk of obesity in dogs comprising the composition.

또한, 본 발명은 상기 조성물을 포함하는 개의 비만 위험성 예측용 마이크로어레이를 제공한다.In addition, the present invention provides a microarray for predicting the risk of obesity in dogs comprising the composition.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및 2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 비만 위험성 예측 방법을 제공한다.In addition, the present invention includes 1) any one or more polynucleotides selected from the group consisting of polynucleotides consisting of nucleotide sequences of SEQ ID NOs: 1 to 20 from DNA of a sample isolated from dogs, or SNPs of complementary polynucleotides thereof. Amplifying the desired region; And 2) it provides a method for predicting the risk of obesity in dogs comprising the step of determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP.

본 발명은 개에서 비만 위험성이 높은 개체를 판별할 수 있는 SNP 20개를 선별하여 해당 유전자형에 따른 비만 위험도를 확인한 것인 바, 이를 이용한 개의 비만도 예측용 SNP 조성물은 비만의 위험성을 갖는 개에 대한 특별한 관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 비만에 의해 발생할 수 있는 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.The present invention is to check the obesity risk according to the genotype by selecting 20 SNPs capable of discriminating individuals with high risk of obesity in dogs, the SNP composition for predicting obesity in dogs using this It can be usefully used to select excellent dogs that do not have the risk of developing diseases that may be caused by obesity by predicting important genetic information when preparing for special management or breeding for breeding.

도 1은 반려견 비만도를 측정하기 위해 5단계 설정 기준의 반려견 체형을 나타낸 도이다. 1 is a diagram showing a dog's body shape based on a five-step setting standard to measure the dog's obesity.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T 또는 A인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 비만 위험성 예측용 조성물을 제공한다. The present invention includes (a) a single nucleotide polymorphism (SNP) in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 1; (b) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) SNP in which the 61st base is A or T in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 6; (g) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 7; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 11; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 18; (s) a SNP in which the 61st base is T or A in the polynucleotide represented by SEQ ID NO: 19; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It provides a composition for predicting the risk of obesity in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.The agent capable of detecting or amplifying the SNP may be a primer or a probe, and specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide including a site containing the SNP, or a It may be a primer capable of specifically amplifying a complementary polynucleotide.

상기 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프라이머는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. 또한, 상기 프라이머는 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소(예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자 및 화학그룹(예를 들어, 바이오틴) 등이 있다.The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

본 명세서에서 사용되는 용어 "프로브"는 DNA 또는 RNA와 특이적으로 결합할 수 있는 수개 내지 수백 개의 염기에 해당하는 핵산 단편을 의미하며, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브 또는 RNA 프로브 등의 형태로 제작될 수 있다.The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe, etc. may be produced.

상기 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프로브는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다.The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. Such a probe can be modified using a number of means known in the art as long as it exhibits an effect of detecting a site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent.

상기 프로브는 이의 5' 말단에 리포터가 추가로 더 접합될 수 있다. 상기 리포터는 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸로다민(tetramethylrhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 리포터로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다. The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine can be any one or more selected from the group consisting of However, any other known material that can be used as a reporter in the art can be used.

상기 프로브는 이의 3' 말단에 소광자가 추가로 더 접합될 수 있다. 상기 소광자는 TAMRA, BHQ(black hole quencher) 1, BHQ2, BHQ3, NFQ(nonfluorescent quencher), 답실(dabcyl), Eclipse, DDQ(deep dark quencher), 블랙베리 퀸처(Blackberry Quencher), 아이오와 블랙(Iowa black)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 소광자로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다.The probe may be further conjugated with a quencher to its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other known material that can be used as a quencher in the art may be used.

상기 SNP를 검출 또는 증폭할 수 있는 제제에는 역전사 중합효소, DNA 중합효소, Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP가 포함될 수 있다. 역전사된 cDNA를 증폭하기 위하여 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, DNA 중합효소의 예로 E.coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 또는 박테리오파지 T7 DNA 중합효소가 있다. 중합효소는 박테리아 그 자체로부터 분리하거나 상업적으로 구입하거나 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다.Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. The polymerase can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

또한, 본 발명은 상기 개의 비만 위험성 예측용 조성물을 포함하는 개의 비만 위험성 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting the risk of obesity in dogs, including the composition for predicting the risk of obesity in dogs.

상기 조성물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 본 발명은 (a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); (b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; (f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 SNP; (p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP; (r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; (s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T 또는 A인 SNP; 및 (t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는 것일 수 있다.The composition may have the characteristics as described above. In one example, the present invention includes (a) a single nucleotide polymorphism (SNP) in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 1; (b) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 2; (c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3; (d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4; (e) SNP in which the 61st base is A or T in the polynucleotide represented by SEQ ID NO: 5; (f) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 6; (g) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 7; (h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8; (i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9; (j) a SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A or G; (k) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 11; (l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12; (m) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 13; (n) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 14; (o) a SNP in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 15; (p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16; (q) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 17; (r) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 18; (s) a SNP in which the 61st base is T or A in the polynucleotide represented by SEQ ID NO: 19; And (t) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 20; It may include an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

또한, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically a probe capable of specifically binding to a site containing the SNP, a polynucleotide comprising a site containing the SNP Alternatively, it may be a primer capable of specifically amplifying its complementary polynucleotide.

상기 키트는 PCR 키트, DNA 분석용 키트일 수 있으나, 이에 제한되지 않는다.The kit may be a PCR kit or a DNA analysis kit, but is not limited thereto.

본 발명의 키트는 상기 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 유전자형을 증폭을 통해 확인하거나, 또는 mRNA의 발현 수준을 확인함으로써 개의 비만 위험성을 예측할 수 있다. 본 발명에서 제공하는 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다.The kit of the present invention can predict the risk of obesity in dogs by confirming the genotype of the SNP marker provided by the present invention through amplification using the above composition, or by confirming the expression level of mRNA. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

예를 들어, RT-PCR 키트는, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드에 대한 특이적인 프라이머 쌍 이외에도 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오티드(dNTPs), Taq-폴리머라제 및 역전사 효소와 같은 효소, DNase 억제제, RNase 억제제, DEPC-수(DEPC-water) 및 멸균수 등을 포함할 수 있다. 한편, 키트에 포함되는 성분들은 액상 형태로 제조될 수도 있고, 포함 성분들의 자유도를 낮추어 제품의 안정성을 제고하기 위해 건조된 형태로 제조될 수도 있다. 이러한 건조된 형태로의 제조를 위해서는 건조 단계의 적용이 필요하고, 이때 가온건조, 자연건조, 감압건조, 동결건조 또는 이들의 복합 공정이 사용될 수 있다.For example, the RT-PCR kit includes a tube or other suitable container, reaction buffer (pH and magnesium concentration varying) in addition to a primer pair specific for a polynucleotide containing the SNP-containing site or a complementary polynucleotide thereof. , Deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water, and sterile water. Meanwhile, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to prepare such a dried form, a drying step is required, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a combination thereof may be used.

또한, 본 발명은 상기 비만 위험성 예측용 조성물을 포함하는 개의 비만 위험성 예측용 마이크로어레이를 제공한다.In addition, the present invention provides a microarray for predicting the risk of obesity in dogs comprising the composition for predicting the risk of obesity.

본 발명에 있어 마이크로어레이란 기판상에 폴리뉴클레오티드의 그룹이 높은 밀도로 고정화되어 있는 것으로서, 상기 폴리뉴클레오티드 그룹은 각각 일정한 영역에 고정화되어 있는 마이크로어레이를 의미한다. 이러한 마이크 로어레이는 당업계에 잘 알려져 있다. In the present invention, a microarray refers to a microarray in which a group of polynucleotides is immobilized on a substrate at a high density, and each of the polynucleotide groups is immobilized in a certain region. Such microarrays are well known in the art.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및 2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 비만 위험성 예측 방법을 제공한다. In addition, the present invention includes 1) any one or more polynucleotides selected from the group consisting of polynucleotides consisting of nucleotide sequences of SEQ ID NOs: 1 to 20 from DNA of a sample isolated from dogs, or SNPs of complementary polynucleotides thereof. Amplifying the desired region; And 2) it provides a method for predicting the risk of obesity in dogs comprising the step of determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP.

상기 단계 1)의 SNP를 포함하는 부위를 증폭시키는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 예를 들면, 표적 핵산을 PCR을 통하여 증폭하고 이를 정제하여 얻을 수 있다. 그 외 리가제 연쇄 반응(LCR)(Wu 및 Wallace, Genomics 4, 560(1989), Landegren 등, Science 241, 1077(1988)), 전사증폭(transcription amplification)(Kwoh 등, ProcNatlAcad Sci USA 86, 1173(1989)), 자가유지 서열 복제(Guatelli 등, ProcNatl Acad Sci USA 87, 1874(1990)) 및 핵산에 근거한 서열 증폭(NASBA)이 사용될 수 있다.The step of amplifying the site containing the SNP of step 1) may be performed by any method known to those skilled in the art. For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), self-maintaining sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA) can be used.

