KR20170053284A - Low-density SNP chip considering the economic costs in Berkshire - Google Patents
Low-density SNP chip considering the economic costs in Berkshire Download PDFInfo
- Publication number
- KR20170053284A KR20170053284A KR1020150155585A KR20150155585A KR20170053284A KR 20170053284 A KR20170053284 A KR 20170053284A KR 1020150155585 A KR1020150155585 A KR 1020150155585A KR 20150155585 A KR20150155585 A KR 20150155585A KR 20170053284 A KR20170053284 A KR 20170053284A
- Authority
- KR
- South Korea
- Prior art keywords
- variety
- snp
- pig
- kit
- probe
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Materials For Photolithography (AREA)
- Cosmetics (AREA)
Abstract
Description
The present invention relates to a low-density SNP chip which considers the economic cost of discriminating pig brecker varieties using single base polymorphic markers.
The swine industry accounts for about 42% of the total production value of the livestock industry, which is 5.5 trillion won. However, it is expected to suffer great damage by the conclusion of an FTA, because it has an unfavorable structure of 50 ~ 60% of the pig farming industry in advanced countries. The number of survivors has increased from 9.9 to 10.5 in the last 10 years. Therefore, in order to maximize the efficiency of breeding pig breeds and compete with the advanced breeding market, practical application of genome selection technology is very urgent.
Since the 1970s, the rapid development of biotechnology and genomic sequencing technology has enabled mass sequencing, and it has become possible to produce large SNP chips covering the entire chromosomes by locating these large SNP markers. In the case of pigs, Illumina porcine 60K, and recent 70K SNP chips were developed. The accuracy of each individual's pedigree information is very important in improving and selecting such genome information.
However, the cost of analyzing large SNP chip genotypes may still be burdensome at the commercial level. Therefore, it is required to develop a low density SNP chip with only a small number of SNPs, minimize the cost, and apply it to breeding improvement based on this.
It is an object of the present invention to provide a composition for distinguishing a pork breccia variety, considering economic costs, using a single base polymorphism marker.
It is another object of the present invention to provide a kit or a microarray comprising the composition for discriminating the breed of the present invention.
It is still another object of the present invention to provide a method for distinguishing a pork brecker variety using the kit or the microarray for identifying the pork brecker variety.
In order to achieve the above object, the present invention provides a composition for distinguishing a pork brecker variety comprising 1479 single nucleotide polymorphism marker groups represented by SNP names and probes capable of hybridization.
In addition, the present invention provides a kit for discriminating pig breccia cultivars comprising the above-described composition for distinguishing a Pork Burksher variety.
In addition, the present invention provides a microarray for discriminating pig brekfast cultivars comprising the composition for discriminating the breed of the present invention.
The present invention also provides a method for identifying a single nucleotide polymorphic marker group of a nucleic acid molecule isolated from a porcine animal using the kit or the microarray for identifying a Pfr. The present invention provides a method for distinguishing a Pork Burkhörter variety including a step of discriminating a Pork Burkhusher variety.
The present invention has the effect of minimizing the cost and high discrimination accuracy in discriminating pig brecker variety using a single base polymorphism marker.
FIG. 1 shows Imputation Error Rate Average according to each analysis method for developing a low-density SNP chip for discriminating the Berkshire variety according to the present invention.
Hereinafter, the configuration of the present invention will be described in detail.
The present invention relates to a composition for identifying a pork brecker variety, which comprises a group of 1,479 single nucleotide polymorphism markers represented by the SNP name and a probe capable of hybridization.
As used herein, the term " single nucleotide polymorphism " (SNP) means that one of the nucleotide sequences consisting of A, T, C, and G on the genome is changed to another nucleotide sequence.
As used herein, the term " marker " refers to a material that constitutes a low-density SNP chip for discriminating pig breccia varieties and includes an analogy of high-density SNP chips through inputation. The marker comprises 1,479 polynucleotides.
According to one embodiment of the present invention, a SNP marker capable of discriminating a Pork brecker variety can be selected through the following process.
We analyzed the genotypes using high density Illumina porcine 60k chip in the data of finishing pig breeders of breeding breeders, and analyzed them using the high density Illumina porcine 62,123 SNP array in Berkshire varieties. Three QCVs (Quality Control) are performed for each SNP, and SNPs of -log (p-value) less than 3 are removed by Hardy-Weinberg equilibrium (HWE) test. The call rate eliminates the SNPs of individuals and SNPs that do not exceed 90% based on the missing data frequency of the collected genotypes. A total of 1200 individuals and 51,709 SNPs were set up. To set up the Test Panel and the Reference Panel, select the first object through random selection for 200 test panels, select the object at regular intervals, and set the Reference Panel for 1,000 panels. Among the genotypes of 200 test panels, only 500, 1000, 1500 and 2000 SNP information are left for each analysis and the rest are missed. The SNPs selected here are extracted randomly within the precursor chromosome. Imputation is performed using the Beagle program to estimate the genotype of two Test Panel 200 using the information in the Reference Panel. In order to confirm the agreement with the previously measured genotypes, the genotype data of the Imputation completed test panel is compared with the existing data to perform the accuracy test.
As a result of the accuracy measurement, the minimum concordance rate was about 79%. For proper low-density SNP chips, the imputation success rate should be at least 90% and 1,479 out of 2,000 SNPs will be selected.
As used herein, the term "SNP designation" refers to the reporter name disclosed in the database of Illumina Porcine SNP 60 BeadChip (WG-410), wherein the database contains the location and sequence of SNPs and their nucleotide sequences in Table 2 As will be appreciated, those skilled in the art can readily ascertain from the database via the SNP name. Thus, in order to avoid overstatement of the specification, the SNP name is used in the claims, but is considered a category understandable at the level of the skilled person.
As used herein, the term "probe" means a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. The hybridization may be implemented by detecting or amplifying SNP markers. Preferably, the probe may include a primer capable of specifically amplifying a mutation site of a gene, an aptamer capable of generating a detectable signal through hybridization, or a complementary polynucleotide.
The probe may be a perfectly complementary sequence to a sequence containing the SNP of the present invention, but a substantially complementary sequence may be used to the extent that it does not interfere with the specific hybridization.
The term "primer" means a base sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template, and functions as a starting point for template strand copying Quot; short sequence " The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. At this time, the PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art.
The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
Also, a probe polynucleotide for detecting the SNP marker capable of generating a detectable signal through the hybridization means an oligonucleotide capable of binding sequence-specifically to the complementary strand of the nucleic acid. The probe polynucleotide of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member, I never do that. In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used for a method of discriminating a Berkshire variety of pig by detecting an allele. Such discrimination methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form preliminarily bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization can usually be performed under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher. For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 < 0 > C may be suitable for allele-specific probe hybridization.
The present invention also relates to a kit for the identification of a pig breccia variety, which comprises the composition for distinguishing the breed of the present invention.
The kit may be an RT-PCR kit or a kit for DNA analysis (e.g., a DNA chip).
The kit of the present invention can identify a pork Burkhörer variety by confirming the amplification of a SNP marker, which is a marker for discriminating a pork Burkshir variety.
In one embodiment, the pork brecker variety identification kit of the present invention may be a kit containing the necessary elements necessary to perform RT-PCR for SNP marker amplification. In addition to the respective primer pairs specific for the SNP markers, the RT-PCR kit also includes RT-PCR kits that include test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs) Enzymes such as lyase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control.
In addition, the kit of the present invention may be a pork brecker variety discrimination kit containing essential elements necessary for carrying out a DNA chip. A DNA chip kit refers to one of DNA microarrays capable of confirming each base of hundreds of thousands of DNAs at a time, and is usually composed of a flat solid support plate (or a solid support), a nucleic acid species In which a nucleic acid is uniformly arranged on the surface of the chip and a hybridization reaction occurs between the nucleic acid on the DNA chip and the complementary nucleic acid contained in the solution treated on the chip surface, It is a tool that enables parallel analysis.
Preferably, the DNA chip of the present invention may be a low-density SNP chip.
The present invention also provides a microarray for discriminating pig brekfast varieties comprising the polynucleotide of the SNP marker for identifying the breed of the present invention.
The microarray may comprise DNA or RNA polynucleotides. The microarray consists of a conventional microarray except that the probe polynucleotide comprises the polynucleotide of the present invention.
Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art.
The process of immobilizing the probe polynucleotide associated with the pig breccia variety discrimination of the present invention on a substrate can also be easily carried out using this conventional technique.
In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. For example, the detection may be performed by, for example, labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, then hybridizing on the microarray, detecting a signal generated from the labeling substance, can do. The fluorescent material may be selected from the group consisting of Pyrene, Texas red, fluorescein, BODYPY, Trtramethylrhodamine, Alexa, Cyanine, allopicocyanine, Blue, nil red or other fluorescent material capable of generating fluorescence may be used. Further, a fluorescent substance having a high quanta yield can be used. It may also be a hydrophilic or hydrophobic dye.
The present invention also relates to a method for identifying a single nucleotide polymorphic marker group of a nucleic acid molecule isolated from a porcine animal using the kit or a microarray for identifying a porcine Berkshire variety and, when the presence of the single nucleotide polymorphic marker group is confirmed, The present invention relates to a method of distinguishing a pork brecker variety including a step of discriminating a breccia variety.
As used herein, the term "nucleic acid molecule" is intended to encompass both DNA (gDNA and cDNA) and RNA molecules, wherein nucleotides that are basic building blocks in nucleic acid molecules are not only natural nucleotides, Also included are analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).
The nucleic acid molecule can be obtained from various sources of porcine individuals, for example, from muscle, epidermis, blood, bone, organs, and most preferably from muscle or blood.
When the starting material in the method of the present invention is gDNA, the separation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (1987); and Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Because the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such a sequence characteristic (see PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press )).
The step of amplifying the polymorphic site of the SNP marker from the nucleic acid molecule may be performed by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sequence amplification based on nucleic acids (NASBA) can be used as well as self-sustaining sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)).
Among the above methods, the base of the amplified polymorphic site is determined by sequence analysis, microarray hybridization, allele specific PCR, dynamic allele-specifichybridization (DASH) PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg MassenRAY system of Sequenom), mini-sequencing method, Bio-Plex system Such as BioRad, CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium analysis) But is not limited thereto. Or by other methods available to those skilled in the art to which the present invention pertains. The base at such a mutation site can be determined preferably through a DNA chip.
Further, the detection of the SNP marker can be confirmed from the signal detection by the hybridization of the probe immobilized on the solid support and the nucleic acid molecule separated from the porcine body using the above-described detection method using the probe polynucleotide.
Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Is provided to fully convey the scope of the invention to those skilled in the art, and the invention is only defined by the scope of the claims.
< Example 1> Collecting Pig Samples
The samples were collected from 1,200 finishing pigs in the breeding group of black fowl, 361 in 2013 at Sunchon National University, and genotype analysis was performed with high density Illumina porcine 60k chip.
Example 2: Low density SNP chip discovery method
The Berkshire collected in Example 1 above was analyzed using high density Illumina porcine 62,123 SNPs arrays. Three QCs (Quality Control) were performed for each SNPs. The Hardy-Weinberg equilibrium (HWE) test was used to remove SNPs with a log-p (p-value) of 3 or less. Finally, the call rate was reduced to less than 90% based on the missing data frequency of the genotypes collected for each individual and each SNPs.
A total of 1,200 individuals and 51,709 SNPs were finally used.
A total of 1,200 test and reference panels were divided into two groups. The test panel selected randomly selected 200 individuals and randomly selected the first individual. For the remaining 1,000, the reference panel was used.
Among the genotypes of 200 test panels, only 500, 1000, 1500 and 2000 SNP information were left for each analysis and the rest were missed. The SNPs selected here were extracted randomly within the precursor chromosomes. Imagination was performed using the Beagle program to estimate the genotypes of two Test Panel 200 using the information in the Reference Panel. In order to confirm the agreement with the previously measured genotypes, the genotype data of the Imputation completed test panel was compared with the existing data and the accuracy test was performed.
As a result of the accuracy measurement, the minimum concordance rate was about 79%. For proper low-density SNP chips, the imputation success rate was at least 90% and 1,479 out of 2,000 SNPs were selected and used in low-density SNP chips.
Results according to each analysis method are shown in Table 1 and FIG.
The SNP nucleotide sequences of the low-density SNP chips obtained through this experiment are shown in Table 2 below. In Table 2, [A / G] means that base A is a SNP mutated to base G. [C / T] also means that base C is a SNP mutated to base T.
CTTCCCACTCGGCCTTGCTGGAGAG [C / T] GAAACTCTTACTAACATTAACTAGA
Claims (9)
H3GA0000026, ASGA0000091, M1GA0000288, H3GA0000320, M1GA0000233, ASGA0000453, M1GA0000547, H3GA0000596, SIRI0000226, M1GA0000742, M1GA0000759, ASGA0089621, ASGA0103410, M1GA0000775, H3GA0000902, H3GA0000953, M1GA0000819, ASGA0089650, ASGA0001198, ALGA0001244, ALGA0001746, ASGA0001664, ASGA0001719, ASGA0001772, ASGA0001819, M1GA0000866, INRA0001175, INRA0001627, ASGA0002159, ALGA0002507, ALGA0002568, ALGA0108847, ALGA0002618, ALGA0002648, ALGA0002697, ALGA0002853, H3GA0001567, ASGA0002567, ALGA0003024, ALGA0003075, ASGA0002618, ASGA0002640, ALGA0002798, ASGA0002727, ASGA0002778, ALGA0003412, ASGA0092170, ALGA0003523, ASGA0002948, ALGA0003655, ALGA0003091, ALGA0003119, ASGA0003143, ASGA0003194, ALGA0003339, ALGA0105914, ALGA0110231, H3GA0001938, DIAS0000563, ALGA0003538, ALGA0003751, ASGA0003159, ASGA0003164, ALGA0109685, ALGA0004503, ASGA0003617, ASGA0003638, ALGA0003972, ALGA0003918, H3GA0002192, ALGA0004766, H3GA0052986, ASGA0003807, ALGA0004945, ALGA0005004, H3GA0002102, ALGA0005102, ASGA0004014, DIAS0002710, ALGA0004558, ALGA0005361, INRA0003660, M1GA0001095, ALGA0004819, ALGA0005560, ALGA0005599, ASGA0004314, H3GA0002625, ASGA0100276, INRA0004013, ALGA0005270, ALGA0005805, ALGA0005302, ASGA0004115, INRA0004137, ALGA0005418, ALGA0005978, ASGA0004563, H3GA0002800, ALGA0006083, INRA0004329, ALGA0006113, ALGA0006154, INRA0004426, DIAS0001921, ALGA0006259, ALGA0006302, ALGA0006405, ASGA0004898, INRA0004790, ASGA0105823, ASGA0004598, INRA0004962, ASGA0005040, ALGA0006773, ASGA0005172, ASGA0005207, ALGA0006920, H3GA0003330, INRA0005278, DIAS0000673, ASGA0004881, H3GA0003379, ALGA0007150, ALGA0007180, ASGA0005405, INRA0005458, H3GA0003428, ALGA0007311, ALGA0007326, ALGA0007355, ALGA0113555, ASGA0005514, DIAS0002061, H3GA0003153, ASGA0005093, SIRI0001496, H3GA0003235, ASGA0005243, ALGA0007591, ALGA0006973, INRA0005815, ALGA0007707, INRA0005864, ALGA0007762, ALGA0007793, ALGA0007819, ASGA0005361, ALGA0007873, ALGA0007188, ASGA0005406, ALGA0007958, H3GA0003731, ALGA0007362 , ALGA0008172, ALGA0113685, ALGA0008263, H3GA0003811, ALGA0008356, H3GA0003854, INRA0005726, ALGA0007557, H3GA0003952, ALGA0008635, ASGA0005581, ALGA0007616, INRA0006750, ASGA0006427, DIAS0000008, ALGA0009009, H3GA0004253, ALGA0009241, ALGA0009308, ALGA0009424, M1GA0001479, ALGA0009612, H3GA0004547, ASGA0007200, H3GA0055689 , ASGA0005807, ASGA0007364, H3GA0004815, H3GA0004855, H3GA0004899, ALGA0010541, H3GA0003815, INRA0006383, M1GA0001790, ASGA0008049, H3GA0005387, ALGA0011079, H3GA0005443, ASGA0006209, DIAS0004421, ALGA0009213, ALGA0009596, ASGA0007292, ALGA0101433, ASGA0093496, H3GA0004988, DIAS0000769, ASGA0008254, ALGA0123970, ALGA0117402 , ALGA0110785, ASGA0008604, M1GA0002408, CASI0008622, ASGA0009021, ASGA0008665, ALGA0012049, ALGA0012152, H3GA0006122, ASGA0009491, DIAS0000337, H3GA0006271, ALGA0012559, ALGA0012743, ASGA0009814, ASGA0009847, ASGA0105635, ALGA0012964, ALGA0012985, ALGA0013017, ASGA0009952, ALGA0013106, ASGA0009979, ALGA0013217, ALGA0013427 , ALGA0013585, H3GA000674 3, ALGA0107251, ASGA0009830, ASGA0010484, ALGA0013976, H3GA0006912, H3GA0006944, H3GA0006967, ALGA0014165, ALGA0014214, ALGA0117539, M1GA0003006, H3GA0007151, M1GA0003027, ASGA0010249, H3GA0007213, ALGA0014620, ASGA0095968, INRA0009187, ALGA0118004, ALGA0014887, ALGA0108058, ASGA0011308, ASGA0011456, ASGA0011563, ALGA0015558, H3GA0007606, ALGA0108179, ASGA0011900, ALGA0015991, ASGA0012080, ALGA0106490, ALGA0016329, ALGA0013966, ALGA0016578, H3GA0008060, ALGA0016883, H3GA0008275, H3GA0006905, ALGA0014200, ASGA0097368, ASGA0011053, ALGA0014972, ASGA0011283, ALGA0115695, ALGA0119834, ASGA0103793, DIAS0003483, ASGA0011818, ASGA0011937, ASGA0104575, ALGA0105738, DIAS0003825, ALGA0118922, H3GA0053178, M1GA0024073, ALGA0120374, ASGA0093527, ALGA0114651, ALGA0106902, ASGA0094169, H3GA0052415, ASGA0085878, ALGA0017050, ASGA0012981, ALGA0017312, H3GA0056245, ALGA0017593, ASGA0013544, ASGA0093049, ASGA0103230, ASGA0013696, ALGA0017905, H3GA0056202, ALGA0018038, ALGA0018313, ALGA0018401, ASGA00142 13, ALGA0018516, ASGA0090008, M1GA0004305, ALGA0107078, ALGA0018863, ALGA0018904, ASGA0099661, ASGA0084261, H3GA0009550, ALGA0019110, ALGA0019129, H3GA0009638, ASGA0014784, M1GA0004422, ASGA0014878, ASGA0097395, ASGA0103234, ALGA0124353, INRA0010830, SIRI0001006, INRA0010853, INRA0010895, ASGA0015188, ASGA0083680, ALGA0019935, INRA0011042, ASGA0015478, ALGA0020343, H3GA0009339, ASGA0015611, ALGA0109278, ASGA0015813, ALGA0020763, SIRI0000008, H3GA0009538, ALGA0021199, ALGA0124343, ALGA0021376, ASGA0016574, DRGA0004296, ALGA0111911, ALGA0122273, ASGA0098950, ASGA0089074, DRGA0017696, ALGA0114825, DIAS0001544, ALGA0120420, H3GA0010219, ASGA0097737, ASGA0015833, ASGA0015988, ALGA0021092, H3GA0010676, H3GA0010704, ALGA0021307, H3GA0053652, ASGA0016728, H3GA0052445, ALGA0110057, ASGA0102422, ALGA0107834, ALGA0105955, ALGA0115511, ASGA0017011, M1GA0005199, M1GA0005374, ASGA0017426, ASGA0017588, ALGA0022450, ASGA0017723, ALGA0022944, ASGA0018166, ALGA0022974, ALGA0023358, H3GA0012015, H3GA0012 096, ASGA0018487, ALGA0023632, ASGA0082347, ASGA0018712, ALGA0103991, ALGA0023865, ALGA0023935, ASGA0018851, ASGA0019036, INRA0013282, ASGA0019027, H3GA0012397, ASGA0019102, ALGA0024316, INRA0013533, H3GA0012430, M1GA0005843, ALGA0024629, INRA0013780, H3GA0012605, ASGA0019537, ALGA0024877, ALGA0024892, INRA0014033, INRA0014071, INRA0014097, INRA0014142, ASGA0019705, ALGA0025237, ALGA0025325, INRA0014382, ALGA0025456, ALGA0025503, H3GA0012878, INRA0014643, ALGA0025780, ASGA0020169, ALGA0025931, ALGA0026033, H3GA0013118, M1GA0005933, INRA0015178, ALGA0026261, INRA0015296, ALGA0026433, ASGA0020687, ALGA0026256, INRA0015510, ASGA0020859, ASGA0020902, ASGA0020965, ALGA0026876, ALGA0026925, ALGA0027129, ALGA0027200, INRA0015922, ALGA0027343, M1GA0006238, ASGA0021487, CASI0009314, ALGA0027075, ALGA0027648, ASGA0021732, ASGA0021775, M1GA0025325, ASGA0092192, ASGA0022017, ASGA0022077, DIAS0003038, INRA0016754, ALGA0027905, ALGA0028731, ALGA0028802, ALGA0028858, ALGA0028943, ASGA0083911, ASGA002 2943, ALGA0029310, ASGA0022387, M1GA0006769, DIAS0002972, ASGA0023397, ASGA0023445, SIRI0000293, ALGA0029781, H3GA0014703, ASGA0090553, ASGA0023698, ASGA0089536, ASGA0023919, ALGA0030074, H3GA0015326, H3GA0015531, H3GA0015604, SIRI0000872, ALGA0030553, ALGA0030609, INRA0018569, ASGA0024642, ASGA0103112, ALGA0030663, ASGA0024935, ASGA0025006, ASGA0082212, ALGA0031303, ASGA0085273, ALGA0031344, ASGA0025400, ALGA0031748, ALGA0031843, ALGA0031866, ALGA0031753, ALGA0032094, DIAS0000586, ALGA0031842, ALGA0032367, ALGA0031885, DIAS0002410, H3GA0016899, ALGA0033160, ALGA0033199, DIAS0000387, ASGA0026573, ASGA0026641, ALGA0033413, M1GA0007840, ALGA0033636, ALGA0033673, M1GA0007944, ALGA0032662, ASGA0027078, ASGA0026243, ALGA0034166, ASGA0027346, ALGA0032949, M1GA0008041, ASGA0091172, ALGA0118913, DIAS0000383, ALGA0110430, DIAS0002318, ALGA0033778, DRGA0017392, ASGA0027253, ASGA0089262, ALGA0112228, DIAS0001800, ASGA0027745, ALGA0034835, ALGA0034871, ASGA0100505, ALGA0034984, M1GA0008432, H3GA00 17523, ALGA0104612, H3GA0017889, ALGA0119039, ASGA0101598, ASGA0103831, ASGA0096575, ASGA0027633, H3GA0018177, ASGA0028579, ALGA0035690, ASGA0094960, ALGA0035847, ASGA0028841, ASGA0028870, ALGA0109856, ASGA0094908, H3GA0018528, DIAS0001073, ASGA0027821, ASGA0027723, ALGA0036399, ASGA0087096, ASGA0085552, ALGA0115970, H3GA0018823, ASGA0029460, ASGA0029573, ALGA0036989, ALGA0103009, ASGA0029647, ALGA0105590, H3GA0054966, ASGA0098610, INRA0022567, ALGA0037277, DIAS0001476, ALGA0037484, ALGA0118476, INRA0022797, ALGA0124503, ASGA0103241, ALGA0103984, ASGA0097167, M1GA0009140, ALGA0119904, ASGA0095441, ALGA0122541, DIAS0000184, CASI0002112, ASGA0092766, ALGA0116054, ASGA0087502, ALGA0101657, ASGA0094634, ASGA0098132, ALGA0113190, ASGA0094523, ALGA0119092, ALGA0114685, ALGA0103876, ALGA0123484, ASGA0105896, ASGA0029336, SIRI0000456, ASGA0099060, ALGA0123444, ALGA0116426, H3GA0018917, ASGA0029632, ALGA0037119, ALGA0119214, ASGA0098750, ASGA0092330, ALGA0112970, ASGA0099428, H3GA0052862, ASGA0 101680, ALGA0116372, ASGA0084182, ASGA0030408, H3GA0019406, ASGA0030544, ASGA0030638, H3GA0019660, ASGA0030861, ALGA0038367, ASGA0031009, H3GA0019871, ASGA0031245, ALGA0038747, M1GA0009643, ALGA0038953, H3GA0020133, ALGA0039074, ALGA0039144, DRGA0007304, ALGA0039254, ASGA0031780, ASGA0031851, ASGA0031942, H3GA0020408, ALGA0039771, H3GA0020592, ASGA0032257, M1GA0009900, H3GA0020700, H3GA0020849, ALGA0040370, ASGA0032705, M1GA0010063, H3GA0020954, H3GA0021066, ASGA0033013, H3GA0021198, ALGA0040859, M1GA0010230, ASGA0033261, ALGA0041077, ALGA0041156, ASGA0098543, ASGA0033485, ALGA0041370, H3GA0021499, ASGA0033771, DIAS0002119, M1GA0010399, M1GA0010406, ASGA0034120, DIAS0000612, ALGA0042239, INRA0026187, ASGA0034309, ALGA0042347, ALGA0042378, H3GA0021993, ALGA0042427, DIAS0000140, CASI0005881, BGIS0000098, INRA0026529, ASGA0034525, ASGA0034554, ALGA0042894, ALGA0042919, ALGA0043063, H3GA0022261, ALGA0043292, ALGA0043398, ASGA0035125, H3GA0022409, ALGA0043572, ALGA0043644, ALGA0043838, ASGA 0035365, ALGA0043860, H3GA0022615, INRA0027605, ALGA0044069, ASGA0035590, ALGA0044087, H3GA0022804, ASGA0035823, ASGA0035864, ASGA0035957, ALGA0044742, ALGA0044856, H3GA0023120, ALGA0044983, ASGA0036491, M1GA0010866, ASGA0036665, ALGA0045365, H3GA0023523, M1GA0011041, H3GA0023580, M1GA0011155, ASGA0037232, ALGA0045896, M1GA0011542, ALGA0102137, ASGA0037429, ASGA0037662, ALGA0046395, ASGA0037879, ASGA0102322, ASGA0101222, M1GA0011821, ASGA0038091, ASGA0092148, H3GA0024523, ALGA0047034, H3GA0054129, ASGA0038287, H3GA0024605, ALGA0119178, H3GA0024739, ASGA0038639, ASGA0038666, BGIS0004952, ASGA0099602, ASGA0089983, ASGA0097635, H3GA0024526, ASGA0105183, ASGA0038843, M1GA0011866, ASGA0038876, ALGA0048059, ASGA0102686, ASGA0038965, ASGA0092536, ASGA0093261, ASGA0088957, ASGA0039113, ASGA0104555, ALGA0048538, ALGA0048597, INRA0030111, ALGA0101778, ASGA0039397, ALGA0048786, H3GA0024861, ASGA0039519, ALGA0049130, ALGA0049219, MARC0083052, ALGA0049326, ASGA0039774, H3GA0025435, ALGA0049519, ALG A0049610, ASGA0040002, ASGA0040047, ALGA0049871, ALGA0049957, ALGA0050272, ALGA0109302, ALGA0115967, M1GA0025365, ALGA0124080, ALGA0105930, H3GA0025183, ASGA0100149, ALGA0048805, ALGA0111705, ALGA0112879, ASGA0039582, ALGA0110747, ALGA0104546, DRGA0017605, ALGA0108646, ALGA0105059, DRGA0017396, ASGA0082187, ALGA0109193, ALGA0118463, ALGA0111816, ALGA0115708, M1GA0012285, ALGA0115828, ASGA0040905, ALGA0050939, M1GA0012669, H3GA0026518, ASGA0041661, ALGA0119387, H3GA0026659, ASGA0041863, ASGA0041962, ASGA0041401, DRGA0009218, CASI0009712, ALGA0051960, ALGA0052075, ASGA0042354, ALGA0052240, ALGA0113729, ASGA0042506, ASGA0105025, M1GA0012912, H3GA0027110, ALGA0051849, ASGA0042872, H3GA0027238, H3GA0027255, ALGA0105323, ALGA0052993, ALGA0053090, ASGA0084095, ASGA0097743, ALGA0053190, ASGA0043272, ASGA0089408, ALGA0053479, ASGA0043547, ASGA0043614, ASGA0043673, ASGA0092361, CASI0002698, ASGA0098451, ALGA0053893, ASGA0043850, ASGA0043883, ALGA0054014, ALGA0054112, DRGA0009573, H3GA0027212, AS GA0042948, H3GA0027919, H3GA0027937, ASGA0044106, ASGA0043131, ALGA0054518, ASGA0044272, ALGA0054650, ALGA0054705, ALGA0054752, ALGA0053309, ALGA0123594, H3GA0028172, ASGA0044519, ALGA0055054, ASGA0103766, ALGA0053558, DRGA0009854, ALGA0121035, ASGA0044872, ASGA0096819, ASGA0045039, ASGA0045135, ASGA0045220, ALGA0055947, ASGA0088640, ASGA0045531, ASGA0043822, ALGA0053993, ASGA0043917, ASGA0094390, ASGA0082120, SIRI0000798, ASGA0044098, ASGA0105731, H3GA0055302, ALGA0054896, ALGA0055139, ALGA0107987, ALGA0114627, ALGA0117819, ALGA0055940, ASGA0102282, ASGA0083137, ALGA0056248, ALGA0056382, ASGA0097841, ALGA0056587, H3GA0029068, ASGA0046300, CASI0000975, ALGA0057095, ASGA0046593, ASGA0046278, ALGA0057423, ALGA0057494, ALGA0057646, H3GA0056199, ASGA0092473, ALGA0121879, ALGA0103767, DIAS0004765, ALGA0058242, ASGA0047606, ASGA0049110, ALGA0058525, H3GA0030029, ASGA0083886, ASGA0084296, ALGA0057922, ALGA0059073, ALGA0059224, H3GA0030352, ASGA0047247, ASGA0100960, ALGA0103343, ALGA0059633, H 3GA0030621, ALGA0058420, ASGA0091392, H3GA0030080, ASGA0089200, ASGA0092634, ALGA0119532, ALGA0123578, ASGA0104307, ALGA0107850, ALGA0116778, ASGA0048596, ALGA0109580, ASGA0106223, ALGA0059853, ASGA0098785, H3GA0030844, ASGA0049179, ALGA0060306, ASGA0049456, ASGA0049515, ASGA0049553, ASGA0049706, ASGA0049606, ALGA0060847, H3GA0031403, ASGA0049951, ASGA0050108, ASGA0050173, H3GA0031555, ASGA0091162, ALGA0061441, ASGA0050421, ALGA0061574, H3GA0055621, ASGA0050290, M1GA0026237, INRA0036096, ALGA0061987, ALGA0113992, INRA0036442, ASGA0050895, ASGA0050910, ALGA0062389, SIRI0000315, ALGA0062506, ALGA0062552, ALGA0062659, ALGA0062840, ALGA0062892, ALGA0063105, ALGA0063227, M1GA0015222, ALGA0062433, H3GA0032448, ALGA0063736, ALGA0062534, ALGA0063875, H3GA0032639, SIRI0000656, ASGA0052271, INRA0038295, ALGA0062888, ALGA0112357, ASGA0051791, ASGA0089719, H3GA0032612, H3GA0032794, H3GA0032926, ASGA0052524, ALGA0064411, H3GA0033152, ASGA0084858, ASGA0052596, ALGA0115312, ALGA0064900, M1GA0025058, ASGA0084454, M1GA0026919, ASGA0053450, H3GA0033729, H3GA0033798, SIRI0000501, ASGA0053210, H3GA0034018, H3GA0034060, ALGA0065989, ALGA0065337, DIAS0000466, ALGA0110084, M1GA0016697, ALGA0066408, ALGA0103958, ALGA0066623, ALGA0066690, ALGA0066725, ASGA0091801, H3GA0034683, ALGA0066960, ALGA0112624, DIAS0003803, ASGA0102822, ASGA0055455, ALGA0065848, ALGA0113454, INRA0038984, H3GA0034289, ALGA0066360, ASGA0054736, ALGA0105621, ASGA0089419, ASGA0105124, H3GA0034675, ALGA0107728, ALGA0113456, ASGA0103858, ASGA0102924, ASGA0055572, ALGA0067437, ALGA0067450, ASGA0090538, ALGA0067672, H3GA0035335, ALGA0067806, ALGA0114264, DIAS0002939, ALGA0068271, ALGA0068398, ALGA0104605, ASGA0104530, ALGA0103810, ASGA0056658, ALGA0068966, ASGA0056791, ASGA0056827, ASGA0083922, ALGA0069329, H3GA0036102, ALGA0069410, ALGA0069484, ALGA0069594, ALGA0069635, DRGA0017663, ASGA0095634, ALGA0069874, ASGA0057446, H3GA0036408, H3GA0036112, ASGA0057575, ASGA0057629, H3GA0036541, ALGA0070387, ASGA0057820, ALGA0070563, ALGA0070606, ALGA0070642, ALGA0070680, H3GA0036708, ALGA0070775, ALGA0069868, ALGA0069890, H3GA0036867, ALGA0071057, BGIS0005898, H3GA0036989, H3GA0056611, ALGA0109628, ASGA0105877, ASGA0058512, H3GA0037137, ALGA0071614, ALGA0114853, ALGA0071695, ASGA0057925, ALGA0071754, ALGA0071780, ALGA0071802, INRA0040911, ASGA0058070, ALGA0071863, CASI0008206, M1GA0025421, ASGA0058802, ASGA0102308, ASGA0058881, H3GA0037351, ALGA0072144, ALGA0072213, DIAS0004292, ALGA0072331, ALGA0072358, ALGA0072415, H3GA0037495, H3GA0037527, ASGA0092621, ALGA0072608, ASGA0094149, CAHM0000041, ALGA0072874, INRA0040784, ALGA0072970, ALGA0073032, ASGA0058640, ALGA0073208, ASGA0059565, ALGA0073419, ALGA0071651, ALGA0071664, ALGA0073695, M1GA0017790, DIAS0001277, H3GA0038043, ALGA0074019, CASI0008722, ALGA0116224, ASGA0058814, ASGA0059007, H3GA0037597, ALGA0072768, ALGA0113284, M1GA0017731, ALGA0073188, ALGA0073298, ALGA0073370, ALGA0106242, ASGA0105649, ASGA0059943, ALGA0124060, DIAS0004550, H3GA0038201, H3GA0038239 , ALGA0123146, ASGA0091691, M1GA0018055, H3GA0038441, ALGA0074689, ALGA0074803, ASGA0061022, ALGA0075011, H3GA0038839, ALGA0075224, ALGA0075342, ASGA0061498, ASGA0061663, ASGA0061699, ASGA0061740, ALGA0075723, H3GA0039144, ALGA0075902, INRA0042962, ASGA0061973, H3GA0039341, ASGA0062118, H3GA0039422, ASGA0062144, ALGA0076538 , INRA0043343, ALGA0076660, ASGA0062422, ASGA0062551, M1GA0018494, ASGA0062621, INRA0043576, DRGA0013788, ALGA0076968, H3GA0039834, ALGA0077086, DIAS0002955, ALGA0119264, INRA0043833, ASGA0063113, H3GA0040014, INRA0043983, ASGA0063279, H3GA0040156, ASGA0063267, ASGA0063388, INRA0044092, ASGA0063565, INRA0044365, ALGA0078039 , ALGA0078299, ASGA0064072, ALGA0078379, DRGA0013981, ASGA0064065, ALGA0078590, INRA0044654, ALGA0078676, ASGA0064326, ALGA0078815, H3GA0040970, ALGA0079015, INRA0045035, ALGA0079138, H3GA0041107, ALGA0079199, ALGA0079240, ASGA0064841, ALGA0079389, ALGA0079416, ASGA0064937, ALGA0079568, ALGA0079687, DIAS0001234, ALGA0079905 , INRA0045780, ALGA008003 0, ASGA0065440, ALGA0080128, DIAS0004751, H3GA0041636, ASGA0065540, INRA0046307, ALGA0080609, ALGA0080725, ALGA0080825, INRA0046538, ALGA0080940, ASGA0066073, ALGA0080877, H3GA0042098, ASGA0066192, ASGA0066235, ASGA0066137, H3GA0042157, ASGA0066388, ALGA0081560, H3GA0042355, ALGA0081813, ALGA0081626, ASGA0066914, ALGA0082192, ASGA0067078, ALGA0082435, M1GA0019328, ASGA0067340, H3GA0042967, ALGA0082399, ASGA0067225, ASGA0067752, H3GA0043253, DIAS0001635, M1GA0020072, M1GA0019637, H3GA0043574, H3GA0043639, ALGA0083488, ALGA0103648, ALGA0083768, ALGA0083557, ASGA0068670, H3GA0043799, ALGA0084105, SIRI0001081, ASGA0093353, ASGA0069029, ASGA0069121, H3GA0043848, ALGA0084763, H3GA0043939, ALGA0084990, ASGA0068971, ASGA0096052, ALGA0085109, ALGA0084519, INRA0049257, ASGA0069526, ALGA0110144, ALGA0102797, ALGA0123278, ALGA0122159, ALGA0085618, ALGA0085682, INRA0049496, ALGA0085775, ALGA0085795, ASGA0069847, ALGA0085880, ALGA0085946, ASGA0069914, ASGA0069947, ASGA0069588, ALGA0104833, ALGA00862 41, INRA0049832, H3GA0044704, ASGA0070147, ALGA0086369, H3GA0044463, ASGA0070187, ALGA0085736, ALGA0119395, ALGA0086613, ALGA0086720, ALGA0085953, H3GA0045012, ASGA0070769, SIRI0000138, ALGA0087491, ASGA0071133, ASGA0071222, ALGA0087956, ALGA0116061, H3GA0045481, UMB10000052, ALGA0086355, ALGA0110636, ASGA0070246, ALGA0086631, ALGA0086800, ALGA0104428, H3GA0045081, ALGA0087535, CASI0004261, ASGA0071489, ALGA0109945, ASGA0089162, ALGA0123500, H3GA0045791, ALGA0088720, H3GA0045917, ALGA0088909, ALGA0089010, ALGA0120855, ALGA0116156, ALGA0088880, H3GA0045988, H3GA0046164, SIRI0000715, ALGA0105533, ASGA0072799, ALGA0089953, ALGA0089991, ALGA0090051, ASGA0103297, H3GA0046118, ASGA0073029, ALGA0090291, ALGA0116502, ALGA0090372, ASGA0073168, ALGA0117283, ASGA0072755, ALGA0090596, ALGA0123153, H3GA0046637, ALGA0090922, DIAS0003649, ASGA0073681, ALGA0091099, H3GA0046876, H3GA0046920, ALGA0091311, ALGA0091373, H3GA0046980, H3GA0047032, ALGA0091846, ALGA0091967, ASGA0074544, ASGA0074687, ALGA0090 686, ASGA0073415, ALGA0090995, ALGA0091078, ALGA0091572, ASGA0100134, ALGA0102977, ASGA0098928, ASGA0096434, H3GA0056580, ALGA0092509, ALGA0092574, ASGA0075006, ASGA0075036, ALGA0092930, ALGA0093041, ALGA0120853, ASGA0098668, ALGA0093340, ASGA0075610, ALGA0093633, ALGA0093742, ALGA0093797, ALGA0093835, ALGA0093891, ASGA0075880, ALGA0094001, ASGA0075970, ALGA0094168, H3GA0048364, H3GA0048438, ASGA0075894, ASGA0076595, ALGA0094709, M1GA0021987, ASGA0076841, H3GA0048941, ALGA0095080, ALGA0095191, ALGA0095323, ASGA0077233, ALGA0095453, H3GA0049247, ASGA0076851, ALGA0094942, ASGA0077484, ASGA0077557, M1GA0022271, ALGA0095955, ALGA0096031, H3GA0049660, ASGA0077149, ALGA0096192, ALGA0096256, H3GA0049828, ASGA0078395, ASGA0078502, H3GA0049322, ALGA0096393, CASI0008570, ALGA0111541, ASGA0078792, ASGA0082412, ASGA0078916, ASGA0100463, ASGA0105404, ASGA0078994, INRA0055317, ALGA0097246, ALGA0096836, ASGA0079106, ASGA0079185, ALGA0097420, ALGA0097562, ALGA0097157, ALGA0097232, ALGA0097811, DIAS000 2692, ALGA0097291, ALGA0097955, ALGA0097979, ASGA0103869, INRA0055799, ALGA0098232, ASGA0079330, M1GA0023257, ALGA0098468, H3GA0051025, H3GA0050691, SIRI0000344, ALGA0097857, DRGA0017710, DIAS0000747, ALGA0111325 and ALGA0109418
Wherein the probe is an agent capable of detecting or amplifying SNP markers.
The kit is RT-PCR or DNA chip, a kit for the identification of pig breccia varieties.
Wherein the presence of the single nucleotide polymorphic marker group is confirmed by amplification of the polymorphic site.
The presence of the group of single nucleotide polymorphic markers is confirmed from the signal detection by hybridization of the probe immobilized on the solid support and the nucleic acid molecule separated from the pig.
Wherein the probe is capable of hybridizing with a single polymorphic polymorphic marker group and is a polynucleotide labeled with a fluorescent substance.
The fluorescent material may be selected from the group consisting of pyrene, Texas red, fluorescein, BODYPY, Trtramethylrhodamine, Alexa, Cyanine, allopicocyanine, , Nil red, and quantum dots. ≪ / RTI >
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150155585A KR101767524B1 (en) | 2015-11-06 | 2015-11-06 | Low-density SNP chip considering the economic costs in Berkshire |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020150155585A KR101767524B1 (en) | 2015-11-06 | 2015-11-06 | Low-density SNP chip considering the economic costs in Berkshire |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20170053284A true KR20170053284A (en) | 2017-05-16 |
KR101767524B1 KR101767524B1 (en) | 2017-08-11 |
Family
ID=59035118
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020150155585A KR101767524B1 (en) | 2015-11-06 | 2015-11-06 | Low-density SNP chip considering the economic costs in Berkshire |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101767524B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102242575B1 (en) * | 2019-12-05 | 2021-04-20 | 대한민국 | SNP marker set for identifying Iberico varieties in pigs |
KR20220133515A (en) * | 2021-03-25 | 2022-10-05 | (주)티엔티리써치 | Composition for Discriminating Breeds of Pig and Uses thereof |
-
2015
- 2015-11-06 KR KR1020150155585A patent/KR101767524B1/en active IP Right Grant
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102242575B1 (en) * | 2019-12-05 | 2021-04-20 | 대한민국 | SNP marker set for identifying Iberico varieties in pigs |
KR20220133515A (en) * | 2021-03-25 | 2022-10-05 | (주)티엔티리써치 | Composition for Discriminating Breeds of Pig and Uses thereof |
Also Published As
Publication number | Publication date |
---|---|
KR101767524B1 (en) | 2017-08-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101823368B1 (en) | SNP marker regulating polyunsaturated fatty acid level in the pork and uses thereof | |
KR101929391B1 (en) | Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof | |
KR101418402B1 (en) | Novel SNP marker for discriminating level of loinmuscle area of Pig and use thereof | |
KR101749823B1 (en) | Composition for identifying short hair spepcies in Sapsaree comprising single nucleotide polymorphism markers | |
KR101450792B1 (en) | Novel SNP marker for discriminating Black Coat Colour of Pig and use thereof | |
KR101823209B1 (en) | Composition for identifying breed Hanwoo comprising single nucleotide polymorphism markers | |
KR101796158B1 (en) | SNP markers of NAT9 gene for prediction of pigs litter size and methods for selection of fecund pigs using the same | |
KR101312480B1 (en) | Novel snp marker for discriminating number of rib of pig and use thereof | |
KR102081569B1 (en) | SNP marker for predicting backfat thickness of pig | |
KR20170053284A (en) | Low-density SNP chip considering the economic costs in Berkshire | |
KR101784163B1 (en) | Novel SNP marker for discriminating reduction of backfat thickness and use thereof | |
KR101823374B1 (en) | SNP Markers for Identification of Chookjin Duroc Porcine and Method for Identifying Chookjin Duroc Porcine using the same | |
KR20200073407A (en) | SNP Markers for discriminating quality of pig semen and their uses | |
KR101985659B1 (en) | Method for identification of Baekwoo breed using single nucleotide polymorphism markers | |
KR102108737B1 (en) | Composition for determining the color of a bovine including an agent capable of detecting or amplifying SNP | |
KR101686438B1 (en) | Black pig having enhanced fleshiness and stress tolerance and process for preparing the same | |
KR102141566B1 (en) | Composition for determining the marbling index of a bovine including an agent capable of detecting or amplifying SNP | |
KR101928887B1 (en) | Single nucleotide polymorphism markers for determining Jeju black cattle and the uses thereof | |
KR102669168B1 (en) | SNP marker set for dog identification and dog identification method using the same | |
KR101823376B1 (en) | SNP marker regulating stearic acid level in the pork and uses thereof | |
KR102083675B1 (en) | Method for identification of Chikso breed using single nucleotide polymorphism markers | |
KR102083672B1 (en) | Composition for identifying a bovine marbling trait comprising an agent capable of detecting or amplifying a haplotype | |
KR20230173443A (en) | SNP marker for determining the color of a pig and the use thereof | |
KR102083674B1 (en) | Composition for identifying a bovine carcass weight trait comprising an agent capable of detecting or amplifying a haplotype | |
KR20230173442A (en) | SNP marker for determining the color of a pig and the use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |