KR102108737B1 - Composition for determining the color of a bovine including an agent capable of detecting or amplifying SNP - Google Patents

Abstract

The present invention relates to a composition for distinguishing meat color of bovine, comprising an agent capable of detecting or amplifying SNP. The present invention selects six SNPs highly related to the meat color of bovine and confirms a meat color trait according to a genotype, thereby accurately distinguishing the meat color trait of bovine.

Description

Composition for determining the color of a bovine including an agent capable of detecting or amplifying SNP}

The present invention relates to a composition for discriminating cow's flesh color, a kit for discriminating a cow's flesh color containing the composition, and a method for determining a cow's flesh color, which includes an agent capable of detecting or amplifying SNP.

The meat color of beef refers to the meat color of the longest cross-section of beef, and is known to be the primary criterion for the determination of the quality of beef as one of the characteristics that directly affects the price formation of beef.

In order to easily discriminate high-quality Korean beef, research using biotechnological methods for discrimination of meat color has been actively conducted. Specifically, the Republic of Korea Patent Publication No. 10-2015-0047672 discloses a method for discriminating characteristics such as meat color of Korean beef using SNP, and the Korean Patent Publication No. 10-2016-0048316 discloses the genes ITGB6, F3 and ITGA5. Disclosed is a method for predicting the coloration of Korean beef using a marker, and Korean Patent No. 82348 relates to Korean beef selection using biomarker protein, and discloses a biomarker related to the longest area of pear for high-grade Korean beef selection. .

The present inventors have completed the present invention by discovering new SNPs for discriminating meat traits to easily and accurately discriminate Korean beef.

An object of the present invention is to provide a composition for discrimination of bovine flesh, comprising an agent capable of detecting or amplifying SNP.

Another object of the present invention is to provide a kit for determining the color of a cow.

Another object of the present invention is to provide a method for discriminating cow flesh.

In order to achieve the above object, there is provided a composition for discrimination of bovine flesh, comprising an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of monobasic polymorphism (SNP).

In addition, the present invention provides a kit for determining the color of a cow.

In addition, the present invention provides a method for determining the color of a cow.

When the composition for discrimination of color of a cow of the present invention is used, it is possible to accurately determine the color of a cow, and thereby it is possible to easily and accurately discriminate high-quality meat.

Figure 1 shows the results of a full-length genome association analysis in order to select a new SNP associated with Korean beef meat traits.

Hereinafter, the present invention will be described in detail.

The present invention is a single nucleotide polymorphism (SNP) in which the 101st base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;

SNP in which the 101st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;

SNP in which the 101st base is C or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; And

In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, the 101st base is A or C, comprising a formulation capable of detecting or amplifying any one or more SNPs selected from the group consisting of, in the composition for discrimination of cattle color It is about.

The cow may be Korean beef, but is not limited thereto.

The term "nucleotide" in the present invention is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogs of nucleotides in nature, unless specifically stated otherwise.

In the present invention, the term, "SNP (Single Nucleotide polymorphism)" refers to a single base polymorphism, SNP refers to one or dozens of base mutations representing individual variation among the 3 billion base sequences possessed by chromosomes in the cell nucleus, This results in differences in phenotype, drug responsiveness, and disease resistance.

The term "an agent capable of detecting or amplifying a polynucleotide" of the present invention is an agent capable of specifically recognizing and binding to a site containing an SNP in a polynucleotide, or an agent capable of amplifying a site containing the SNP. , Specifically, a probe capable of specifically binding to the site containing the SNP, a polynucleotide comprising the site containing the SNP, or a primer capable of specifically amplifying a complementary polynucleotide thereof.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. These primers can be modified using a number of means known in the art, as long as they have the effect of detecting the site containing the SNP. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modification between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids are one or more additional covalently attached residues, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer may include a label that can be directly or indirectly detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g. ³² P), fluorescent molecules and chemical groups (e.g. biotin), etc. There is this.

As used herein, the term "probe" refers to nucleic acid fragments corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, oligonucleotide probes, single stranded DNA probes , It may be produced in the form of a double stranded DNA (double stranded DNA) probe or RNA probe.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such a probe can be modified using a number of means known in the art, as long as it has the effect of detecting the site containing the SNP. Examples of such modifications are methylation, encapsulation, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamidate , Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids can include one or more additional covalently attached residues, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may be further bonded to a reporter at its 5 'end. The reporters are FAM (6-carboxyfluorescein), Texas red, fluorescein, fluorescein chlorotriazinyl, HEX (2 ', 4', 5 ', 7'-tetrachloro -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, alexa Fluoro (alexa fluor), JOE (6-Carboxy-4 ', 5'-Dichloro-2', 7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine. However, any material known to be used as a reporter in the art can be used.

The probe may further be conjugated with a quencher at its 3 'end. The quencher is TAMRA, black hole quencher (BHQ) 1, BHQ2, BHQ3, nonfluorescent quencher (NFQ), dabcyl, Eclipse, deep dark quencher (DDQ), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other material known to be used in the art as a quencher can be used.

The "an agent capable of detecting or amplifying a polynucleotide" may include a reverse transcriptase, a DNA polymerase, a cofactor such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. A variety of DNA polymerases can be used in the amplification step of the present invention to amplify reverse transcribed cDNA, and examples of DNA polymerases include Klenow fragments of E.coli DNA polymerase I, thermostable DNA polymerases or bacteriophage T7 DNA polymerization There are enzymes. The polymerase can be obtained from cells that are isolated from the bacteria itself, purchased commercially or express high levels of the cloning gene encoding the polymerase.

The term "Linkage Disequilibrium" as used in the present invention means non-random association of alleles in two or more loci not necessarily on the same chromosome in population genetics. do. In other words, linkage disequilibrium is a measure of binding between alleles at different positions. If each gene is combined completely independently, the gene set will probably maintain linkage equilibrium, but some alleles are found together. There are many examples, that is, they are not randomly shuffled, and these alleles are in linkage disequilibrium. This linkage disequilibrium is interpreted to appear as a result of natural selection when alleles are located close to each other or if alleles are clustered together.

In addition, the present invention relates to a kit for determining the color of a cow comprising the composition for discriminating the color of the cow.

The composition may have the characteristics as described above. In one example, the composition is a single nucleotide polymorphism (SNP) in which the 101st base is T or C in a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;

SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;

SNP in which the 101st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;

SNP in which the 101st base is C or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; And

The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 may include an agent capable of detecting or amplifying any one or more SNP selected from the group consisting of SNP having 101 or A base C.

In addition, the agent capable of detecting or amplifying the polynucleotide is a preparation capable of specifically recognizing and binding to a site containing the SNP in the polynucleotide, or a product capable of amplifying the site containing the SNP, specifically May be a probe capable of specifically binding to the site containing the SNP, a polynucleotide containing the site containing the SNP, or a primer capable of specifically amplifying a complementary polynucleotide thereof.

The kit may be a PCR kit, a kit for DNA analysis, but is not limited thereto.

The kit of the present invention can be confirmed by amplifying the genotype of the SNP marker provided by the present invention using the above composition. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

For example, RT-PCR kits include tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary) in addition to specific primer pairs for polynucleotides or complementary polynucleotides thereof that contain the SNP-containing site. , Enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water. Meanwhile, the components included in the kit may be manufactured in a liquid form, or may be manufactured in a dried form in order to improve the stability of the product by lowering the degrees of freedom of the components. In order to manufacture the dried form, application of a drying step is required, and at this time, heating, natural drying, vacuum drying, freeze drying, or a combination process thereof may be used.

In the present invention, when applied to a PCR amplification process, "kit" is, optionally, a reagent required for PCR amplification, such as a buffer, a DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermally stable DNA polymerase obtained from Thermisflavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit can be made of a number of separate packaging or compartments containing the reagent components described above.

In addition, the present invention is 1) polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of the sample isolated from cattle, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Any one or more polynucleotides selected from the group consisting of polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 4, polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 5, and polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 6, or Amplifying the region containing the SNP of the complementary polynucleotide,

The SNP is the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 1, the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3 , 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, step; And

2) providing a method for discriminating cow's meat color, comprising determining the base type of SNP at the site containing the amplified SNP.

The step of amplifying the site containing the SNP of step 1) may be any method known to those skilled in the art. For example, it can be obtained by amplifying and purifying the target nucleic acid through PCR. Other ligase chain reactions (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), autologous sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA) can be used.

The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) is sequencing, hybridization by microarray, allele specific PCR, dynamic allele hybridization technique (dynamic allelespecifichybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis) It can be, but is not limited to.

In the method for determining the color of a cow according to the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 is T or C, it can be determined that the color or color of the cow is excellent.

In the method for determining the color of a cow of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 2 is G or A, it can be determined that the color or color of the cow is excellent.

In the method for determining the color of a cow of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 3 is G or A, it can be determined that the color or color of the cow is excellent.

In the method for determining the color of a cow of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 4 is A or G, it can be determined that the color or color of the cow is excellent.

In the method for determining the color of a cow of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5 is C or G, it can be determined that the color or color of the cow is excellent.

In the method for determining the color of a cow of the present invention, when the 101st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6 is A or C, it can be determined that the color or color of the cow is excellent.

In addition, in the present invention, when the meat color or meat color of the cow is excellent, it can be determined as high-quality meat.

In one embodiment of the present invention, the present inventors analyzed Korean beef coloration through GWAS analysis of 15,489,195 single-base polymorphic markers among 25,676,502 single-base polymorphism (SNP) markers present in the whole-genome sequencing data of 2108 Korean cattle. Six SNP markers highly related to and were selected and confirmed to be significant (see Examples, Tables 1 and 2).

Therefore, it is possible to accurately discriminate the chromogenic traits of cows using the composition for discrimination of cow's flesh, which includes an agent capable of detecting or amplifying the SNP of the present invention, and furthermore, it is possible to easily and accurately discriminate the high-quality meat.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples illustrate the present invention, and the contents of the present invention are not limited by the examples.

Example: Selection of Korean beef meat color SNP marker

Of the 25,676,502 single-base polymorphism (SNP) markers present in 2108 Korean cattle whole-genome sequencing data, 15,489,195 were passed the criteria of MAF value of 0.01 or higher, MWE value of 0.001 or higher, and R2 of 0.4 or higher. Single base polymorphism (SNP) markers were used for GWAS analysis.

Specifically, in order to select the Hanwoo meat color SNP markers related to the Hanwoo meat color trait, the 15,489,195 single base polymorphism (SNP) markers were analyzed using the analysis model of Equation 1 below. Association Study (GWAS) was conducted.

[Equation 1]

y = Xb + Zq + Wg + e

In the analysis model equation, y is a phenotype observation vector for an individual, X is a vector for a fixed effect (test order), b is an estimate vector for a fixed effect, Z is a random effect vector for an individual, q is a genotype for QTL Vector for fixed effect (fixed effect), g for additive genetic effect for marker effect, e for random error

Using the mixed linear model based association analysis (MLMA) and restricted maximum likelihood (REML) analysis methods, the significance of association between Korean beef meat traits and the 15,489,195 single nucleotide polymorphism (SNP) markers was determined. At this time, the sex and slaughter age, which had a large effect on the Korean beef color phenotype, were added and corrected.

Statistical software of GCTA (version 1.91, https://cnsgenomics.com/software/gcta/#Overview) was used to verify the significance of each selected Korean beef-colored SNP marker according to traits, and the characteristic of Korean-colored beef traits was the National Agricultural Cooperative Federation It was provided by an improvement office. Hanwoo meat color SNP markers for each trait were screened for a -log ₁₀ P-value of 6 or higher through a significance test.

As a result, the six Korean beef-colored SNP markers having the highest significance (SEQ ID NOs: 1 to 6) were selected (FIG. 1). The selected Korean beef color SNP markers showed high significance (P-value, -log ₁₀ P-value,% Vg) with Korean beef color traits (Table 1).

SNP ID chromosome location MAF Allele P-value -log ₁₀ P-value % Vg (genetic dispersion effect) rs134082813 2 53507272 0.153 T / C 0.00000000825 8.083546 5.7 rs207766300 2 9573053 0.019 G / A 0.000000814 6.089376 3.7 rs110365059 24 51436913 0.273 G / A 0.00000085 6.070581 4.3 rs208112592 24 51469591 0.28 A / G 0.00000126 5.899629 4.2 rs137372673 14 83349464 0.089 C / G 0.000000163 6.787812 4.5 rs382546607 14 82249097 0.271 A / C 0.000000257 6.590067 4.7

The base sequence of the Hanwoo meat color SNP marker for the production of the selected Hanwoo meat color SNP chip is described in SEQ ID NOs: 1 to 6 (Table 2).

SNP ID Sequence Sequence number rs134082813 AGTACATCTCTCAAACACAAATTTATATCCCTCTCTCTCAGCTCTTTCTTAAATTGACATTTATACACTGAATAACATCACTATAAATTTTTGCACTACT [T / C] TGTACCCAAAGCCGAAAAAAAAAAAGAAAAGAAATTAGGCAATGTGTGTGAGTCCATGTGCTTACGCCATTATGCTAGTGAA One rs207766300 GAACAGTGTGAGGAAAAGACTGCAAAGGGTTAGGTTCCGCTATCTTGAAGCAGCAATCTTCCAAAGACAGTGGAGCAGGTCTGCTAACTGGGTCCTCTAG [G / A] ATTCCTGCCTTTTACAGTCTGCTTTTTCAGCCTTCCCTAGGATCCTGCAAACTCCTGATATCCTACTCAT 2 rs110365059 CTTGGAGAGTGTGGTTTGCTACGCCCAAAGGCTCATCAGTTTGGGAAAATAAAGCCGTTTGCCACAGTTTAATCCCATTAGAGATGTAGCTTCGAGTACC [G / A] GTGCTTTTTATTCCTTCCTTTCCCAGCGTCCTCTTTTCTGCTCTGTCTTTTCTTCCTTCCTCCTTCCCCAACTAAAATC 3 rs208112592 ATTTTCCAGGCAAGAATACTGAAATGGGTTGCCATTTCCTTCTCCAGGAGACCTTCCTGACCCAGGGATTGAACCTGGGTCTCCTGCATTGTAGGCAGAC [A / G] CTTTACCGTCTGAGCCACCAGGGAAGTCCCATTGGGTATAGTTTAATTCAGGCCTTGTTAACTGCAAGAACAAGTCAG 4 rs137372673 AGCATCAATTCTTTCACACTCAGCCTTCTTCACAGTCCAACTCTCACATCCATGCTAATTAACAGCACTCTTGCTGTGTCTCCATTACTTGGGTTCTGTT [C / G] CAAAACTTCTATTGTATCTTGGCTCCTCCTGTCTCTTCGGAACAGCCCCTCAGACCTGTGTTCTAAAGGCTGTGCTGGGA 5 rs382546607 CAATCCAGGACTTAAAAGTGTGCTTTTCAAAAGCTATATGGATATTTTTATCCACATTTTAAATGTACACAATGCTATAGAGTCAGATTGTGTTTATTTT [A / C] TATATTTTAAAGGTTTAAATAAGCAAAAGTTTCAAAATTGAATATCAATATCTTTTTTTCAAAATGATACTTTGATTATTATATATTATGTAT 6

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for determining the color of a bovine including an          agent capable of detecting or amplifying SNP <130> 2018P-12-017 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 1 <400> 1 agtacatctc tcaaacacaa atttatatcc ctctctctca gctctttctt aaattgacat 60 ttatacactg aataacatca ctataaattt ttgcactact tctgtaccca aagccgaaaa 120 aaaaaaagaa aagaaattag gcaatgtgtg tgagtccatg tgcttacgcc attatgctag 180 tgccaaaagg cgttaaaaaa at 202 <210> 2 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 2 <400> 2 gaacagtgtg aggaaaagac tgcaaagggt taggttccgc tatcttgaag cagcaatctt 60 ccaaagacag tggagcaggt ctgctaactg ggtcctctag gaattcctgc cttttacagt 120 ctgctttttc agccttccct aggatcctgc aaactcctga tatcctacta catatttcta 180 attatccaaa ctctgctcct gt 202 <210> 3 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 3 <400> 3 cttggagagt gtggtttgct acgcccaaag gctcatcagt ttgggaaaat aaagccgttt 60 gccacagttt aatcccatta gagatgtagc ttcgagtacc gagtgctttt tattccttcc 120 tttcccagcg tcctcttttc tgctctgtct tttcttcctt cctccttccc ctcctcctct 180 ttaccaaaaa atcaggtata aa 202 <210> 4 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 4 <400> 4 attttccagg caagaatact gaaatgggtt gccatttcct tctccaggag accttcctga 60 cccagggatt gaacctgggt ctcctgcatt gtaggcagac agctttaccg tctgagccac 120 cagggaagtc ccattgggta tagtttaatt caggccttgt taactgcaag aacagaaacc 180 tatcagacta gtccagagat aa 202 <210> 5 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 5 <400> 5 agcatcaatt ctttcacact cagccttctt cacagtccaa ctctcacatc catgctaatt 60 aacagcactc ttgctgtgtc tccattactt gggttctgtt cgcaaaactt ctattgtatc 120 ttggctcctc ctgtctcttc ggaacagccc ctcagacctg tgttctaaag gctgtgctct 180 ggactggagt cctcagaaaa tc 202 <210> 6 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> # 6 <400> 6 caatccagga cttaaaagtg tgcttttcaa aagctatatg gatattttta tccacatttt 60 aaatgtacac aatgctatag agtcagattg tgtttatttt actatatttt aaaggtttaa 120 ataagcaaaa gtttcaaaat tgaatatcaa tatctttttt tcaaaatgat actttgatta 180 ttattatctt agaattttat gt 202

Claims (8)

Single nucleotide polymorphism (SNP) in which the 101st base is T or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;
SNP in which the 101st base is G or A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
SNP in which the 101st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP in which the 101st base is C or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; And
Comprising a base sequence of SEQ ID NO: 6 in the polynucleotide 101 is A or C SNP containing a formulation capable of detecting or amplifying a composition for discrimination of Korean beef.
delete According to claim 1, The agent capable of detecting or amplifying the SNP is a primer or probe, a composition for discrimination of Korean beef.
Kit comprising the composition of claim 1, to determine the color of Korean beef.
delete 1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 from the DNA of a sample isolated from Korean beef, SEQ ID NO: 4 As a step of amplifying a portion comprising the SNP of a polynucleotide consisting of a nucleotide sequence, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 5 and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 6 or a complementary polynucleotide thereof,
The SNP is the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 1, the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the base 101 of the polynucleotide consisting of the base sequence of SEQ ID NO: 3 , 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 and 101 base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, step; And
2) determining the base type of SNP at the site containing the amplified SNP, a method for discriminating meat color in Korean beef.
delete According to claim 6, When the base 101, the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C,
When the base 101, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, is G or A,
When the base 101 of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is G or A,
When the base 101, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, is A or G,
When the base 101 of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 5 is C or G, or
When the base No. 101, which is the SNP of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 6, is A or C, it is judged that the color of the Korean beef is excellent, and the method for determining the color of the Korean beef.

Images