상기 단계 2)의 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계는 서열분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화 기법(dynamic allelespecifichybridization, DASH), PCR 연장 분석, PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예를 들면, Sequenom의 MassARRAY 시스템), 미니-시퀀싱(minisequencing) 방법, Bio-Plex 시스템(BioRad), CEQ and SNPstream 시스템(Beckman), Molecular Inversion Probe 어레이 기술(예를 들면, Affymetrix GeneChip), 및 BeadArray Technologies(예를 들면, Illumina GoldenGate 및 Infinium 분석법) 등을 이용하여 수행될 수 있으나, 이에 제한되지는 않는다. The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) includes sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele hybridization techniques. (dynamic allelespecific hybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assay), etc. May be, but is not limited thereto.

상기 개의 비만 위험성 예측 방법에 있어서, 서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T인 경우; 서열번호 6로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 및 서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C인 경우; 서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우; 서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우; 로 이루어진 그룹에서 선택되는 적어도 하나에 해당하면 비만 위험성이 높은 것으로 판단할 수 있다. In the method for predicting the risk of obesity in the dog, when the 61st base in the polynucleotide represented by SEQ ID NO: 1 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 2 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 3 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 4 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 5 is T; When the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 8 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 9 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 11 is G; And when the 61st base in the polynucleotide represented by SEQ ID NO: 12 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 13 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 14 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 15 is C; When the 61st base in the polynucleotide represented by SEQ ID NO: 16 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 17 is G; When the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A; When the 61st base in the polynucleotide represented by SEQ ID NO: 20 is A; If it corresponds to at least one selected from the group consisting of, it may be determined that the risk of obesity is high.

본 발명의 구체적인 실시예에서, 본 발명자들은 개 150두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 비만 위험성을 조기 예측 가능한 SNP 20개를 선별하였다(표 1 내지 표 4 참조).In a specific embodiment of the present invention, the present inventors extract DNA from the blood of 150 dogs, then analyze the SNP genotype using a 170K SNP chip for the dog, and analyze the full-length genome association (Genome-wide association study, GWAS). 20 SNPs capable of early predicting the risk of obesity in dogs were selected through (see Tables 1 to 4).

따라서, 본 발명에 따른 개에서 비만 위험성이 높은 개체를 판별할 수 있는 SNP 조성물, 이를 포함하는 개의 비만 위험성 예측용 키트, 또는 이를 이용한 개의 비만 위험성 예측 방법은 비만의 위험성을 갖는 개에 대한 특별한 관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 비만에 의해 발생할 수 있는 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.Therefore, the SNP composition capable of discriminating individuals with high risk of obesity in dogs according to the present invention, a kit for predicting the risk of obesity in a dog, or a method for predicting the risk of obesity in dogs using the same is a special management for dogs having a risk of obesity It can be usefully used to select excellent dogs that do not have the risk of developing diseases that may be caused by obesity by predicting important genetic information when preparing or breeding for breeding.

이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by examples and experimental examples.

단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해서 한정되는 것은 아니다.However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<실시예 1> 개에 대한 SNP 유전자형 분석<Example 1> SNP genotyping analysis of dogs

개 150두의 혈액으로부터 DNA 정제 키트(Wizard Genomic DNA Purification Kit, Promega, 미국)를 이용하여 각각 DNA를 추출한 후, 개에 대한 170K SNP 칩(CanineHD BeadChip, Illumina, 미국)을 이용하여 SNP 유전자형을 분석하였다.DNA was extracted from the blood of 150 dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then SNP genotype was analyzed using 170K SNP chip (CanineHD BeadChip, Illumina, USA) for dogs. I did.

<1-1> 1일차: 증폭(Amplification)<1-1> Day 1: Amplification

MSA3 바코드를 붙인 96-웰 0.8 ㎖ MIDI 플레이트(이하, 'MSA3 플레이트')에 웰 당 20 ㎕의 MA1을 넣고, 개 150두의 혈액으로부터 추출한 각 DNA를 웰 당 4 ㎕씩 넣은 후, DNA ID 및 옮긴 MSA3 플레이트의 위치를 기록해두었다. 이후, 각 웰 당 4 ㎕의 0.1 N NaOH를 넣고, 96-웰 덮개(96 well cap mat)로 플레이트를 덮은 후 1,600 rpm에서 1분 동안 흔들어 섞어주고(vortexing), 280 × g에서 1분간 원심분리하였다. 이후, 10분 동안 실온에서 반응시킨 후, 웰 당 34 ㎕의 MA2를 넣고, 38 ㎕의 MSM을 넣은 후, 96-웰 덮개를 덮고 280 × g에서 1분간 원심분리하였다. 37℃의 오븐(Illumina Hybridization oven)에서 20 내지 24시간 동안 반응시켜 시료를 증폭시켰다.20 µl of MA1 per well was added to a 96-well 0.8 ml MIDI plate (hereinafter referred to as'MSA3 plate') with MSA3 barcodes attached, and 4 µl of each DNA extracted from the blood of 150 dogs was added per well, and then DNA ID and The location of the transferred MSA3 plate was recorded. Thereafter, 4 µl of 0.1 N NaOH was added to each well, and after covering the plate with a 96-well cover (96 well cap mat), shake it at 1,600 rpm for 1 minute (vortexing), and centrifuge at 280 × g for 1 minute. I did. Thereafter, after reacting at room temperature for 10 minutes, 34 µl of MA2 was added per well, 38 µl of MSM was added, and then the 96-well cover was covered and centrifuged at 280 × g for 1 minute. Samples were amplified by reacting for 20 to 24 hours in a 37°C oven (Illumina Hybridization oven).

<1-2> 2일차: 조각(Fragment)<1-2> Day 2: Fragment

상기 실시예 1-1의 MSA3 플레이트를 오븐에서 꺼내 50 × g에서 1분간 원심분리하고, 각 웰 당 25 ㎕의 FMS를 넣은 후, 덮개로 플레이트를 덮어 1,600 rpm에서 1분간 흔들어 섞어주었다(vortexing). 이후, 플레이트를 50 × g에서 1분간 원심분리하고, 37℃ 히트 블록(heat block)에서 1시간 동안 반응시켰다.The MSA3 plate of Example 1-1 was taken out of the oven and centrifuged at 50 × g for 1 minute, and 25 μl of FMS was added to each well, and then the plate was covered with a cover and shaken at 1,600 rpm for 1 minute (vortexing). . Thereafter, the plate was centrifuged at 50 × g for 1 minute, and reacted in a 37° C. heat block for 1 hour.

<1-3> 2일차: 침전(Precipitation)<1-3> Day 2: Precipitation

상기 실시예 1-2의 플레이트에 각 웰 당 25 ㎕의 PM1을 넣은 후, 덮개를 덮고, 1,600 rpm에서 1분간 원심분리한 후, 37℃ 오븐에서 5분간 반응시켰다. 플레이트를 50 × g에서 1분간 원심분리한 후, 덮개를 벗기고, 각 웰 당 155 ㎕의 2-프로판올(2-propanol)을 넣었다. 새로운 96-웰 덮개로 플레이트를 덮고 10번 뒤집어 혼합한 뒤, 4℃에서 30분 동안 보관하였다. 이후, 4℃, 3,000 rpm에서 20분 동안 원심분리 후, 플레이트 덮개를 제거하고 빠르게 뒤집어 상층액을 버렸다. 키친타올에 10회 정도 가볍게 두드려 남아있는 상층액을 제거하고, 뒤집어진 플레이트를 그대로 튜브 렉에 올려놓고 1시간 동안 자연 건조시켜 DNA 침전만 남도록 하였다.After adding 25 µl of PM1 per well to the plate of Example 1-2, the cover was covered, centrifuged at 1,600 rpm for 1 minute, and reacted in an oven at 37° C. for 5 minutes. After centrifuging the plate at 50 × g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, inverted 10 times, mixed, and stored at 4° C. for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and quickly turned over to discard the supernatant. The remaining supernatant was removed by tapping lightly on a kitchen towel about 10 times, and the inverted plate was placed on a tube rack and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> 2일차: 재현탁(Resuspend)<1-4> Day 2: Resuspend

상기 실시예 1-3의 DNA 침전이 들어있는 플레이트에 웰 당 23 ㎕의 RA1을 넣고, 남은 RA1은 추후 염색(XStain HD Bead Chip)을 위해 냉동보관하였다. 플레이트에 호일 실(foil seal)을 올리고, 히트-실러 블록(heat-sealer block)을 5초 동안 눌러 밀봉하였다. 밀봉한 플레이트를 48℃의 오븐에서 1시간 동안 반응시킨 후, 1,800 rpm에서 1분간 흔들어 섞어주었고(vortexing), 280 × g에서 1분간 원심분리하였다.23 µl of RA1 per well was added to the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for later staining (XStain HD Bead Chip). A foil seal was put on the plate, and a heat-sealer block was pressed for 5 seconds to seal. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken at 1,800 rpm for 1 minute and mixed (vortexing), followed by centrifugation at 280 × g for 1 minute.

<1-5> 2일차: 혼성화(Hybridazation)<1-5> Day 2: Hybridization

상기 실시예 1-4의 플레이트를 95℃ 히트 블록(Heat block)에 넣어 20분 동안 DNA 시료를 변성시켰다(denaturation). 이후, 플레이트를 실온에 30분 동안 두고 식히는 동안 혼성화 챔버(HybChamber)에 가스킷(gaskets)을 끼우고, 혼성화 챔버에 있는 8개의 버퍼 리저버(humidifying buffer reservoir)에 각 400 ㎕의 PB2를 넣고, 뚜껑을 닫아 실온에 두었다. 실온에서 식힌 DNA가 담긴 MSA3 플레이트를 280 × g에서 1분간 원심분리하였다. 냉장 보관하던 SNP 칩을 하나씩 꺼내 준비하고, 혼성화 챔버 인서트(insert)의 바코드 모양과 칩의 바코드 부분을 맞추어 놓은 후, 멀티채널 피펫으로 식힌 DNA 시료를 각 15 ㎕씩 칩의 양쪽 부분으로 로딩(loading)하였다. 각 칩의 시료 로딩이 끝나는 대로 혼성화 챔버에 넣고 다음 칩도 같은 방법으로 반복하였다. 챔버가 모두 채워지면 챔버 뚜껑을 닫고 48℃의 오븐에 넣고 속도를 5로 설정하여 16 내지 24시간 동안 반응시켰다.The plate of Example 1-4 was placed in a 95° C. heat block to denature the DNA sample for 20 minutes (denaturation). Then, leave the plate at room temperature for 30 minutes and insert gaskets into the hybridization chamber (HybChamber) while cooling, add 400 μl of PB2 to each of the eight humidifying buffer reservoirs in the hybridization chamber, and remove the lid. Closed and placed at room temperature. MSA3 plate containing DNA cooled at room temperature was centrifuged at 280 × g for 1 minute. Take out and prepare refrigerated SNP chips one by one, align the barcode shape of the hybridization chamber insert with the barcode part of the chip, and then load the DNA sample cooled with a multi-channel pipette into both parts of the chip by 15 µl each. ). As soon as the sample loading of each chip was finished, it was placed in the hybridization chamber and the next chip was repeated in the same manner. When the chamber was all filled, the chamber lid was closed, placed in an oven at 48° C., and the rate was set to 5 to react for 16 to 24 hours.

<1-6> 3일차: 세척(Washing bead chips)<1-6> Day 3: Washing bead chips

상기 실시예 1-5의 혼성화 챔버를 오븐에서 꺼내고, 챔버 속의 인서트를 하나씩 꺼내, 칩에 붙어 있는 실(seal)을 잡아당겨 제거한 후, 실이 제거된 칩을 세척 렉(wash rack)에 꽂아 WB1이 담긴 세척 디쉬(wash dish)에 담갔다. 모든 칩이 WB1에 담긴 후 세척 렉을 디쉬에서 1분 동안 뺐다 넣었다 하면서 씻어주었고, PB1이 들어 있는 다른 세척 디쉬에 렉을 옮겨 1분 동안 뺐다 넣었다 하면서 씻어주었다. 세척이 끝난 후, 비드칩 얼라인먼트 픽스쳐(Multi-sample BeadChips Alignment fixture)에 백 프레임(back frame)을 올리고, 바코드 방향에 맞추어 칩을 한 장씩 올린 후, 흰색 부분과 분리한 투명한 부분의 스페이스를 얼라인먼트 픽스쳐의 윗부분과 아랫부분에 맞추어 끼웠다. 스페이스를 올린 후, 바코드가 없는 칩의 윗부분에 얼라인먼트 바(alignment bar)를 올리고, 유리판의 끝이 바에 닿도록 유리판을 덮은 후, 클립을 끼워 챔버 어셈블리(Flow-through chamber assembly)를 완성하였다. 얼라인먼트 바를 제거하고, 챔버 어셈블리 양끝의 스페이스 부분을 가위로 잘라주었다.The hybridization chamber of Example 1-5 was taken out of the oven, the inserts in the chamber were taken out one by one, and the seal attached to the chip was pulled to remove it, and then the chip from which the seal was removed was inserted into a wash rack, and WB1 It was immersed in a wash dish. After all the chips were immersed in WB1, the washing rack was removed from the dish for 1 minute and washed, and the rack was moved to another washing dish containing PB1, and the rack was removed and placed for 1 minute. After washing, place the back frame on the Multi-sample BeadChips Alignment fixture, put the chip one by one according to the barcode direction, and then align the space of the transparent part separated from the white part. It was fitted to the top and bottom of the. After raising the space, an alignment bar was placed on the upper part of the chip without the barcode, the glass plate was covered so that the end of the glass plate touched the bar, and the flow-through chamber assembly was completed by inserting a clip. The alignment bar was removed, and spaces at both ends of the chamber assembly were cut with scissors.

<1-7> 3일차: 염색(XStain Beadchips)<1-7> Day 3: Dyeing (XStain Beadchips)

챔버 렉의 온도를 44℃로 맞춘 후, 상기 실시예 1-6의 챔버 어셈블리를 챔버 렉에 끼웠다. 각 칩에 150 ㎕의 RA1을 넣고 30초 동안 반응시키는 과정을 6번 반복한 후, 450 ㎕의 XC1, 450 ㎕의 XC2 및 200 ㎕의 TEM을 순차적으로 각 칩에 넣고 각각 10분씩 반응시켰다. 450 ㎕의 95% 포름아미드(formamide)/1mM EDTA(ethylenediaminetetraacetic acid)를 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 5분 동안 반응시켰다. LTM 튜브의 라벨에 적혀 있는 온도를 확인하고 해당 온도로 챔버 렉의 온도를 바꾸고, 450 ㎕의 XC3을 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 상기 설정한 챔버 렉의 온도에 도달할 때까지 기다렸다. 이후, 하기 표 1의 A - B - A - B - A의 순서로 각 칩에 시약을 넣고 반응시켰다.After adjusting the temperature of the chamber rack to 44° C., the chamber assembly of Example 1-6 was fitted to the chamber rack. 150 µl of RA1 was added to each chip and the reaction for 30 seconds was repeated 6 times, and then 450 µl of XC1, 450 µl of XC2, and 200 µl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 µl of 95% formamide/1mM ethylenediaminetetraacetic acid (EDTA) was added to each chip and reacted for 1 minute, and then the same was added again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, put 450 µl of XC3 into each chip and react for 1 minute, then put it the same again and put the set temperature of the chamber rack Waited until it reached. Thereafter, reagents were added to each chip in the order of A-B-A-B-A in Table 1 and reacted.

세트set 순서order 각 칩에 넣는 시약Reagents for each chip 시약 넣은 후 반응시간Reaction time after adding reagent AA 1One 250 ㎕의 LTM250 μl LTM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 minute 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes BB 1One 250 ㎕의 ATM250 μl of ATM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 minute 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes

상기 반응 종료 후, 즉시 챔버 어셈블리에서 챔버 렉을 분리하고 실온의 실험 테이블로 옮겨 평평하게 꺼내 두었다. 310 ㎖의 PB1을 세척 용기에 넣고 염색용 렉을 용기 안에 담가 두었다. 기구를 이용하여 챔버 렉의 클립을 벗기고 유리 블록을 들어서 제거한 후, 칩의 비드(bead) 부분을 건드리지 않도록 하면서 스페이스를 제거하였다. 칩에 붙였던 부착물을 모두 제거한 후, PB1에 담겨 있는 염색용 렉(staining rack)에 꽂아 PB1에 담가 두었다. 모든 칩을 순차적으로 상기와 동일하게 처리하였다. 염색용 렉을 천천히 10번 정도 위 아래로 움직여 칩을 담금질한 후, 5분 동안 담가두었다가 다른 세척용 용기에 XC4 310 ㎖을 채우고 상기와 동일하게 칩을 담금질한 후 5분 동안 담가두었다. 이후, 염색용 렉을 꺼내고 집게를 이용하여 칩을 조심스럽게 꺼내 튜브 렉 위에 올려두었다. 칩을 올린 튜브 렉을 진공 건조기에 넣고 508 mmHg(0.68 bar)의 진공 상태로 55분 동안 건조시켰다. 에탄올에 적신 티슈(KIMWIPES)를 이용하여 비드 부분을 건드리지 않도록 주의하면서 건조된 칩의 가장자리를 닦아주었다. 실험이 완료된 비드 칩은 72시간 이내에 스캐너를 이용하여 이미지화시켰다.Immediately after completion of the reaction, the chamber rack was removed from the chamber assembly, transferred to a room temperature experiment table, and placed flat. 310 ml of PB1 was put in a washing container, and the rack for dyeing was immersed in the container. After removing the clip of the chamber rack using a tool and lifting the glass block, the space was removed while not touching the bead part of the chip. After removing all the attachments attached to the chip, it was inserted into the staining rack contained in PB1 and immersed in PB1. All chips were sequentially treated in the same manner as above. The dyeing rack was slowly moved up and down about 10 times to quench the chips, and then soaked for 5 minutes. Then, 310 ml of XC4 was filled in another container for washing, and the chips were quenched in the same manner as above, and then soaked for 5 minutes. Thereafter, the dyeing rack was taken out, and the chips were carefully removed using forceps and placed on the tube rack. The tube rack on which the chips were loaded was placed in a vacuum dryer and dried for 55 minutes in a vacuum of 508 mmHg (0.68 bar). Using a tissue soaked in ethanol (KIMWIPES), the edge of the dried chip was wiped while being careful not to touch the bead. The bead chip after the experiment was completed was imaged using a scanner within 72 hours.

<실험예 1> 개의 비만 위험성을 조기 예측 가능한 20개 SNP의 선별<Experimental Example 1> Selection of 20 SNPs capable of early predicting the risk of obesity in dogs

개 150두에 대한 고밀도 SNP 170K 칩 분석 및 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 수행하였다.A high-density SNP 170K chip analysis and a genome-wide association study (GWAS) were performed for 150 dogs.

구체적으로, Canine 170k (17만개) SNP 칩을 이용한 비만 연관 유전자 좌위 발굴을 위하여 반려견 비만도 점수에 대한 유전자형 분석 후 얻어진 모든 SNP의 자료들은 하디-바인베르그 평형(HWE)과 minor allele의 빈도(MAF)에 대하여 R/SNPassoc 패키지의 chi-square 검정을 실시하여, 일정 조건에 맞지 않는 결과는 배제하였다(HWE; P<0.001, MAF; <1%). 개의 비만 연관 유전자 좌위 검출을 위하여 비만도 점수와 SNP 마커 사이의 연관성을 검정하는데 single marker regression에 대한 R-통계 패키지를 이용하여 비만도에 대한 각 SNP marker들의 상가적유전효과(additive effect)를 하기 일반식 1과 같이 분석하였다.Specifically, all SNP data obtained after genotyping of dog obesity scores for discovering obesity-related loci using Canine 170k (170,000) SNP chips are Hardy-Weinberg equilibrium (HWE) and frequency of minor allele (MAF). For the R/SNPassoc package, a chi-square test was performed, and results that did not meet certain conditions were excluded (HWE; P<0.001, MAF; <1%). To detect the obesity-related locus in dogs, the association between the obesity score and the SNP marker is tested.The following general formula is used to calculate the additive effect of each SNP marker on obesity by using the R-statistics package for single marker regression. It was analyzed as in 1.

[일반식 1][General Formula 1]

y = μ + Sexi + SNPj + eij y = μ + Sex i + SNP j + e ij

(상기 일반식 1에서, y는 비만도 점수, μ는 전체 평균, Sexi는 유전자형 효과(i=암컷, 수컷 및 중성화된 수컷), SNPj는 유전자형 효과(j=AA, AB, BB), eij는 임의오차, N~(0, σ2 e))(In the general formula 1, y is the obesity score, μ is the overall mean, Sex i is the genotypic effect (i = female, male and neutralized male), SNP j is the genotypic effect (j = AA, AB, BB), e ij is a random error, N~(0, σ 2 e ))

유전체전장 연관분석(genome wide association test)과 같은 다중분석(multiple testing)의 문제점인 임의 발생 오류로 인한 오류 검정(False Positive)을 위하여 10,000번의 permutation test를 수행하여 0.1% 수준으로 genome-wise P-값을 계산하였다.For the false positive, which is a problem of multiple testing, such as the genome wide association test, 10,000 permutation tests were performed and the genome-wise P- The value was calculated.

그 결과, 개의 비만 위험성을 조기 예측할 수 있는 20개의 SNP를 선별하였고, 선별한 각 표현형 수치들의 평균 및 표준편차(Standard Deviation,SD)를 구하고, 각 표준편차를 유전자형별 개수의 제곱으로 나누어 표준오차(Standard error, SE)를 계산하였다(표 2 내지 표 4). 각 표현형 별로 평균값이 높을수록 비만 위험도가 높음을 의미한다. As a result, 20 SNPs that can predict the risk of obesity early in dogs were selected, the mean and standard deviation (SD) of each selected phenotype value were obtained, and each standard deviation was divided by the square of the number of each genotype and the standard error (Standard error, SE) was calculated (Tables 2 to 4). The higher the average value for each phenotype, the higher the risk of obesity.

<개의 비만 위험도를 조기 예측할 수 있는 20개 SNP의 통계분석><Statistical analysis of 20 SNPs that can predict early risk of obesity in dogs> 번호number SNP
단일염기변이 이름SNP
Single base variant name Chr
염색체Chr
chromosome bp(위치)bp (location) A1A1 A2A2 유전자빈도Gene frequency 베타통계량Beta statistics 표준오차Standard error p(확률값)p (probability value) 1One BICF2P539993BICF2P539993 1313 2846040228460402 CC GG 0.305 0.305 -0.326 -0.326 0.094 0.094 0.0005370.000537 22 BICF2G630340192BICF2G630340192 33 4478205944782059 GG AA 0.105 0.105 0.492 0.492 0.144 0.144 0.0006440.000644 33 BICF2S230175BICF2S230175 3434 4095393240953932 AA GG 0.400 0.400 0.300 0.300 0.090 0.090 0.0008150.000815 44 BICF2P539992BICF2P539992 1313 2846049028460490 AA GG 0.295 0.295 -0.312 -0.312 0.094 0.094 0.0008810.000881 55 BICF2P539986BICF2P539986 1313 2846086928460869 AA TT 0.291 0.291 -0.317 -0.317 0.095 0.095 0.0008860.000886 66 BICF2P1060361BICF2P1060361 3535 95320669532066 GG AA 0.082 0.082 -0.516 -0.516 0.156 0.156 0.0009130.000913 77 BICF2S22912803BICF2S22912803 1414 3859848738598487 GG AA 0.086 0.086 -0.476 -0.476 0.146 0.146 0.0010840.001084 88 BICF2G630241695BICF2G630241695 55 7070264870702648 AA GG 0.341 0.341 -0.306 -0.306 0.094 0.094 0.0011830.001183 99 BICF2G630285277BICF2G630285277 1717 5978689259786892 AA GG 0.236 0.236 -0.332 -0.332 0.103 0.103 0.0012710.001271 1010 BICF2G630340139BICF2G630340139 33 4466731344667313 AA GG 0.127 0.127 0.405 0.405 0.126 0.126 0.0013580.001358 1111 BICF2P76353BICF2P76353 88 3954022239540222 GG AA 0.105 0.105 0.458 0.458 0.144 0.144 0.0014980.001498 1212 BICF2P787912BICF2P787912 1818 5084503450845034 AA GG 0.127 0.127 0.432 0.432 0.136 0.136 0.0015220.001522 1313 BICF2P1230191BICF2P1230191 2121 5076041550760415 GG AA 0.055 0.055 -0.658 -0.658 0.208 0.208 0.0015350.001535 1414 G1319f19S89G1319f19S89 2626 3165930831659308 GG AA 0.271 0.271 0.289 0.289 0.092 0.092 0.0015970.001597 1515 BICF2P825535BICF2P825535 1212 68265666826566 CC GG 0.191 0.191 0.331 0.331 0.107 0.107 0.0020640.002064 1616 BICF2P311268BICF2P311268 2121 96286039628603 AA GG 0.245 0.245 0.317 0.317 0.103 0.103 0.0021040.002104 1717 BICF2G630659577BICF2G630659577 2121 59168615916861 GG AA 0.109 0.109 0.456 0.456 0.149 0.149 0.0022020.002202 1818 BICF2G630659576BICF2G630659576 2121 59474205947420 AA GG 0.109 0.109 0.456 0.456 0.149 0.149 0.0022020.002202 1919 BICF2G630610951BICF2G630610951 1313 2036314520363145 TT AA 0.321 0.321 -0.290 -0.290 0.095 0.095 0.0023310.002331 2020 BICF2S23438846BICF2S23438846 22 1175333511753335 AA GG 0.418 0.418 0.265 0.265 0.087 0.087 0.0023360.002336

<개의 비만 위험도를 조기예측 가능한 SNP의 염기서열 정보><Sequence information of SNP that can predict early risk of obesity in dogs> 번호number 단일염기다형 이름Monobase polymorphic name 염색체chromosome 염기서열변이영역Base sequence variation region 비만 위험성
유전자형Risk of obesity
genotype 1One BICF2P539993BICF2P539993 1313 TTCCACATTCCACAGCAACCTGGCCCGCCTCACCATAGCACCCCCTGCA
CATTCTTATAA[C/G]CTTTGTTCATCATCTGTCCCCTTCAAAGACAAA
ATTCCCCAAGGAGCAGAGACTGCTTTTTTCCACATTCCACAGCAACCTGGCCCGCCTCACCATAGCACCCCCTGCA
CATTCTTATAA[C/G]CTTTGTTCATCATCTGTCCCCTTCAAAGACAAA
ATTCCCCAAGGAGCAGAGACTGCTTTT GG 22 BICF2G630340192BICF2G630340192 33 AATATAGCAAGCTGGTTTACCCACATTAACTAATTCAAGACTCAAAATA
CCTCTAAAGGC[A/G]TTTATTTATTCCCAATGTACTGATGAGAATGCC
ACACAGGTTCTGTAAAACCCCTCAGAGAATATAGCAAGCTGGTTTACCCACATTAACTAATTCAAGACTCAAAATA
CCTCTAAAGGC[A/G]TTTATTTATTCCCAATGTACTGATGAGAATGCC
ACACAGGTTCTGTAAAACCCCTCAGAG GG 33 BICF2S230175BICF2S230175 3434 AAAGGCAAAGGTGATGATGGTGGTATTGTAGATCAAATCATTCCACTAA
GGTATGGGAGG[A/G]AACTGTAAACAGAGAAACAAAACATAGGACAAG
CCATGGCAATTTTTACGGACTTTTGGAAAAGGCAAAGGTGATGATGGTGGTATTGTAGATCAAATCATTCCACTAA
GGTATGGGAGG[A/G]AACTGTAAACAGAGAAACAAAACATAGGACAAG
CCATGGCAATTTTTACGGACTTTTGGA AA 44 BICF2P539992BICF2P539992 1313 GTGAGGCGGGCCAGGTTGCTGTGGAATGTGGAATGAATCAGATGGTCCG
AATTCATGCCT[A/G]CTCGTTGCGGGGAGACTGCTCCTGCCAGAGCTA
ATGGCTTCTCCRTTATTTCTTTATTTTGTGAGGCGGGCCAGGTTGCTGTGGAATGTGGAATGAATCAGATGGTCCG
AATTCATGCCT[A/G]CTCGTTGCGGGGAGACTGCTCCTGCCAGAGCTA
ATGGCTTCTCCRTTATTTCTTTATTTT GG 55 BICF2P539986BICF2P539986 1313 CGAAGTATACCTACTATGTGCAYCAGGTGGTGACACACATATACTTCCA
ACCCACACATT[A/T]TCAAGGGCCTACCATCCCGCCAGTTCCCATTCT
TCAGAGCAGCTGTGATAGTCCAAACCACGAAGTATACCTACTATGTGCAYCAGGTGGTGACACACATATACTTCCA
ACCCACACATT[A/T]TCAAGGGCCTACCATCCCGCCAGTTCCCATTCT
TCAGAGCAGCTGTGATAGTCCAAACCA TT 66 BICF2P1060361BICF2P1060361 3535 AAATTTTTAAAAAAGGATTCACCCAAGCCTCAGTGCCTCCACATCAAGT
AGGATGGATAC[A/G]CTATTGAGACAGACAGACAGGTGAAGTGGCCTG
TCCACAGTCACCAGAATTCCGATGTCAAAATTTTTAAAAAAGGATTCACCCAAGCCTCAGTGCCTCCACATCAAGT
AGGATGGATAC[A/G]CTATTGAGACAGACAGACAGGTGAAGTGGCCTG
TCCACAGTCACCAGAATTCCGATGTCA AA 77 BICF2S22912803BICF2S22912803 1414 TGCATCAYGGTAAACCTTAAGAAGGTTTACTCCTGATGTGGGGCATGTG
AAAATGCAACT[A/G]TTCTTTCAAAATGAATGGCTGAAATTCAGACTC
AGAGTAAGAATCCTGAAACAGAACCATTGCATCAYGGTAAACCTTAAGAAGGTTTACTCCTGATGTGGGGCATGTG
AAAATGCAACT[A/G]TTCTTTCAAAATGAATGGCTGAAATTCAGACTC
AGAGTAAGAATCCTGAAACAGAACCAT AA 88 BICF2G630241695BICF2G630241695 55 TTTCTCCGCACCCTTGGTGTGGGCCATCTTACATAAAAGTACAGAGTAT
GGACTATAGCA[A/G]GGGGCGGGTRAGAAGAGAGGTATGCCAAGGTGG
GAGTTGGGGAAACGCTGAATTAGGGTGTTTCTCCGCACCCTTGGTGTGGGCCATCTTACATAAAAGTACAGAGTAT
GGACTATAGCA[A/G]GGGGCGGGTRAGAAGAGAGGTATGCCAAGGTGG
GAGTTGGGGAAACGCTGAATTAGGGTG GG 99 BICF2G630285277BICF2G630285277 1717 TAATGAAGCCATGCTATAGCAACTCCCAAAAGGTTCCTGATTCCTACAC
TTTCAGACCAT[A/G]CACAGCCCTTCTTTGAGTCTGCCTAGAGTTCTT
TTGTTTGCTACCAAAGAATCTGTACTATAATGAAGCCATGCTATAGCAACTCCCAAAAGGTTCCTGATTCCTACAC
TTTCAGACCAT[A/G]CACAGCCCTTCTTTGAGTCTGCCTAGAGTTCTT
TTGTTTGCTACCAAAGAATCTGTACTA GG 1010 BICF2G630340139BICF2G630340139 33 TCCCAGGCTCTAATTCAAATCTTGAAATGGAACCTAGACCATCAGACAC
GACTGGGGGGG[A/G]AAGCACCTAGCATATGGAAGAAGGTCTACTTTC
CAAAAGGAGAAAACACAGACCCTGTTGTCCCAGGCTCTAATTCAAATCTTGAAATGGAACCTAGACCATCAGACAC
GACTGGGGGGG[A/G]AAGCACCTAGCATATGGAAGAAGGTCTACTTTC
CAAAAGGAGAAAACACAGACCCTGTTG AA 1111 BICF2P76353BICF2P76353 88 ATTCTCTGAAAAATCATATTTGGTCATATTTAAAACATTAAAGTAAGTT
GCTCAAGAACC[A/G]CCTTATTCATTCAGCACCTATTATGTAACCATG
TGCAGAGCACTTGATCACAAATGGGCAATTCTCTGAAAAATCATATTTGGTCATATTTAAAACATTAAAGTAAGTT
GCTCAAGAACC[A/G]CCTTATTCATTCAGCACCTATTATGTAACCATG
TGCAGAGCACTTGATCACAAATGGGCA GG 1212 BICF2P787912BICF2P787912 1818 AATGAATGAATGAATGAATGAGCAATATGAGCAGTAGTCGTGACAGCCT
CCTTCAGCTTC[A/G]GGCACAGATCCCAGTCCCGCTTGACACCACCAG
GGGGCTGTGAGGCTGTGCACGGGCCATAATGAATGAATGAATGAATGAGCAATATGAGCAGTAGTCGTGACAGCCT
CCTTCAGCTTC[A/G]GGCACAGATCCCAGTCCCGCTTGACACCACCAG
GGGGCTGTGAGGCTGTGCACGGGCCAT GG 1313 BICF2P1230191BICF2P1230191 2121 TGAAGCAARAACTAAACAAAAGGGTAGATATGCAGAAAAGGTAAGAACA
GCCCAAGCAAG[A/G]AACAAACCAAGTGTGCATGGGGTGTGTTCCAAG
AACAAAGGATAGATACCCAGTGATTTTTGAAGCAARAACTAAACAAAAGGGTAGATATGCAGAAAAGGTAAGAACA
GCCCAAGCAAG[A/G]AACAAACCAAGTGTGCATGGGGTGTGTTCCAAG
AACAAAGGATAGATACCCAGTGATTTT AA 1414 G1319f19S89G1319f19S89 2626 TCTGTAGGTTTCATCAAGTCAGCACAAATGTCAAAGTCATTTCAAGGAT
GTAAATCTGCC[A/G]ATTTAGGAGCCTGGGCCATATAAACTTCACATT
GTCCTTTTAATCTGGGGTCCCCATGCATCTGTAGGTTTCATCAAGTCAGCACAAATGTCAAAGTCATTTCAAGGAT
GTAAATCTGCC[A/G]ATTTAGGAGCCTGGGCCATATAAACTTCACATT
GTCCTTTTAATCTGGGGTCCCCATGCA GG 1515 BICF2P825535BICF2P825535 1212 GATACAAATCCCTTAGTCCTCTGCACCTTCACTCCCCTCTCCACGGAGC
AGGAATGTGAA[C/G]AAGGCCCGGGCTGCTTCTCTCAGGGAGGCACGC
TCACTGCGTGTCAGGGACGTGTCATCAGATACAAATCCCTTAGTCCTCTGCACCTTCACTCCCCTCTCCACGGAGC
AGGAATGTGAA[C/G]AAGGCCCGGGCTGCTTCTCTCAGGGAGGCACGC
TCACTGCGTGTCAGGGACGTGTCATCA CC 1616 BICF2P311268BICF2P311268 2121 AATGAACATTTTGACAAGCAGGTTTTGCAAGGCCAATTACCATGAGAAT
GTTATGTCAAC[A/G]TGACCTCCTGGAAAACAACAGTACTTGAGTCAT
TCAGAATACTACCGGGGTGACACTCAGAATGAACATTTTGACAAGCAGGTTTTGCAAGGCCAATTACCATGAGAAT
GTTATGTCAAC[A/G]TGACCTCCTGGAAAACAACAGTACTTGAGTCAT
TCAGAATACTACCGGGGTGACACTCAG AA 1717 BICF2G630659577BICF2G630659577 2121 TTAAGCAGAAATTTTAAGTCTAAGAGAGACGTTTCAGATAAATTATTTA
AAGCTATGTAA[A/G]TTACCTTAATAAAACATGTTATGAATTCACTGT
GATGAATTATTAGGATTTCCACATAAATTAAGCAGAAATTTTAAGTCTAAGAGAGACGTTTCAGATAAATTATTTA
AAGCTATGTAA[A/G]TTACCTTAATAAAACATGTTATGAATTCACTGT
GATGAATTATTAGGATTTCCACATAAA GG 1818 BICF2G630659576BICF2G630659576 2121 CTCCACTAMCCTTTAGTTGGAAAAACTGAGTGCTTTGGATCAAGGACTA
TAAGGATTCTG[A/G]CATGACAATATCAGGACCTTTCCTGATTCACTC
ACCACTGAACTAGGCAAAAAAAAGTATCTCCACTAMCCTTTAGTTGGAAAAACTGAGTGCTTTGGATCAAGGACTA
TAAGGATTCTG[A/G]CATGACAATATCAGGACCTTTCCTGATTCACTC
ACCACTGAACTAGGCAAAAAAAAGTAT AA 1919 BICF2G630610951BICF2G630610951 1313 TTAGGTTTACAGATTTAAGATGGATTGTGGTCCACACATCACCCTTGCC
TCTCCAATTCA[A/T]TCAAGGGTCCCACATCACCCTTGCCTTTCAAAT
TCATTAATTCATTCTAACATCATGATTTTAGGTTTACAGATTTAAGATGGATTGTGGTCCACACATCACCCTTGCC
TCTCCAATTCA[A/T]TCAAGGGTCCCACATCACCCTTGCCTTTCAAAT
TCATTAATTCATTCTAACATCATGATT AA 2020 BICF2S23438846BICF2S23438846 22 TACAATGCTTGTAGAACAAAAGTTAAATCGACAGGGATCTGATGTTAAT
TTTTAACCACA[A/G]ACAAGGTAGGGGATAAACTGTCAGAGAAAAAAG
CAGTCATTCTTCCTATGGCCTAAGTTTTACAATGCTTGTAGAACAAAAGTTAAATCGACAGGGATCTGATGTTAAT
TTTTAACCACA[A/G]ACAAGGTAGGGGATAAACTGTCAGAGAAAAAAG
CAGTCATTCTTCCTATGGCCTAAGTTT AA

<개의 비만 위험도와 연관된 유전자형별 평균치와 표준오차 값><Mean and standard error values for each genotype associated with the risk of obesity in dogs> 번호number 단일염기다형 이름Monobase polymorphic name 염색체chromosome 항목Item 유전자형-1Genotype-1 유전자형-2Genotype-2 유전자형-3Genotype-3 1One BICF2P539993BICF2P539993 1313 변이(개체수)Variation (number of individuals) GG(74)GG(74) CG(56)CG(56) CC(20)CC(20) 평균Average 2.57 2.57 2.20 2.20 1.70 1.70 표준오차Standard error 0.18 0.18 0.19 0.19 0.33 0.33 22 BICF2G630340192BICF2G630340192 33 변이(개체수)Variation (number of individuals) AA(122)AA(122) AG(25)AG(25) GG(3)GG(3) 평균Average 2.21 2.21 2.76 2.76 2.67 2.67 표준오차Standard error 0.13 0.13 0.34 0.34 1.33 1.33 33 BICF2S230175BICF2S230175 3434 변이(개체수)Variation (number of individuals) AA(23)AA(23) AG(61)AG(61) GG(66)GG(66) 평균Average 3.09 3.09 2.51 2.51 1.86 1.86 표준오차Standard error 0.29 0.29 0.18 0.18 0.19 0.19 44 BICF2P539992BICF2P539992 1313 변이(개체수)Variation (number of individuals) AA(20)AA(20) AG(54)AG(54) GG(76)GG(76) 평균Average 1.70 1.70 2.17 2.17 2.58 2.58 표준오차Standard error 0.33 0.33 0.20 0.20 0.18 0.18 55 BICF2P539986BICF2P539986 1313 변이(개체수)Variation (number of individuals) AA(19)AA(19) AT(55)AT(55) TT(76)TT(76) 평균Average 1.63 1.63 2.18 2.18 2.58 2.58 표준오차Standard error 0.34 0.34 0.19 0.19 0.18 0.18 66 BICF2P1060361BICF2P1060361 3535 변이(개체수)Variation (number of individuals) AA(129)AA(129) AG(19)AG(19) GG(2)GG(2) 평균Average 2.35 2.35 2.16 2.16 1.50 1.50 표준오차Standard error 0.14 0.14 0.32 0.32 0.50 0.50 77 BICF2S22912803BICF2S22912803 1414 변이(개체수)Variation (number of individuals) AA(131)AA(131) AG(16)AG(16) GG(3)GG(3) 평균Average 2.34 2.34 2.19 2.19 2.00 2.00 표준오차Standard error 0.14 0.14 0.31 0.31 0.58 0.58 88 BICF2G630241695BICF2G630241695 55 변이(개체수)Variation (number of individuals) AA(21)AA(21) AG(57)AG(57) GG(72)GG(72) 평균Average 1.76 1.76 2.54 2.54 2.29 2.29 표준오차Standard error 0.31 0.31 0.18 0.18 0.19 0.19 99 BICF2G630285277BICF2G630285277 1717 변이(개체수)Variation (number of individuals) AA(9)AA(9) AG(51)AG(51) GG(90)GG(90) 평균Average 2.44 2.44 2.00 2.00 2.48 2.48 표준오차Standard error 0.41 0.41 0.19 0.19 0.17 0.17 1010 BICF2G630340139BICF2G630340139 33 변이(개체수)Variation (number of individuals) AA(5)AA(5) AG(29)AG(29) GG(116)GG(116) 평균Average 3.00 3.00 2.48 2.48 2.24 2.24 표준오차Standard error 0.77 0.77 0.34 0.34 0.13 0.13 1111 BICF2P76353BICF2P76353 88 변이(개체수)Variation (number of individuals) AA(125)AA(125) AG(23)AG(23) GG(2)GG(2) 평균Average 2.18 2.18 2.96 2.96 3.50 3.50 표준오차Standard error 0.13 0.13 0.31 0.31 0.50 0.50 1212 BICF2P787912BICF2P787912 1818 변이(개체수)Variation (number of individuals) AA(5)AA(5) AG(33)AG(33) GG(112)GG(112) 평균Average 1.60 1.60 2.48 2.48 2.29 2.29 표준오차Standard error 0.98 0.98 0.30 0.30 0.14 0.14 1313 BICF2P1230191BICF2P1230191 2121 변이(개체수)Variation (number of individuals) AA(131)AA(131) AG(17)AG(17) GG(2)GG(2) 평균Average 2.41 2.41 1.82 1.82 0.00 0.00 표준오차Standard error 0.13 0.13 0.35 0.35 0.00 0.00 1414 G1319f19S89G1319f19S89 2626 변이(개체수)Variation (number of individuals) AA(87)AA(87) AG(43)AG(43) GG(19)GG(19) 평균Average 2.14 2.14 2.56 2.56 2.53 2.53 표준오차Standard error 0.15 0.15 0.26 0.26 0.39 0.39 1515 BICF2P825535BICF2P825535 1212 변이(개체수)Variation (number of individuals) AA(9)AA(9) AT(35)AT(35) TT(106)TT(106) 평균Average 2.78 2.78 2.69 2.69 2.15 2.15 표준오차Standard error 0.60 0.60 0.25 0.25 0.15 0.15 1616 BICF2P311268BICF2P311268 2121 변이(개체수)Variation (number of individuals) AA(8)AA(8) AG(49)AG(49) GG(93)GG(93) 평균Average 3.38 3.38 2.59 2.59 2.08 2.08 표준오차Standard error 0.32 0.32 0.22 0.22 0.16 0.16 1717 BICF2G630659577BICF2G630659577 2121 변이(개체수)Variation (number of individuals) AA(122)AA(122) AG(27)AG(27) GG(1)GG(1) 평균Average 2.16 2.16 2.96 2.96 3.00 3.00 표준오차Standard error 0.13 0.13 0.30 0.30 3.00 3.00 1818 BICF2G630659576BICF2G630659576 2121 변이(개체수)Variation (number of individuals) AA(1)AA(1) AG(27)AG(27) GG(122)GG(122) 평균Average 3.00 3.00 2.96 2.96 2.16 2.16 표준오차Standard error 3.00 3.00 0.30 0.30 0.13 0.13 1919 BICF2G630610951BICF2G630610951 1313 변이(개체수)Variation (number of individuals) AA(73)AA(73) AG(58)AG(58) GG(18GG(18 평균Average 2.41 2.41 2.28 2.28 2.00 2.00 표준오차Standard error 0.19 0.19 0.19 0.19 0.32 0.32 2020 BICF2S23438846BICF2S23438846 22 변이(개체수)Variation (number of individuals) AA(28)AA(28) AG(59)AG(59) GG(63)GG(63) 평균Average 2.82 2.82 2.53 2.53 1.89 1.89 표준오차Standard error 0.27 0.27 0.19 0.19 0.19 0.19

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for prediction of dog's obesity and prediction method using the same <130> 2019p-09-020 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539993 <220> <221> variation <222> (61) <223> n is C or G <400> 1 ttccacattc cacagcaacc tggcccgcct caccatagca ccccctgcac attcttataa 60 nctttgttca tcatctgtcc ccttcaaaga caaaattccc caaggagcag agactgcttt 120 t 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630340192 <220> <221> variation <222> (61) <223> n is A or G <400> 2 aatatagcaa gctggtttac ccacattaac taattcaaga ctcaaaatac ctctaaaggc 60 ntttatttat tcccaatgta ctgatgagaa tgccacacag gttctgtaaa acccctcaga 120 g 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S230175 <220> <221> variation <222> (61) <223> n is A or G <400> 3 aaaggcaaag gtgatgatgg tggtattgta gatcaaatca ttccactaag gtatgggagg 60 naactgtaaa cagagaaaca aaacatagga caagccatgg caatttttac ggacttttgg 120 a 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539992 <220> <221> variation <222> (61) <223> n is A or G <400> 4 gtgaggcggg ccaggttgct gtggaatgtg gaatgaatca gatggtccga attcatgcct 60 nctcgttgcg gggagactgc tcctgccaga gctaatggct tctccrttat ttctttattt 120 t 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539986 <220> <221> variation <222> (61) <223> n is A or T <400> 5 cgaagtatac ctactatgtg caycaggtgg tgacacacat atacttccaa cccacacatt 60 ntcaagggcc taccatcccg ccagttccca ttcttcagag cagctgtgat agtccaaacc 120 a 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1060361 <220> <221> variation <222> (61) <223> n is A or G <400> 6 aaatttttaa aaaaggattc acccaagcct cagtgcctcc acatcaagta ggatggatac 60 nctattgaga cagacagaca ggtgaagtgg cctgtccaca gtcaccagaa ttccgatgtc 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S22912803 <220> <221> variation <222> (61) <223> n is A or G <400> 7 tgcatcaygg taaaccttaa gaaggtttac tcctgatgtg gggcatgtga aaatgcaact 60 nttctttcaa aatgaatggc tgaaattcag actcagagta agaatcctga aacagaacca 120 t 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630241695 <220> <221> variation <222> (61) <223> n is A or G <400> 8 tttctccgca cccttggtgt gggccatctt acataaaagt acagagtatg gactatagca 60 nggggcgggt ragaagagag gtatgccaag gtgggagttg gggaaacgct gaattagggt 120 g 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630285277 <220> <221> variation <222> (61) <223> n is A or G <400> 9 taatgaagcc atgctatagc aactcccaaa aggttcctga ttcctacact ttcagaccat 60 ncacagccct tctttgagtc tgcctagagt tcttttgttt gctaccaaag aatctgtact 120 a 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630340139 <220> <221> variation <222> (61) <223> n is A or G <400> 10 tcccaggctc taattcaaat cttgaaatgg aacctagacc atcagacacg actggggggg 60 naagcaccta gcatatggaa gaaggtctac tttccaaaag gagaaaacac agaccctgtt 120 g 121 <210> 11 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P76353 <220> <221> variation <222> (61) <223> n is A or G <400> 11 attctctgaa aaatcatatt tggtcatatt taaaacatta aagtaagttg ctcaagaacc 60 nccttattca ttcagcacct attatgtaac catgtgcaga gcacttgatc acaaatgggc 120 a 121 <210> 12 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P787912 <220> <221> variation <222> (61) <223> n is A or G <400> 12 aatgaatgaa tgaatgaatg agcaatatga gcagtagtcg tgacagcctc cttcagcttc 60 nggcacagat cccagtcccg cttgacacca ccagggggct gtgaggctgt gcacgggcca 120 t 121 <210> 13 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1230191 <220> <221> variation <222> (61) <223> n is A or G <400> 13 tgaagcaara actaaacaaa agggtagata tgcagaaaag gtaagaacag cccaagcaag 60 naacaaacca agtgtgcatg gggtgtgttc caagaacaaa ggatagatac ccagtgattt 120 t 121 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> G1319f19S89 <220> <221> variation <222> (61) <223> n is A or G <400> 14 tctgtaggtt tcatcaagtc agcacaaatg tcaaagtcat ttcaaggatg taaatctgcc 60 natttaggag cctgggccat ataaacttca cattgtcctt ttaatctggg gtccccatgc 120 a 121 <210> 15 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P825535 <220> <221> variation <222> (61) <223> n is C or G <400> 15 gatacaaatc ccttagtcct ctgcaccttc actcccctct ccacggagca ggaatgtgaa 60 naaggcccgg gctgcttctc tcagggaggc acgctcactg cgtgtcaggg acgtgtcatc 120 a 121 <210> 16 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P311268 <220> <221> variation <222> (61) <223> n is A or G <400> 16 aatgaacatt ttgacaagca ggttttgcaa ggccaattac catgagaatg ttatgtcaac 60 ntgacctcct ggaaaacaac agtacttgag tcattcagaa tactaccggg gtgacactca 120 g 121 <210> 17 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630659577 <220> <221> variation <222> (61) <223> n is A or G <400> 17 ttaagcagaa attttaagtc taagagagac gtttcagata aattatttaa agctatgtaa 60 nttaccttaa taaaacatgt tatgaattca ctgtgatgaa ttattaggat ttccacataa 120 a 121 <210> 18 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630659576 <220> <221> variation <222> (61) <223> n is A or G <400> 18 ctccactamc ctttagttgg aaaaactgag tgctttggat caaggactat aaggattctg 60 ncatgacaat atcaggacct ttcctgattc actcaccact gaactaggca aaaaaaagta 120 t 121 <210> 19 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630610951 <220> <221> variation <222> (61) <223> n is A or T <400> 19 ttaggtttac agatttaaga tggattgtgg tccacacatc acccttgcct ctccaattca 60 ntcaagggtc ccacatcacc cttgcctttc aaattcatta attcattcta acatcatgat 120 t 121 <210> 20 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23438846 <220> <221> variation <222> (61) <223> n is A or G <400> 20 tacaatgctt gtagaacaaa agttaaatcg acagggatct gatgttaatt tttaaccaca 60 nacaaggtag gggataaact gtcagagaaa aaagcagtca ttcttcctat ggcctaagtt 120 t 121 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for prediction of dog's obesity and prediction method using the same <130> 2019p-09-020 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539993 <220> <221> variation <222> (61) <223> n is C or G <400> 1 ttccacattc cacagcaacc tggcccgcct caccatagca ccccctgcac attcttataa 60 nctttgttca tcatctgtcc ccttcaaaga caaaattccc caaggagcag agactgcttt 120 t 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630340192 <220> <221> variation <222> (61) <223> n is A or G <400> 2 aatatagcaa gctggtttac ccacattaac taattcaaga ctcaaaatac ctctaaaggc 60 ntttatttat tcccaatgta ctgatgagaa tgccacacag gttctgtaaa acccctcaga 120 g 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S230175 <220> <221> variation <222> (61) <223> n is A or G <400> 3 aaaggcaaag gtgatgatgg tggtattgta gatcaaatca ttccactaag gtatgggagg 60 naactgtaaa cagagaaaca aaacatagga caagccatgg caatttttac ggacttttgg 120 a 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539992 <220> <221> variation <222> (61) <223> n is A or G <400> 4 gtgaggcggg ccaggttgct gtggaatgtg gaatgaatca gatggtccga attcatgcct 60 nctcgttgcg gggagactgc tcctgccaga gctaatggct tctccrttat ttctttattt 120 t 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P539986 <220> <221> variation <222> (61) <223> n is A or T <400> 5 cgaagtatac ctactatgtg caycaggtgg tgacacacat atacttccaa cccacacatt 60 ntcaagggcc taccatcccg ccagttccca ttcttcagag cagctgtgat agtccaaacc 120 a 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1060361 <220> <221> variation <222> (61) <223> n is A or G <400> 6 aaatttttaa aaaaggattc acccaagcct cagtgcctcc acatcaagta ggatggatac 60 nctattgaga cagacagaca ggtgaagtgg cctgtccaca gtcaccagaa ttccgatgtc 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S22912803 <220> <221> variation <222> (61) <223> n is A or G <400> 7 tgcatcaygg taaaccttaa gaaggtttac tcctgatgtg gggcatgtga aaatgcaact 60 nttctttcaa aatgaatggc tgaaattcag actcagagta agaatcctga aacagaacca 120 t 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630241695 <220> <221> variation <222> (61) <223> n is A or G <400> 8 tttctccgca cccttggtgt gggccatctt acataaaagt acagagtatg gactatagca 60 nggggcgggt ragaagagag gtatgccaag gtgggagttg gggaaacgct gaattagggt 120 g 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630285277 <220> <221> variation <222> (61) <223> n is A or G <400> 9 taatgaagcc atgctatagc aactcccaaa aggttcctga ttcctacact ttcagaccat 60 ncacagccct tctttgagtc tgcctagagt tcttttgttt gctaccaaag aatctgtact 120 a 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630340139 <220> <221> variation <222> (61) <223> n is A or G <400> 10 tcccaggctc taattcaaat cttgaaatgg aacctagacc atcagacacg actggggggg 60 naagcaccta gcatatggaa gaaggtctac tttccaaaag gagaaaacac agaccctgtt 120 g 121 <210> 11 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P76353 <220> <221> variation <222> (61) <223> n is A or G <400> 11 attctctgaa aaatcatatt tggtcatatt taaaacatta aagtaagttg ctcaagaacc 60 nccttattca ttcagcacct attatgtaac catgtgcaga gcacttgatc acaaatgggc 120 a 121 <210> 12 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P787912 <220> <221> variation <222> (61) <223> n is A or G <400> 12 aatgaatgaa tgaatgaatg agcaatatga gcagtagtcg tgacagcctc cttcagcttc 60 nggcacagat cccagtcccg cttgacacca ccagggggct gtgaggctgt gcacgggcca 120 t 121 <210> 13 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1230191 <220> <221> variation <222> (61) <223> n is A or G <400> 13 tgaagcaara actaaacaaa agggtagata tgcagaaaag gtaagaacag cccaagcaag 60 naacaaacca agtgtgcatg gggtgtgttc caagaacaaa ggatagatac ccagtgattt 120 t 121 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> G1319f19S89 <220> <221> variation <222> (61) <223> n is A or G <400> 14 tctgtaggtt tcatcaagtc agcacaaatg tcaaagtcat ttcaaggatg taaatctgcc 60 natttaggag cctgggccat ataaacttca cattgtcctt ttaatctggg gtccccatgc 120 a 121 <210> 15 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P825535 <220> <221> variation <222> (61) <223> n is C or G <400> 15 gatacaaatc ccttagtcct ctgcaccttc actcccctct ccacggagca ggaatgtgaa 60 naaggcccgg gctgcttctc tcagggaggc acgctcactg cgtgtcaggg acgtgtcatc 120 a 121 <210> 16 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P311268 <220> <221> variation <222> (61) <223> n is A or G <400> 16 aatgaacatt ttgacaagca ggttttgcaa ggccaattac catgagaatg ttatgtcaac 60 ntgacctcct ggaaaacaac agtacttgag tcattcagaa tactaccggg gtgacactca 120 g 121 <210> 17 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630659577 <220> <221> variation <222> (61) <223> n is A or G <400> 17 ttaagcagaa attttaagtc taagagagac gtttcagata aattatttaa agctatgtaa 60 nttaccttaa taaaacatgt tatgaattca ctgtgatgaa ttattaggat ttccacataa 120 a 121 <210> 18 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630659576 <220> <221> variation <222> (61) <223> n is A or G <400> 18 ctccactamc ctttagttgg aaaaactgag tgctttggat caaggactat aaggattctg 60 ncatgacaat atcaggacct ttcctgattc actcaccact gaactaggca aaaaaaagta 120 t 121 <210> 19 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630610951 <220> <221> variation <222> (61) <223> n is A or T <400> 19 ttaggtttac agatttaaga tggattgtgg tccacacatc acccttgcct ctccaattca 60 ntcaagggtc ccacatcacc cttgcctttc aaattcatta attcattcta acatcatgat 120 t 121 <210> 20 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23438846 <220> <221> variation <222> (61) <223> n is A or G <400> 20 tacaatgctt gtagaacaaa agttaaatcg acagggatct gatgttaatt tttaaccaca 60 nacaaggtag gggataaact gtcagagaaa aaagcagtca ttcttcctat ggcctaagtt 120 t 121

Claims (6)

(a)서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP);
(b)서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(c)서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(d)서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(e)서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP;
(f)서열번호 6으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(g)서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(h)서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(i)서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(j)서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(k)서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(l)서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(m)서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(n)서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(o)서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C 또는 G인 SNP;
(p)서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(q)서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G 또는 A인 SNP;
(r)서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
(s)서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T 또는 A인 SNP; 및
(t)서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 비만 위험성 예측용 조성물.
(a) single nucleotide polymorphism (SNP) in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 1;
(b) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 2;
(c) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 3;
(d) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 4;
(e) SNP in which the 61st base is A or T in the polynucleotide represented by SEQ ID NO: 5;
(f) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 6;
(g) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 7;
(h) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 8;
(i) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 9;
(j) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 10;
(k) a SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 11;
(l) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 12;
(m) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 13;
(n) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 14;
(o) a SNP in which the 61st base is C or G in the polynucleotide represented by SEQ ID NO: 15;
(p) SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 16;
(q) SNP in which the 61st base is G or A in the polynucleotide represented by SEQ ID NO: 17;
(r) a SNP in which the 61st base is A or G in the polynucleotide represented by SEQ ID NO: 18;
(s) a SNP in which the 61st base is T or A in the polynucleotide represented by SEQ ID NO: 19; And
(t) SNP in which the 61st base in the polynucleotide represented by SEQ ID NO: 20 is A or G;
A composition for predicting the risk of obesity in dogs, including an agent capable of detecting or amplifying.
 제1항에 있어서, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브인 것을 특징으로 하는, 개의 비만 위험성 예측용 조성물.
The composition of claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
 제1항의 조성물을 포함하는 것을 특징으로 하는, 개의 비만 위험성 예측용 키트.
A kit for predicting the risk of obesity, comprising the composition of claim 1.
 제1항의 조성물을 포함하는 것을 특징으로 하는, 개의 비만 위험성 예측용 마이크로어레이.
A microarray for predicting the risk of obesity in dogs, comprising the composition of claim 1.
 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1 내지 20의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계; 및
2) 상기 증폭된 SNP를 포함하는 부위에서 61번째 염기에 해당하는 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 비만 위험성 예측 방법.
1) amplifying a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1 to 20 from the DNA of a sample isolated from a dog or a region containing the SNP of a complementary polynucleotide thereof; And
2) A method for predicting the risk of obesity in dogs comprising the step of determining the base type of the SNP corresponding to the 61st base at the site containing the amplified SNP.
 제5항에 있어서,
서열번호 1로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 2로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 3으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 4로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 5로 표시되는 폴리뉴클레오티드에서 61번째 염기가 T인 경우;
서열번호 6로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 7로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 8로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 9로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 10으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 11로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 12로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 13으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 14로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 15로 표시되는 폴리뉴클레오티드에서 61번째 염기가 C인 경우;
서열번호 16으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 17로 표시되는 폴리뉴클레오티드에서 61번째 염기가 G인 경우;
서열번호 18로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 19로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
서열번호 20으로 표시되는 폴리뉴클레오티드에서 61번째 염기가 A인 경우;
로 이루어진 그룹에서 선택되는 적어도 하나에 해당하면 비만 위험성이 높은 것으로 판단하는 방법.

The method of claim 5,
When the 61st base in the polynucleotide represented by SEQ ID NO: 1 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 2 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 3 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 4 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 5 is T;
When the 61st base in the polynucleotide represented by SEQ ID NO: 6 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 7 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 8 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 9 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 10 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 11 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 12 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 13 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 14 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 15 is C;
When the 61st base in the polynucleotide represented by SEQ ID NO: 16 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 17 is G;
When the 61st base in the polynucleotide represented by SEQ ID NO: 18 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 19 is A;
When the 61st base in the polynucleotide represented by SEQ ID NO: 20 is A;
A method of determining that the risk of obesity is high if it is at least one selected from the group consisting of.
KR1020190126479A 2019-10-11 2019-10-11 SNP marker for prediction of dog's obesity and prediction method using the same KR102194881B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190126479A KR102194881B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's obesity and prediction method using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190126479A KR102194881B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's obesity and prediction method using the same

Publications (1)

Publication Number Publication Date
KR102194881B1 true KR102194881B1 (en) 2020-12-24

Family

ID=74087289

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190126479A KR102194881B1 (en) 2019-10-11 2019-10-11 SNP marker for prediction of dog's obesity and prediction method using the same

Country Status (1)

Country Link
KR (1) KR102194881B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008096009A2 (en) * 2007-02-09 2008-08-14 Mellitech Polymorphism in the slc30a8 gene
KR20120043793A (en) * 2010-10-27 2012-05-07 대한민국(농촌진흥청장) Snp for diagnosing hip dysplasia in dog and uses thereof
KR20170056726A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's food consumption and prediction method using the same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008096009A2 (en) * 2007-02-09 2008-08-14 Mellitech Polymorphism in the slc30a8 gene
KR20120043793A (en) * 2010-10-27 2012-05-07 대한민국(농촌진흥청장) Snp for diagnosing hip dysplasia in dog and uses thereof
KR20170056726A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's food consumption and prediction method using the same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Animal Genetics (2015) 47:245-249* *
Molecular Biology Reports (2017) 44:333-339* *
PLoS Genetics (2017) 13(3):e1006661* *

Similar Documents

Publication Publication Date Title
KR101432164B1 (en) Novel haplotype marker for discriminating level of meat quality of Pig and use thereof
KR101677517B1 (en) Novel SNP marker for discriminating level of meat quality and Black Coat Color of pig and use thereof
KR102185440B1 (en) Composition for early predicting or diagnosing hypercholesterolemia in dog
CN108026583A (en) HLA-B*15:02 single nucleotide polymorphism and its application
KR101751932B1 (en) A new dna marker and a detecting method of using the same
KR102124652B1 (en) Composition for early predicting or diagnosing anxiety disorder in dog
KR101450792B1 (en) Novel SNP marker for discriminating Black Coat Colour of Pig and use thereof
KR102194878B1 (en) Composition for early predicting or diagnosing mental stability in dog
KR102141607B1 (en) Composition for predicting or diagnosing progressive retinal atrophy in dog
KR101312480B1 (en) Novel snp marker for discriminating number of rib of pig and use thereof
KR102470966B1 (en) Development of genetic markers for early prediction of body height of Jindo dogs
KR102108737B1 (en) Composition for determining the color of a bovine including an agent capable of detecting or amplifying SNP
KR102194881B1 (en) SNP marker for prediction of dog&#39;s obesity and prediction method using the same
KR102124770B1 (en) Composition for early predicting or diagnosing hip dysplasia in dog
KR102387431B1 (en) Marker for predicting protein content of pork and use thereof
KR102194880B1 (en) SNP marker for prediction of dog&#39;s diabetes risk and prediction method using the same
KR102194879B1 (en) SNP marker for prediction of dog&#39;s owner friendliness and prediction method using the same
KR102470971B1 (en) Development of genetic markers for early prediction of body length vs. height ratio in Jindo dogs
KR102475362B1 (en) SNP marker for prediction of dog&#39;s activity and prediction method using the same
KR102167792B1 (en) Composition for early predicting or diagnosing hypercalcemia in dog
KR102475364B1 (en) SNP marker for prediction of dog&#39;s environmental adaptability and prediction method using the same
KR102470954B1 (en) Development of genetic markers for early prediction of body length of Jindo dogs
KR102470958B1 (en) Development of genetic markers for early prediction of weight of Jindo dogs
KR102336624B1 (en) Marker for predicting collagen content in pork and use thereof
KR102141604B1 (en) Composition for predicting or diagnosing luxating patella in dog

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant