KR102447490B1 - Genetic marker composition for identifying Jeju horse species and method for identifying Jeju horse species using the same - Google Patents

Abstract

The present invention relates to a genetic marker composition for identifying the species of Jeju horse and a method for identifying the species of Jeju horse using the same. It is possible to establish a systematic selection standardization system by selecting information necessary for genetic resource management and accurate species identification through a genetic approach. In addition, if the Jeju horse species is identified through a rapid and accurate molecular diagnosis method, economic benefits can be obtained by efficient genetic resource management and establishment of a reliable management system.

Description

Genetic marker composition for identifying Jeju horse species and method for identifying Jeju horse species using the same}

The present invention relates to a genetic marker composition for identifying the species of Jeju horse and a method for identifying the species of Jeju horse using the same.

Horse ( Equus ) caballus ) has been domesticated by humans for a long time, and the breed has been improved to suit its use. Although its use has decreased compared to the past, it is still widely bred for sports and hobbies such as riding and racing. In Korea, Jeju horse, which was created by crossbreeding native and Mongolian horses since the Goryeo Dynasty, is an indigenous breed. Currently, the Jeju horse management system manages the official registration and management of Jeju horses through DNA testing that confirms appearance criteria and genetic factors. In the current method, the identification of the Jeju horse species is often not clear due to the subjective appearance criteria and the identification of a small number of genetic factors.

In this regard, we are trying to develop a more clear species identification method while reducing time with a new Jeju horse-specific gene discovery and new identification method, and next generation sequencing (NGS) is applied as a suitable technology. Next-generation sequencing is an optimized genome analysis system that can identify specific genetic regions of Jeju horses and discover mutations in a way that can obtain large-capacity genetic information at low cost. At home and abroad, the next-generation sequencing method is being used for many R&D, and the technology is continuously improving. Jeju horse is a livestock managed by the state, and a more accurate and rapid analysis method is needed for future species diversity and conservation of genetic resources.

Korean Patent Registration No. 10-2108740 (Registered on May 1, 2020)

It is an object of the present invention to provide a genetic marker composition for identifying the species of Jeju horse and a method for identifying the species of Jeju horse using the same.

In order to achieve the above object, the present invention is composed of 10-50 consecutive DNA sequences comprising any one or more single nucleotide polymorphism (SNP) markers selected from the group consisting of the 26th nucleotide of SEQ ID NO: 1 to SEQ ID NO: 35 It provides a SNP marker composition for discrimination of Jejuma species comprising a polynucleotide or a complementary polynucleotide thereof.

In addition, the present invention provides a composition for discriminating Jejuma species comprising a primer set for amplifying the SNP marker.

In addition, the present invention provides a kit for identifying Jeju horse species comprising the composition.

In addition, the present invention provides a method for determining the species of Jeju horse using the composition.

The present invention relates to a genetic marker composition for identifying the species of Jeju horse and a method for identifying the species of Jeju horse using the same. It is possible to establish a systematic selection standardization system by selecting information necessary for genetic resource management and accurate species identification through a genetic approach. In addition, if the Jeju horse species is identified through a rapid and accurate molecular diagnosis method, economic benefits can be obtained by efficient genetic resource management and establishment of a reliable management system.

1 shows the results of amplifying a DNA fragment through PCR from horse DNA samples of 17 thoroughbreds and 15 horses of Jeju horse to analyze the nucleotide sequence of the Jeju horse-specific gene CD1a6.
2 shows the results of confirming the nucleotide variation of SNPs having a difference from Thoroughbred, a horse reference genome species, in the Jejuma-specific gene CD1a6 region using the Sanger sequencing method for DNA fragments amplified through PCR.

The present invention relates to a polynucleotide consisting of 10-50 consecutive DNA sequences comprising any one or more single nucleotide polymorphism (SNP) markers selected from the group consisting of the 26th nucleotide of SEQ ID NO: 1 to SEQ ID NO: 35, or a complementary polynucleotide thereof It provides a SNP marker composition for discrimination of Jeju horses containing nucleotides.

Specifically, the SNP marker may be a SNP marker in the CD1a6 gene, but is not limited thereto.

Specifically, the alleles of the 26th nucleotide of SEQ ID NO: 1 to SEQ ID NO: 35 are shown in Table 1.

The 26th nucleotide of SEQ ID NO: 1 to SEQ ID NO: 35 was prepared according to the multibase description method. For example, when the allele type is A/G, it may be A or G, so it is described as "r". In addition, if the allele type is C/T, it can be C or T, so it is described as "y". In addition, when the allele type is A/C, it can be A or C, so it is described as "m". In addition, if the allele type is G/T, it can be G or T, so it is described as "k". In addition, if the allele type is C/G, it can be C or G, so it is described as "s". In addition, when the allele type is A/T, it can be A or T, so it is described as "w".

In the present invention, "marker" refers to a nucleotide sequence used as a reference point when identifying genetically unspecifiedly related loci. The term also applies to nucleic acid sequences complementary to marker sequences, such as nucleic acids used as primer sets capable of amplifying the marker sequence. The location on the genetic map of a molecular marker is called a genetic locus.

In the present invention, "polymorphism" refers to a case in which two or more alleles exist at a single locus, and "polymorphic site" refers to a locus in which the allele exists. Among polymorphic sites, a single nucleotide that differs from one individual to another is called 'single nucleotide polymorphism', that is, SNP (single nucleotide polymorphism).

As used herein, the term "allele" refers to several types of a gene present at the same locus on homologous chromosomes. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

In addition, the present invention provides a composition for discriminating Jejuma species comprising a primer set for amplifying a SNP marker.

Preferably, the primer set may be a primer set represented by SEQ ID NO: 36 and SEQ ID NO: 37 or a primer set represented by SEQ ID NO: 38 and SEQ ID NO: 39, but is not limited thereto.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present invention, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

The present invention provides a kit for identifying the Jeju horse species comprising the composition.

In addition to the above primer set, it may include conventional components included in the PCR kit. Typical components included in the kit may be reaction buffers, polymerases, dNTPs (dATP, dCTP, dGTP and dTTP) and cofactors such as Mg2+. Various DNA polymerases can be used in the amplification step of the present invention, including Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of the polymerases can be isolated from the bacteria themselves or can be purchased commercially.

The present invention comprises the steps of (1) isolating DNA from a horse; (2) amplifying the SNP marker according to claim 1 using the isolated DNA as a template; and (3) confirming the genotype of the amplified SNP marker.

Methods for isolating DNA from horses may use methods known in the art. Also, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

The method of the present invention comprises analyzing the amplification product. The detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement. Methods for confirming the genotype of the amplified SNP marker site include sequencing analysis, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension assay, PCR-SSCP, PCR-RFLP assay, HRM assay or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. Sequenom's MassARRAY system), mini-sequencing method, Bio -Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assays), etc. However, it is not particularly limited thereto. One or more alleles in the SNP marker can be identified by the above methods or other methods available to those skilled in the art to which the present invention pertains.

In the CD1a6 gene used in the present invention, the reference CD1a6 gene is shown as SEQ ID NO: 44, and the jejuma-specific CD1a6 gene is shown as SEQ ID NO: 45.

Hereinafter, the present invention will be described in detail according to non-limiting examples. Of course, the following examples of the present invention are not intended to limit or limit the scope of the present invention, but only to embody the present invention. Accordingly, what can be easily inferred by an expert in the technical field to which the present invention pertains from the detailed description and examples of the present invention is construed as belonging to the scope of the present invention.

< Experimental example >

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

One. Jeju horse Securing DNA samples and Jeju horse Securing genomic data

For molecular biological analysis, the present inventors obtained DNA samples from 5 Jeju horses provided by the National University of Agriculture and Fisheries, Korea, assigned IDs to each sample, and stored them in a -20°C freezer until just before use. Using the obtained DNA, WGRS (Whole Genome Re-Sequencing) was performed through Illumina's HiSeq2500 platform, and genomic data was obtained from 5 Jeju horses.

2. Data acquisition ( UCSC genome database) and Jeju horse Selection of specific genetic candidates

Based on the map of the equine reference genome (Broad/equCab2; Sep.2007) constructed by the National Human Genome Research Institute (NHGRI) research support program in the United States, the genome data of Jeju horses in Korea were comparatively analyzed. The data obtained by whole genome sequencing was mapped to the horse reference genome using the BWA (v.0.7.12) program. Then, regions having SNP mutations for each horse were identified using The Genome Analysis Toolkit (GATK), which is one of the existing analysis methods for analyzing whole genome sequence data in order to discover single nucleotide polymorphic SNPs. Using the SNP mutations discovered in this way, Jeju horse-specific SNPs were identified. As a result, the most Jejuma-specific gene was identified as CD1a6.

3. Region-specific for identification of common trait mutations primer Design and Polymerase Chain Reaction (PCR)

To confirm the Jeju horse specific gene CD1a6, based on the horse reference genome map, the lateral nucleotide sequence was secured and the primer was applied to Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) It was selected using a web tool. Polymerase chain reaction was carried out in 15 heads of Jeju horses and 17 heads of thoroughbreds using the primers designed in this way, and 100ng of the sample and 1kb marker were loaded together with the amplified PCR product on 1% agarose gel, and then the DNA gel imaging system (Bio -rad) was used to confirm the image and amplify/confirm the DNA fragment for Jejuma-specific SNP identification.

4. Sanger Analysis of common trait mutations using a sequencing system

The SNP sequence of the Jeju horse-specific CD1a6 was confirmed by using the Sanger sequencing method on the PCR amplification product performed to check whether the identified Jeju horse-specific SNP sites differ between different horse groups.

< Example >

Table 1 presents information on the SNP mutation location for identifying Jejuma obtained through the analysis of the present invention and the primers prepared to confirm it.

The genetic difference between Jeju horse and thirdbread can be identified through PCR in the corresponding region, and this makes it possible to identify the Jeju horse species.

gene length location data version CD1a6 2,821 bp chr5:39293402-39296222 Sep.2007 (Broad/equCab2) Forward Primer-1 Reverse Primer-1 GGTTCTGAGTAGGCGGTCCAC (SEQ ID NO: 36) CGTGACAAACCAGCATCAG (SEQ ID NO: 37) Forward Primer-2 Reverse Primer-2 CACACCTTCTCATTATCTCC (SEQ ID NO: 38) CACAGAACCAGAGTCAGAAC (SEQ ID NO: 39) Primer SNP [ N/N] and both nucleotide sequences SEQ ID NO: Position Primer
set1 GGAGGAGAACCACTAGCAATGCAAA[T/C]TGCAGGAACAGCATTTTATTTGCTG One chr5:39296208 GGGAGGAGAACCACTAGCAATGCAA[A/G]TTGCAGGAACAGCATTTTATTTGCT 2 chr5:39296207 CCGGGAAGGGTTGTAAAAGGATGAG[C/A]TGTAGATAACTCGGAAGGAGGTTGG 3 chr5:39295761 TGAGCCCAGAGCTTGCACCCGGGAA[G/C]GGTTGTAAAAGGATGAGCTGTAGAT 4 chr5:39295743 CAAGCTGAGCCCAGAGCTTGCACCC[G/A]GGAAGGGTTGTAAAAGGATGAGCTG 5 chr5:39295738 CCAACCAAGCTGAGCCCAGAGCTTG[C/T]ACCCGGGAAGGGTTGTAAAAGGATG 6 chr5:39295733 CAGGAAAATAAAACTGCCAGTGTGG[T/C]TCTCCCACCCATGAGTCTGCAACTC 7 chr5:39295680 GGACCAAGGCCTCAGGAAAATAAAA[C/G]TGCCAGTGTGGTTCTCCCACCCATG 8 chr5:39295668 CCTTGGACCAAGGCCTCAGGAAAAT[A/T]AAACTGCCAGTGTGGTTCTCCCACC 9 chr5:39295664 GTTGCCCTTGGACCAAGGCCTCAGG[A/T]AAATAAAACTGCCAGTGTGGTTTCTC 10 chr5:39295659 AGTTGCCCTTGGACCAAGGCCTCAG[G/A]AAAATAAAACTGCCAGTGTGGTTCT 11 chr5:39295658 CACTGCTGAAGTTGCCCTTGGACCA[A/G]GGCCTCAGGAAAATAAAACTGCCAG 12 chr5:39295649 GCTCCTCACTGCTGAAGTTGCCCTT[G/C]GACCAAGGCCTCAGGAAAATAAAAC 13 chr5:39295643 CTTTTCGATTTCAGTCAGCTCCTCA[C/T]TGCTGAAGTTGCCCTTGGACCAAGG 14 chr5:39295626 AACTTTTCGATTTCAGTCAGCTCCT[C/T]ACTGCTGAAGTTGCCCTTGGACCAA 15 chr5:39295624 CGGAATAACTTTTCGATTTCAGTCA[G/T]CTCCTCACTGCTGAAGTTGCCCTTG 16 chr5:39295618 TGCTGAACGTTCGGAATAACTTTTC[G/C]ATTTCAGTCAGCTCCTCACTGCTGA 17 chr5:39295607 ATTAAATTCAATGCTGAACGTTCGG[A/G]ATAACTTTTCGATTTCAGTCAGCTC 18 chr5:39295596 TATCTGATTAAATTCAATGCTGAAC[G/A]TTCGGAATAACTTTTCGATTTCAGT 19 chr5:39295590 AATATCTGATTAAATTCAATGCTGA[A/T]CGTTCGGAATAACTTTTCGATTTCA 20 chr5:39295588 AAATATCTGATTAAATTCAATGCTG[A/G]ACGTTCGGAATAACTTTTCGATTTC 21 chr5:39295587 TGAAATATCTGATTAAATTCAATGC[T/A]GAACGTTCGGAATAACTTTTCGATT 22 chr5:39295585 GTGAAATATCTGATTAAATTCAATG[C/G]TGAACGTTCGGAATAACTTTTCGAT 23 chr5:39295584 ATGGTTGTGAAATATCTGATTAAAT[T/C]CAATGCTGAACGTTCGGAATAACTT 24 chr5:39295578 CATTGACTGGCATGGTTGTGAAATA[T/C]CTGATTAAATTCAATGCTGAACGTT 25 chr5:39295567 CCCGTGGAGGAAATTGTACTCACAT[G/T]CAAGCTGCCATTGACTGGCATGGTT 26 chr5:39295533 AGGAGCCTGTGCCATGTTTCCAGGA[A/T]GACTTTATTCAAATTGAATCGTCCG 27 chr5:39294635 GTCAGTGAGGAGCCTGTGCCATGTT[T/C]CCAGGAAGACTTTATTCAAATTGAA 28 chr5:39294628 GGTGTCAGTGAGGAGCCTGTGCCAT[G/A]TTTCCAGGAAGACTTTATTCAAATT 29 chr5:39294625 Primer
set2 AGAGACGTGACAAACCAGCATCAGA[T/C]GGCCTGGAGCAGGACTAGGGCCAGT 30 chr5:39294273 TAGGCTTTGGGTAGAAGCTAGAGAC[G/T]TGACAAACCAGCATCAGATGGCCTG 31 chr5:39294254 ACCCAAATAGGCTTTGGGTAGAAGC[T/C]AGAGACGTGACAAACCAGCATCAGA 32 chr5:39294247 TGCTGAGTGCCCTGTTGCTCTTTCT[T/C]ACCCCGCATCCACATCACCCAAATA 33 chr5:39294205 CTTTGCTGAGTGCCCTGTTGCTCTT[T/G]CTTACCCCGCATCCACATCACCCAA 34 chr5:39294202 TATCACTGCCAAGAAGATCCAGCCC[G/A]TGGAGCTGCGATGTTCTGTGGATTT 35 chr5:39293689

Table 2 shows the polymerase chain reaction conditions of Primer set1 (Forward Primer-1, Reverse Primer-1).

temperature hour Cycles Pre- denaturation 95℃ 5 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 59℃ 30 seconds Extension 72℃ 2 minutes final extension 72℃ 1 minute 30 seconds 1 cycle Hold 4℃ ∞

Table 3 shows the polymerase chain reaction conditions of Primer set2 (Forward Primer-2, Reverse Primer-2).

temperature hour Cycles Pre- denaturation 95℃ 5 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 57℃ 30 seconds Extension 72℃ 1 minute 30 seconds final extension 72℃ 1 minute 30 seconds 1 cycle Hold 4℃ ∞

1 is a result of amplifying DNA fragments through PCR from horse DNA samples of 17 thoroughbreds and 15 Jeju horses in order to analyze the nucleotide sequence of the Jeju horse-specific gene CD1a6. The DNA fragment amplification of 2,194bp and 1,169bp capable of detecting the genetic transformation region to be confirmed through the gel electrophoresis image of the PCR product obtained using the primers and PCR conditions presented above was confirmed.

Figure 2 is the result of confirming the nucleotide variation of SNPs having a difference from Thoroughbred, a horse reference genome species, in the Jejuma-specific gene CD1a6 region using the Sanger sequencing method of a DNA fragment amplified through PCR. As a result of the confirmation, 35 SNPs in the CD1a6 gene, which Jeju horses have in common, were identified, and their effectiveness as a species-discriminating molecular marker was demonstrated.

On the other hand, in the SNP sequencing analysis, the sequencing primer for confirming the SNP mutation in SEQ ID NO: 1 and SEQ ID NO: 2 is GGTTCTGAGTAGGCGGTCCAC (SEQ ID NO: 36), and the sequencing primer for confirming the SNP mutation in SEQ ID NO: 3 to SEQ ID NO: 26 is GGGCAGGTAAATGTCTCC (SEQ ID NO: 40), the sequencing primer for confirming the SNP mutation in SEQ ID NO: 27 to SEQ ID NO: 29 is CTACTGTCTTTTGCTTCCAT (SEQ ID NO: 41), and the sequencing primer for confirming the SNP mutation in SEQ ID NO: 30 to SEQ ID NO: 34 is ATGTCTATCTAAACTGATGTG (sequencing 42), and the sequencing primer for SNP mutation identification in SEQ ID NO: 35 is CTGCGGATGTAGGAGGAC (SEQ ID NO: 43).

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation Industry Academy Cooperation Group of Korea National College of Agricultural and Fisheries Optolane Technologies Inc. <120> Genetic marker composition for identifying Jeju horse species and method for identifying Jeju horse species using the same <130> ADP-2020-0601 <160> 43 <170> KopatentIn 2.0 <210> 1 <211> 51 <212> DNA <213> Jeju horse <400> 1 ggaggagaac cactagcaat gcaaaytgca ggaacagcat tttatttgct g 51 <210> 2 <211> 51 <212> DNA <213> Jeju horse <400> 2 gggaggagaa ccactagcaa tgcaarttgc aggaacagca ttttatttgc t 51 <210> 3 <211> 51 <212> DNA <213> Jeju horse <400> 3 ccgggaaggg ttgtaaaagg atgagmtgta gataactcgg aaggaggttg g 51 <210> 4 <211> 51 <212> DNA <213> Jeju horse <400> 4 tgagcccaga gcttgcaccc gggaasggtt gtaaaaggat gagctgtaga t 51 <210> 5 <211> 51 <212> DNA <213> Jeju horse <400> 5 caagctgagc ccagagcttg cacccrggaa gggttgtaaa aggatgagct g 51 <210> 6 <211> 51 <212> DNA <213> Jeju horse <400> 6 ccaaccaagc tgagcccaga gcttgyaccc gggaagggtt gtaaaaggat g 51 <210> 7 <211> 51 <212> DNA <213> Jeju horse <400> 7 caggaaaata aaactgccag tgtggytctc ccacccatga gtctgcaact c 51 <210> 8 <211> 51 <212> DNA <213> Jeju horse <400> 8 ggaccaaggc ctcaggaaaa taaaastgcc agtgtggttc tccccacccat g 51 <210> 9 <211> 51 <212> DNA <213> Jeju horse <400> 9 ccttggacca aggcctcagg aaaatwaaac tgccagtgtg gttctcccac c 51 <210> 10 <211> 51 <212> DNA <213> Jeju horse <400> 10 gttgcccttg gaccaaggcc tcaggwaaat aaaactgcca gtgtggttct c 51 <210> 11 <211> 51 <212> DNA <213> Jeju horse <400> 11 agttgccctt ggaccaaggc ctcagraaaa taaaactgcc agtgtggttc t 51 <210> 12 <211> 51 <212> DNA <213> Jeju horse <400> 12 cactgctgaa gttgcccttg gaccarggcc tcaggaaaat aaaactgcca g 51 <210> 13 <211> 51 <212> DNA <213> Jeju horse <400> 13 gctcctcact gctgaagttg cccttsgacc aaggcctcag gaaaataaaa c 51 <210> 14 <211> 51 <212> DNA <213> Jeju horse <400> 14 cttttcgatt tcagtcagct cctcaytgct gaagttgccc ttggaccaag g 51 <210> 15 <211> 51 <212> DNA <213> Jeju horse <400> 15 aacttttcga tttcagtcag ctcctyactg ctgaagttgc ccttggacca a 51 <210> 16 <211> 51 <212> DNA <213> Jeju horse <400> 16 cggaataact tttcgatttc agtcakctcc tcactgctga agttgccctt g 51 <210> 17 <211> 51 <212> DNA <213> Jeju horse <400> 17 tgctgaacgt tcggaataac ttttcsattt cagtcagctc ctcactgctg a 51 <210> 18 <211> 51 <212> DNA <213> Jeju horse <400> 18 attaaattca atgctgaacg ttcggrataa cttttcgatt tcagtcagct c 51 <210> 19 <211> 51 <212> DNA <213> Jeju horse <400> 19 tatctgatta aattcaatgc tgaacrttcg gaataacttt tcgatttcag t 51 <210> 20 <211> 51 <212> DNA <213> Jeju horse <400> 20 aatatctgat taaattcaat gctgawcgtt cggaataact tttcgatttc a 51 <210> 21 <211> 51 <212> DNA <213> Jeju horse <400> 21 aaatatctga ttaaattcaa tgctgracgt tcggaataac ttttcgattt c 51 <210> 22 <211> 51 <212> DNA <213> Jeju horse <400> 22 tgaaatatct gattaaattc aatgcwgaac gttcggaata acttttcgat t 51 <210> 23 <211> 51 <212> DNA <213> Jeju horse <400> 23 gtgaaatatc tgattaaatt caatgstgaa cgttcggaat aacttttcga t 51 <210> 24 <211> 51 <212> DNA <213> Jeju horse <400> 24 atggttgtga aatatctgat taaatycaat gctgaacgtt cggaataact t 51 <210> 25 <211> 51 <212> DNA <213> Jeju horse <400> 25 cattgactgg catggttgtg aaatayctga ttaaattcaa tgctgaacgt t 51 <210> 26 <211> 51 <212> DNA <213> Jeju horse <400> 26 cccgtggagg aaattgtact cacatkcaag ctgccattga ctggcatggt t 51 <210> 27 <211> 51 <212> DNA <213> Jeju horse <400> 27 aggagcctgt gccatgtttc caggawgact ttattcaaat tgaatcgtcc g 51 <210> 28 <211> 51 <212> DNA <213> Jeju horse <400> 28 gtcagtgagg agcctgtgcc atgttyccag gaagacttta ttcaaattga a 51 <210> 29 <211> 51 <212> DNA <213> Jeju horse <400> 29 ggtgtcagtg aggagcctgt gccatrtttc caggaagact ttattcaaat t 51 <210> 30 <211> 51 <212> DNA <213> Jeju horse <400> 30 agagacgtga caaaccagca tcagayggcc tggagcagga ctagggccag t 51 <210> 31 <211> 51 <212> DNA <213> Jeju horse <400> 31 taggctttgg gtagaagcta gagacktgac aaaccagcat cagatggcct g 51 <210> 32 <211> 51 <212> DNA <213> Jeju horse <400> 32 acccaaatag gctttgggta gaagcyagag acgtgacaaa ccagcatcag a 51 <210> 33 <211> 51 <212> DNA <213> Jeju horse <400> 33 tgctgagtgc cctgttgctc tttctyaccc cgcatccaca tcacccaaat a 51 <210> 34 <211> 51 <212> DNA <213> Jeju horse <400> 34 ctttgctgag tgccctgttg ctcttkctta ccccgcatcc acatcaccca a 51 <210> 35 <211> 51 <212> DNA <213> Jeju horse <400> 35 tatcactgcc aagaagatcc agcccrtgga gctgcgatgt tctgtggatt t 51 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer-1 <400> 36 ggttctgagt aggcggtcca c 21 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer-1 <400> 37 cgtgacaaac cagcatcag 19 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer-2 <400> 38 cacaccttct cattatctcc 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer-2 <400> 39 cacagaacca gagtcagaac 20 <210> 40 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sequencing Primer <400> 40 gggcaggtaa atgtctcc 18 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sequencing Primer <400> 41 ctactgtctt ttgcttccat 20 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Sequencing Primer <400> 42 atgtctatct aaactgatgt g 21 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sequencing Primer <400> 43 ctgcggatgt aggaggac 18

Claims (6)

A polynucleotide consisting of 10-50 consecutive DNA sequences comprising any one or more single nucleotide polymorphism (SNP) markers selected from the group consisting of the 26th nucleotide of SEQ ID NO: 1 to SEQ ID NO: 35 or a complementary polynucleotide thereof SNP marker composition for the identification of Jeju horse species. The SNP marker composition according to claim 1, wherein the SNP marker is a SNP marker in the CD1a6 gene. A composition for identifying Jeju horses comprising a primer set for amplifying the SNP marker according to claim 1 . The composition for discriminating Jejuma species according to claim 3, wherein the primer set is a primer set represented by SEQ ID NO: 36 and SEQ ID NO: 37 or a primer set represented by SEQ ID NO: 38 and SEQ ID NO: 39. A kit for identifying Jeju horse species comprising the composition according to claim 3 or 4. (1) isolating DNA from horses;
(2) using the isolated DNA as a template, amplifying the SNP marker according to claim 1; and
(3) A method for determining the species of Jejuma comprising the step of confirming the genotype of the amplified SNP marker.

Images