KR102185440B1 - Composition for early predicting or diagnosing hypercholesterolemia in dog - Google Patents

Composition for early predicting or diagnosing hypercholesterolemia in dog Download PDF

Info

Publication number
KR102185440B1
KR102185440B1 KR1020190121850A KR20190121850A KR102185440B1 KR 102185440 B1 KR102185440 B1 KR 102185440B1 KR 1020190121850 A KR1020190121850 A KR 1020190121850A KR 20190121850 A KR20190121850 A KR 20190121850A KR 102185440 B1 KR102185440 B1 KR 102185440B1
Authority
KR
South Korea
Prior art keywords
seq
nucleotide sequence
base
polynucleotide consisting
snp
Prior art date
Application number
KR1020190121850A
Other languages
Korean (ko)
Inventor
최봉환
임다정
조아라
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020190121850A priority Critical patent/KR102185440B1/en
Application granted granted Critical
Publication of KR102185440B1 publication Critical patent/KR102185440B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Abstract

The present invention relates to a composition for early prediction or diagnosis of hypercholesterolemia in dogs. The present invention selects ten single nucleotide polymorphisms (SNPs) to identify individuals with a high risk of hypercholesterolemia from dogs, such that the risk of hypercholesterolemia is confirmed in accordance with corresponding genotypes. According to the present invention, the composition for early prediction or diagnosis of hypercholesterolemia in dogs predicts allows a user to predict important genetic information when preparing special dietary management for dogs at risk of arteriosclerosis, ischemic heart disease, and ischemic cerebrovascular disease capable of being caused by hypercholesterolemia, or when breeding such dogs, thereby being usefully used for selecting excellent dogs that do not have a risk of developing diseases such as arteriosclerosis, ischemic heart disease, and ischemic cerebrovascular disease, which may be caused by hypercholesterolemia.

Description

개의 고콜레스테롤혈증 조기 예측 또는 진단용 조성물{Composition for early predicting or diagnosing hypercholesterolemia in dog}Composition for early predicting or diagnosing hypercholesterolemia in dog}

본 발명은 개의 고콜레스테롤혈증 조기 예측 또는 진단용 조성물에 관한 것이다.The present invention relates to a composition for early prediction or diagnosis of hypercholesterolemia in dogs.

고콜레스테롤 혈증(hypercholesterolemia)이란 혈청(혈장) 중 콜레스테롤 농도가 220~250㎎/L 이상인 상태를 말하며, 이 경우 저밀도 지질단백질(LDL, low-density lipoprotein) 속의 콜레스테롤이 170㎎/dL 이상인 경우가 많고, 동맥경화성 질환이 발생하기 쉽다.Hypercholesterolemia refers to a condition in which the cholesterol concentration in serum (plasma) is 220-250 mg/L or higher. In this case, cholesterol in low-density lipoprotein (LDL) is often 170 mg/dL or higher. , Atherosclerotic disease is prone to occur.

고콜레스테롤혈증의 원인으로는 유전성, 동물성 육류 등의 음식으로 섭취하는 콜레스테롤, 과체중이나 비만, 당뇨병, 갑상선 기능저하증, 신증후군, 경구피임약, 부신피질 호르몬 등과 같은 질병이나 약물 등이 있다. 그 중, 콜레스테롤이 체내에서 얼마나 빨리 만들어지고 혈액에서 제거되는지를 결정하는 유전자에 문제가 발생한 것이 가족성 고콜레스테롤 혈증이다.The causes of hypercholesterolemia include inherited, cholesterol consumed by food such as animal meat, overweight or obesity, diabetes, hypothyroidism, nephrotic syndrome, oral contraceptives, diseases or drugs such as adrenal corticosteroids. Among them, familial hypercholesterolemia has a problem with the gene that determines how quickly cholesterol is made in the body and removed from the blood.

사람 뿐 아니라 개에서도 고콜레스테롤혈증은 나타날 수 있다(Vet J. 2010 Jan;183(1):12-21.). 고콜레스테롤혈증의 임상증상은 대사성 질환으로 그 자체가 갖고 있는 증상이 없다. 동맥경화에 기인한 허혈성 심질환이나 뇌혈관 질환이 발병한 후에 그로 인한 증상이 나타나면서 고콜레스테롤혈증이 뒤늦게 발견되는 수가 있다.Hypercholesterolemia can occur in dogs as well as humans (Vet J. 2010 Jan;183(1):12-21.). The clinical symptoms of hypercholesterolemia are metabolic diseases and do not have any symptoms. After the onset of ischemic heart disease or cerebrovascular disease caused by arteriosclerosis, symptoms may appear and hypercholesterolemia may be detected late.

한편, 유전 질환에 대한 DNA 시험은 주요 위험 변이체를 조기에 확인하는데 중요한 정보를 제공해준다. 현재 DNA 시험이 활용되고 있는 개의 유전질환으로는 왜소발육증, 퇴행성 망막위축증, 간질 및 악성 발열 등이 있으며, 분자생물학적 기법을 통해 지속적으로 개발되고 있다.On the other hand, DNA testing for genetic diseases provides important information for early identification of key risk variants. Genetic diseases in dogs for which DNA tests are currently being used include dwarf development, degenerative retinal atrophy, epilepsy and malignant fever, and are continuously developed through molecular biological techniques.

본 발명에 관한 선행문헌으로, 쥐에서 Insig2 유전자 내의 단일염기다형성이 혈장 내 콜레스테롤 수준과 높은 연관성을 가지고 있다는 점을 개시한 문헌(Genomics 86 (2005) 505-517.), 개의 섭식능력 예측용 SNP 마커 및 이를 이용한 예측 방법(대한민국 등록특허 10-1823355호) 및 개의 꼬리모양 예측용 SNP 마커 및 이를 이용한 예측 방법(대한민국 등록특허 10-1960427호) 등이 있으나, 개의 고콜레스테롤혈증을 예측하기위한 본 발명의 단일염기다형성은 지금까지 개시된 바 없다.As a prior document related to the present invention, a document (Genomics 86 (2005) 505-517.) which discloses that monobasic polymorphism in the Insig2 gene has a high correlation with plasma cholesterol levels in rats, SNP for predicting feeding ability of dogs There is a marker and a prediction method using the same (Korea Patent Registration No. 10-1823355) and a SNP marker for predicting the shape of a dog's tail, and a prediction method using the same (Korea Patent Registration No. 10-1960427), but this is a pattern for predicting hypercholesterolemia in dogs. The single base polymorphism of the invention has not been disclosed so far.

이에, 본 발명자들은 개 50두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 고콜레스테롤혈증 위험도를 조기 예측 가능한 SNP 10개를 선별하여 본 발명을 완성하였다.Therefore, the present inventors extracted DNA from the blood of 50 dogs, analyzed the SNP genotype using a 170K SNP chip for dogs, and analyzed the genome-wide association study (GWAS) in dogs for hypercholesterolemia. The present invention was completed by selecting 10 SNPs capable of early predicting the risk.

본 발명의 목적은 개의 고콜레스테롤혈증 예측 또는 진단용 조성물, 이를 포함하는 개의 고콜레스테롤혈증 예측 또는 진단용 키트, 또는 이를 이용한 개의 고콜레스테롤혈증 예측 또는 진단 방법을 제공하는 것이다.It is an object of the present invention to provide a composition for predicting or diagnosing hypercholesterolemia in dogs, a kit for predicting or diagnosing hypercholesterolemia in dogs, or a method for predicting or diagnosing hypercholesterolemia in dogs using the same.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단용 조성물을 제공한다.In order to achieve the above object, the present invention provides a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And a SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10. It provides a composition for predicting or diagnosing hypercholesterolemia in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

또한, 본 발명은 상기 조성물을 포함하는 개의 고콜레스테롤혈증 예측 또는 진단용 키트를 제공한다.In addition, the present invention provides a kit for predicting or diagnosing hypercholesterolemia in dogs comprising the composition.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계로서,In addition, the present invention relates to 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from dogs. , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, and sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or complementary Amplifying a portion of the polynucleotide containing the SNP,

상기 SNP는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기 또는 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기인, 단계; 및The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of number 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 The step, which is the 61st base of the polynucleotide consisting of the nucleotide sequence of; And

2) 상기 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단 방법을 제공한다.2) It provides a method for predicting or diagnosing hypercholesterolemia in dogs, comprising the step of determining a base type of SNP at a site containing the amplified SNP.

본 발명은 개에서 고콜레스테롤혈증의 위험성이 높은 개체를 판별할 수 있는 SNP 10개를 선별하여 해당 유전자형에 따른 고콜레스테롤혈증 위험도를 확인한 것인 바, 이를 이용한 개의 고콜레스테롤혈증 예측 또는 진단용 조성물은 고콜레스테롤혈증에 의해 발생할 수 있는 동맥경화, 허혈성 심장질환 및 허혈성 뇌혈관 질환의 위험성을 갖는 개에 대한 특별한 식이관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 고콜레스테롤혈증에 의해 발생할 수 있는 동맥경화, 허혈성 심장질환 및 허혈성 뇌혈관 질환과 같은 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.The present invention is to check the risk of hypercholesterolemia according to the genotype by selecting 10 SNPs capable of discriminating individuals with high risk of hypercholesterolemia in dogs, and the composition for predicting or diagnosing hypercholesterolemia in dogs using this Preparing special dietary management for dogs with risk of arteriosclerosis, ischemic heart disease and ischemic cerebrovascular disease, which can be caused by cholesterolemia, or when breeding for breeding, predicts important genetic information to prevent hypercholesterolemia. It can be usefully used to select excellent dogs that do not have the risk of developing diseases such as arteriosclerosis, ischemic heart disease, and ischemic cerebrovascular disease.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단용 조성물을 제공한다.The present invention is a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And a SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10. It provides a composition for predicting or diagnosing hypercholesterolemia in dogs, including an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of.

상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.The agent capable of detecting or amplifying the SNP may be a primer or a probe, and specifically, a probe capable of specifically binding to a site containing the SNP, a polynucleotide including a site containing the SNP, or a It may be a primer capable of specifically amplifying a complementary polynucleotide.

상기 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프라이머는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. 또한, 상기 프라이머는 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소(예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자 및 화학그룹(예를 들어, 바이오틴) 등이 있다.The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect of detecting the site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, if necessary, the primer may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

본 명세서에서 사용되는 용어 "프로브"는 DNA 또는 RNA와 특이적으로 결합할 수 있는 수개 내지 수백 개의 염기에 해당하는 핵산 단편을 의미하며, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브 또는 RNA 프로브 등의 형태로 제작될 수 있다.The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe, etc. may be produced.

상기 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 프로브는 상기 SNP가 포함된 부위를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다.The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. Such a probe can be modified using a number of means known in the art as long as it exhibits an effect of detecting a site containing the SNP. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent.

상기 프로브는 이의 5' 말단에 리포터가 추가로 더 접합될 수 있다. 상기 리포터는 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸로다민(tetramethylrhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 리포터로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다. The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine can be any one or more selected from the group consisting of However, any other known material that can be used as a reporter in the art can be used.

상기 프로브는 이의 3' 말단에 소광자가 추가로 더 접합될 수 있다. 상기 소광자는 TAMRA, BHQ(black hole quencher) 1, BHQ2, BHQ3, NFQ(nonfluorescent quencher), 답실(dabcyl), Eclipse, DDQ(deep dark quencher), 블랙베리 퀸처(Blackberry Quencher), 아이오와 블랙(Iowa black)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 소광자로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다.The probe may be further conjugated with a quencher to its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other known material that can be used as a quencher in the art may be used.

상기 SNP를 검출 또는 증폭할 수 있는 제제에는 역전사 중합효소, DNA 중합효소, Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP가 포함될 수 있다. 역전사된 cDNA를 증폭하기 위하여 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, DNA 중합효소의 예로 E.coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 또는 박테리오파지 T7 DNA 중합효소가 있다. 중합효소는 박테리아 그 자체로부터 분리하거나 상업적으로 구입하거나 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다.Agents capable of detecting or amplifying the SNP may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg 2+ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. Polymerases can be isolated from the bacteria themselves, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

또한, 본 발명은 상기 개의 고콜레스테롤혈증 예측 또는 진단용 조성물을 포함하는 개의 고콜레스테롤혈증 예측 또는 진단용 키트를 제공한다.In addition, the present invention provides a kit for predicting or diagnosing hypercholesterolemia in dogs comprising the composition for predicting or diagnosing hypercholesterolemia in dogs.

상기 조성물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 조성물은 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP); 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP; 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP; 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP로 구성되는 군으로부터 선택되는 어느 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 포함하는 것일 수 있다.The composition may have the characteristics as described above. In one example, the composition comprises a single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4; SNP in which the 61st base is A or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7; SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8; SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And an agent capable of detecting or amplifying any one or more SNPs selected from the group consisting of SNPs in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10.

또한, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브일 수 있고, 구체적으로는 상기 SNP가 포함된 부위에 특이적으로 결합할 수 있는 프로브, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머일 수 있다.In addition, the agent capable of detecting or amplifying the SNP may be a primer or a probe, specifically a probe capable of specifically binding to a site containing the SNP, a polynucleotide comprising a site containing the SNP Alternatively, it may be a primer capable of specifically amplifying its complementary polynucleotide.

상기 키트는 PCR 키트, DNA 분석용 키트일 수 있으나, 이에 제한되지 않는다.The kit may be a PCR kit or a DNA analysis kit, but is not limited thereto.

본 발명의 키트는 상기 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 유전자형을 증폭을 통해 확인하거나, 또는 mRNA의 발현 수준을 확인함으로써 개의 고관절탈구를 예측 또는 진단할 수 있다. 본 발명에서 제공하는 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다.The kit of the present invention can predict or diagnose hip dislocation of a dog by confirming the genotype of the SNP marker provided by the present invention through amplification using the above composition or by confirming the expression level of mRNA. The kit provided by the present invention may be a kit including essential elements necessary for performing RT-PCR.

예를 들어, RT-PCR 키트는, 상기 SNP가 포함된 부위를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드에 대한 특이적인 프라이머 쌍 이외에도 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오티드(dNTPs), Taq-폴리머라제 및 역전사 효소와 같은 효소, DNase 억제제, RNase 억제제, DEPC-수(DEPC-water) 및 멸균수 등을 포함할 수 있다. 한편, 키트에 포함되는 성분들은 액상 형태로 제조될 수도 있고, 포함 성분들의 자유도를 낮추어 제품의 안정성을 제고하기 위해 건조된 형태로 제조될 수도 있다. 이러한 건조된 형태로의 제조를 위해서는 건조 단계의 적용이 필요하고, 이때 가온건조, 자연건조, 감압건조, 동결건조 또는 이들의 복합 공정이 사용될 수 있다.For example, the RT-PCR kit includes a tube or other suitable container, reaction buffer (pH and magnesium concentration varying) in addition to a primer pair specific for a polynucleotide containing the SNP-containing site or a complementary polynucleotide thereof. , Deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water, and sterile water. Meanwhile, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to prepare such a dried form, a drying step is required, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a combination thereof may be used.

또한, 본 발명은 1) 개로부터 분리된 시료의 DNA로부터 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드로 구성되는 군으로부터 선택되는 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계로서,In addition, the present invention relates to 1) a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 from DNA of a sample isolated from dogs. , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, and sequence Any one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10, or complementary Amplifying a portion of the polynucleotide containing the SNP,

상기 SNP는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기 또는 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기인, 단계; 및The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of number 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 The step, which is the 61st base of the polynucleotide consisting of the nucleotide sequence of; And

2) 상기 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단 방법을 제공한다.2) It provides a method for predicting or diagnosing hypercholesterolemia in dogs, comprising the step of determining a base type of SNP at a site containing the amplified SNP.

상기 단계 1)의 SNP를 포함하는 부위를 증폭시키는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 예를 들면, 표적 핵산을 PCR을 통하여 증폭하고 이를 정제하여 얻을 수 있다. 그 외 리가제 연쇄 반응(LCR)(Wu 및 Wallace, Genomics 4, 560(1989), Landegren 등, Science 241, 1077(1988)), 전사증폭(transcription amplification)(Kwoh 등, ProcNatlAcad Sci USA 86, 1173(1989)), 자가유지 서열 복제(Guatelli 등, ProcNatl Acad Sci USA 87, 1874(1990)) 및 핵산에 근거한 서열 증폭(NASBA)이 사용될 수 있다.The step of amplifying the site containing the SNP of step 1) may be performed by any method known to those skilled in the art. For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., ProcNatlAcad Sci USA 86, 1173 (1989)), self-maintaining sequence replication (Guatelli et al., ProcNatl Acad Sci USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA) can be used.

상기 단계 2)의 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계는 서열분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화 기법(dynamic allelespecifichybridization, DASH), PCR 연장 분석, PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예를 들면, Sequenom의 MassARRAY 시스템), 미니-시퀀싱(minisequencing) 방법, Bio-Plex 시스템(BioRad), CEQ and SNPstream 시스템(Beckman), Molecular Inversion Probe 어레이 기술(예를 들면, Affymetrix GeneChip), 및 BeadArray Technologies(예를 들면, Illumina GoldenGate 및 Infinium 분석법) 등을 이용하여 수행될 수 있으나, 이에 제한되지는 않는다. The step of determining the base type of the SNP at the site containing the amplified SNP in step 2) includes sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele hybridization techniques. (dynamic allelespecific hybridization, DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method , Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assay), etc. May be, but is not limited thereto.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or the complementary polynucleotide thereof, are all A, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 열번호 2의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, if all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of column number 2 or the complementary polynucleotide thereof, are G, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 or its complementary polynucleotide, is all G, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or its complementary polynucleotide, is all G, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 T인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, if all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 or the complementary polynucleotide thereof, are T, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 or the complementary polynucleotide thereof, are G, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 C인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or its complementary polynucleotide, is all C, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, if all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 or the complementary polynucleotide thereof, are all A, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when all bases 61, which are SNPs of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or the complementary polynucleotide thereof, are all A, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

상기 개의 고콜레스테롤혈증 예측 또는 진단 방법에 있어서, 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단할 수 있다.In the method for predicting or diagnosing hypercholesterolemia in dogs, when base 61, which is the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 or its complementary polynucleotide, is all G, the risk of hypercholesterolemia in dogs is increased. It can be judged as.

본 발명의 구체적인 실시예에서, 본 발명자들은 개 50두의 혈액으로부터 DNA를 추출한 후, 개에 대한 170K SNP 칩을 이용하여 SNP 유전자형을 분석하고, 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 통하여 개의 고콜레스테롤혈증 위험도를 조기 예측 가능한 SNP 10개를 선별하였다(표 1 내지 표 5 참조).In a specific embodiment of the present invention, the present inventors extract DNA from the blood of 50 dogs, then analyze the SNP genotype using a 170K SNP chip for dogs, and analyze the full-length genome association (Genome-wide association study, GWAS). 10 SNPs capable of early predicting the risk of hypercholesterolemia in dogs were selected (see Tables 1 to 5).

따라서, 본 발명에 따른 개의 고콜레스테롤혈증 예측 또는 진단용 조성물, 이를 포함하는 개의 고콜레스테롤혈증 진단용 키트, 또는 이를 이용한 개의 고콜레스테롤혈증 예측 또는 진단 방법은 고콜레스테롤혈증에 의해 발생할 수 있는 동맥경화, 허혈성 심장질환 및 허혈성 뇌혈관 질환의 위험성을 갖는 개에 대한 특별한 식이관리를 준비하거나, 번식을 위한 교배를 할 때 중요한 유전적 정보를 예측하여 고콜레스테롤혈증에 의해 발생할 수 있는 동맥경화, 허혈성 심장질환 및 허혈성 뇌혈관 질환과 같은 질병의 발생 위험성이 없는 우수한 개를 선발하는데 유용하게 이용될 수 있다.Therefore, the composition for predicting or diagnosing hypercholesterolemia in dogs according to the present invention, a kit for diagnosing hypercholesterolemia in dogs including the same, or a method for predicting or diagnosing hypercholesterolemia in dogs using the same, can be caused by hypercholesterolemia, arteriosclerosis, ischemic heart Predicting important genetic information when preparing special dietary management for dogs at risk of disease and ischemic cerebrovascular disease or breeding for breeding, predicts atherosclerosis, ischemic heart disease, and ischemia that can occur due to hypercholesterolemia It can be usefully used to select excellent dogs who do not have the risk of developing diseases such as cerebrovascular disease.

이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by examples and experimental examples.

단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해서 한정되는 것은 아니다.However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<실시예 1> 개에 대한 SNP 유전자형 분석<Example 1> SNP genotyping analysis of dogs

개 50두의 혈액으로부터 DNA 정제 키트(Wizard Genomic DNA Purification Kit, Promega, 미국)를 이용하여 각각 DNA를 추출한 후, 개에 대한 170K SNP 칩(CanineHD BeadChip, Illumina, 미국)을 이용하여 SNP 유전자형을 분석하였다.DNA was extracted from the blood of 50 dogs using a DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA), and then SNP genotype was analyzed using 170K SNP chip (CanineHD BeadChip, Illumina, USA) for dogs. I did.

<1-1> 1일차: 증폭(Amplification)<1-1> Day 1: Amplification

MSA3 바코드를 붙인 96-웰 0.8 ㎖ MIDI 플레이트(이하, 'MSA3 플레이트')에 웰 당 20 ㎕의 MA1을 넣고, 개 50두의 혈액으로부터 추출한 각 DNA를 웰 당 4 ㎕씩 넣은 후, DNA ID 및 옮긴 MSA3 플레이트의 위치를 기록해두었다. 이후, 각 웰 당 4 ㎕의 0.1 N NaOH를 넣고, 96-웰 덮개(96 well cap mat)로 플레이트를 덮은 후 1,600 rpm에서 1분 동안 흔들어 섞어주고(vortexing), 280 × g에서 1분간 원심분리하였다. 이후, 10분 동안 실온에서 반응시킨 후, 웰 당 34 ㎕의 MA2를 넣고, 38 ㎕의 MSM을 넣은 후, 96-웰 덮개를 덮고 280 × g에서 1분간 원심분리하였다. 37℃의 오븐(Illumina Hybridization oven)에서 20 내지 24시간 동안 반응시켜 시료를 증폭시켰다.Add 20 µl of MA1 per well to a 96-well 0.8 ml MIDI plate (hereinafter referred to as'MSA3 plate') with MSA3 barcodes, and 4 µl of each DNA extracted from the blood of 50 dogs per well, and then DNA ID and The location of the transferred MSA3 plate was recorded. Thereafter, 4 µl of 0.1 N NaOH was added to each well, and after covering the plate with a 96-well cover (96 well cap mat), shake it at 1,600 rpm for 1 minute (vortexing), and centrifuge at 280 × g for 1 minute. I did. Thereafter, after reacting at room temperature for 10 minutes, 34 µl of MA2 was added per well, 38 µl of MSM was added, and then the 96-well cover was covered and centrifuged at 280 × g for 1 minute. Samples were amplified by reacting for 20 to 24 hours in a 37°C oven (Illumina Hybridization oven).

<1-2> 2일차: 조각(Fragment)<1-2> Day 2: Fragment

상기 실시예 1-1의 MSA3 플레이트를 오븐에서 꺼내 50 × g에서 1분간 원심분리하고, 각 웰 당 25 ㎕의 FMS를 넣은 후, 덮개로 플레이트를 덮어 1,600 rpm에서 1분간 흔들어 섞어주었다(vortexing). 이후, 플레이트를 50 × g에서 1분간 원심분리하고, 37℃ 히트 블록(heat block)에서 1시간 동안 반응시켰다.The MSA3 plate of Example 1-1 was taken out of the oven and centrifuged at 50 × g for 1 minute, and 25 μl of FMS was added to each well, and then the plate was covered with a cover and shaken at 1,600 rpm for 1 minute (vortexing). . Thereafter, the plate was centrifuged at 50 × g for 1 minute, and reacted in a 37° C. heat block for 1 hour.

<1-3> 2일차: 침전(Precipitation)<1-3> Day 2: Precipitation

상기 실시예 1-2의 플레이트에 각 웰 당 25 ㎕의 PM1을 넣은 후, 덮개를 덮고, 1,600 rpm에서 1분간 원심분리한 후, 37℃ 오븐에서 5분간 반응시켰다. 플레이트를 50 × g에서 1분간 원심분리한 후, 덮개를 벗기고, 각 웰 당 155 ㎕의 2-프로판올(2-propanol)을 넣었다. 새로운 96-웰 덮개로 플레이트를 덮고 10번 뒤집어 혼합한 뒤, 4℃에서 30분 동안 보관하였다. 이후, 4℃, 3,000 rpm에서 20분 동안 원심분리 후, 플레이트 덮개를 제거하고 빠르게 뒤집어 상층액을 버렸다. 키친타올에 10회 정도 가볍게 두드려 남아있는 상층액을 제거하고, 뒤집어진 플레이트를 그대로 튜브 렉에 올려놓고 1시간 동안 자연 건조시켜 DNA 침전만 남도록 하였다.After adding 25 µl of PM1 per well to the plate of Example 1-2, the cover was covered, centrifuged at 1,600 rpm for 1 minute, and reacted in an oven at 37° C. for 5 minutes. After centrifuging the plate at 50 × g for 1 minute, the cover was removed, and 155 μl of 2-propanol was added to each well. The plate was covered with a new 96-well cover, inverted 10 times, mixed, and stored at 4° C. for 30 minutes. Thereafter, after centrifugation at 4° C. and 3,000 rpm for 20 minutes, the plate cover was removed and quickly turned over to discard the supernatant. The remaining supernatant was removed by tapping lightly on a kitchen towel about 10 times, and the inverted plate was placed on a tube rack and dried naturally for 1 hour so that only DNA precipitation remained.

<1-4> 2일차: 재현탁(Resuspend)<1-4> Day 2: Resuspend

상기 실시예 1-3의 DNA 침전이 들어있는 플레이트에 웰 당 23 ㎕의 RA1을 넣고, 남은 RA1은 추후 염색(XStain HD Bead Chip)을 위해 냉동보관하였다. 플레이트에 호일 실(foil seal)을 올리고, 히트-실러 블록(heat-sealer block)을 5초 동안 눌러 밀봉하였다. 밀봉한 플레이트를 48℃의 오븐에서 1시간 동안 반응시킨 후, 1,800 rpm에서 1분간 흔들어 섞어주었고(vortexing), 280 × g에서 1분간 원심분리하였다.23 µl of RA1 per well was added to the plate containing the DNA precipitation of Example 1-3, and the remaining RA1 was stored frozen for later staining (XStain HD Bead Chip). A foil seal was put on the plate, and a heat-sealer block was pressed for 5 seconds to seal. The sealed plate was reacted in an oven at 48° C. for 1 hour, then shaken at 1,800 rpm for 1 minute and mixed (vortexing), followed by centrifugation at 280 × g for 1 minute.

<1-5> 2일차: 혼성화(Hybridazation)<1-5> Day 2: Hybridization

상기 실시예 1-4의 플레이트를 95℃ 히트 블록(Heat block)에 넣어 20분 동안 DNA 시료를 변성시켰다(denaturation). 이후, 플레이트를 실온에 30분 동안 두고 식히는 동안 혼성화 챔버(HybChamber)에 가스킷(gaskets)을 끼우고, 혼성화 챔버에 있는 8개의 버퍼 리저버(humidifying buffer reservoir)에 각 400 ㎕의 PB2를 넣고, 뚜껑을 닫아 실온에 두었다. 실온에서 식힌 DNA가 담긴 MSA3 플레이트를 280 × g에서 1분간 원심분리하였다. 냉장 보관하던 SNP 칩을 하나씩 꺼내 준비하고, 혼성화 챔버 인서트(insert)의 바코드 모양과 칩의 바코드 부분을 맞추어 놓은 후, 멀티채널 피펫으로 식힌 DNA 시료를 각 15 ㎕씩 칩의 양쪽 부분으로 로딩(loading)하였다. 각 칩의 시료 로딩이 끝나는 대로 혼성화 챔버에 넣고 다음 칩도 같은 방법으로 반복하였다. 챔버가 모두 채워지면 챔버 뚜껑을 닫고 48℃의 오븐에 넣고 속도를 5로 설정하여 16 내지 24시간 동안 반응시켰다.The plate of Example 1-4 was placed in a 95° C. heat block to denature the DNA sample for 20 minutes (denaturation). Then, leave the plate at room temperature for 30 minutes and insert gaskets into the hybridization chamber (HybChamber) while cooling, add 400 μl of PB2 to each of the eight humidifying buffer reservoirs in the hybridization chamber, and remove the lid. Closed and placed at room temperature. MSA3 plate containing DNA cooled at room temperature was centrifuged at 280 × g for 1 minute. Take out and prepare refrigerated SNP chips one by one, align the barcode shape of the hybridization chamber insert with the barcode part of the chip, and then load the DNA sample cooled with a multi-channel pipette into both parts of the chip by 15 µl each. ). As soon as the sample loading of each chip was finished, it was placed in the hybridization chamber and the next chip was repeated in the same manner. When the chamber was all filled, the chamber lid was closed, placed in an oven at 48° C., and the rate was set to 5 to react for 16 to 24 hours.

<1-6> 3일차: 세척(Washing bead chips)<1-6> Day 3: Washing bead chips

상기 실시예 1-5의 혼성화 챔버를 오븐에서 꺼내고, 챔버 속의 인서트를 하나씩 꺼내, 칩에 붙어 있는 실(seal)을 잡아당겨 제거한 후, 실이 제거된 칩을 세척 렉(wash rack)에 꽂아 WB1이 담긴 세척 디쉬(wash dish)에 담갔다. 모든 칩이 WB1에 담긴 후 세척 렉을 디쉬에서 1분 동안 뺐다 넣었다 하면서 씻어주었고, PB1이 들어 있는 다른 세척 디쉬에 렉을 옮겨 1분 동안 뺐다 넣었다 하면서 씻어주었다. 세척이 끝난 후, 비드칩 얼라인먼트 픽스쳐(Multi-sample BeadChips Alignment fixture)에 백 프레임(back frame)을 올리고, 바코드 방향에 맞추어 칩을 한 장씩 올린 후, 흰색 부분과 분리한 투명한 부분의 스페이스를 얼라인먼트 픽스쳐의 윗부분과 아랫부분에 맞추어 끼웠다. 스페이스를 올린 후, 바코드가 없는 칩의 윗부분에 얼라인먼트 바(alignment bar)를 올리고, 유리판의 끝이 바에 닿도록 유리판을 덮은 후, 클립을 끼워 챔버 어셈블리(Flow-through chamber assembly)를 완성하였다. 얼라인먼트 바를 제거하고, 챔버 어셈블리 양끝의 스페이스 부분을 가위로 잘라주었다.The hybridization chamber of Example 1-5 was taken out of the oven, the inserts in the chamber were taken out one by one, and the seal attached to the chip was pulled to remove it, and then the chip from which the seal was removed was inserted into a wash rack, and WB1 It was immersed in a wash dish. After all the chips were immersed in WB1, the washing rack was removed from the dish for 1 minute and washed, and the rack was moved to another washing dish containing PB1, and the rack was removed and placed for 1 minute. After washing, place the back frame on the Multi-sample BeadChips Alignment fixture, put the chip one by one according to the barcode direction, and then align the space of the transparent part separated from the white part. It was fitted to the top and bottom of the. After raising the space, an alignment bar was placed on the upper part of the chip without the barcode, the glass plate was covered so that the end of the glass plate touched the bar, and the flow-through chamber assembly was completed by inserting a clip. The alignment bar was removed, and spaces at both ends of the chamber assembly were cut with scissors.

<1-7> 3일차: 염색(XStain Beadchips)<1-7> Day 3: Dyeing (XStain Beadchips)

챔버 렉의 온도를 44℃로 맞춘 후, 상기 실시예 1-6의 챔버 어셈블리를 챔버 렉에 끼웠다. 각 칩에 150 ㎕의 RA1을 넣고 30초 동안 반응시키는 과정을 6번 반복한 후, 450 ㎕의 XC1, 450 ㎕의 XC2 및 200 ㎕의 TEM을 순차적으로 각 칩에 넣고 각각 10분씩 반응시켰다. 450 ㎕의 95% 포름아미드(formamide)/1mM EDTA(ethylenediaminetetraacetic acid)를 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 5분 동안 반응시켰다. LTM 튜브의 라벨에 적혀 있는 온도를 확인하고 해당 온도로 챔버 렉의 온도를 바꾸고, 450 ㎕의 XC3을 각 칩에 넣고 1분 동안 반응시킨 후, 다시 한번 더 동일하게 넣고 상기 설정한 챔버 렉의 온도에 도달할 때까지 기다렸다. 이후, 하기 표 1의 A - B - A - B - A의 순서로 각 칩에 시약을 넣고 반응시켰다.After adjusting the temperature of the chamber rack to 44° C., the chamber assembly of Example 1-6 was fitted to the chamber rack. 150 µl of RA1 was added to each chip and the reaction for 30 seconds was repeated 6 times, and then 450 µl of XC1, 450 µl of XC2, and 200 µl of TEM were sequentially added to each chip and reacted for 10 minutes each. 450 µl of 95% formamide/1mM ethylenediaminetetraacetic acid (EDTA) was added to each chip and reacted for 1 minute, and then the same was added again and reacted for 5 minutes. Check the temperature written on the label of the LTM tube, change the temperature of the chamber rack to the corresponding temperature, put 450 µl of XC3 into each chip and react for 1 minute, then put it the same again and put the set temperature of the chamber rack Waited until it reached. Thereafter, reagents were added to each chip in the order of A-B-A-B-A in Table 1 and reacted.

세트set 순서order 각 칩에 넣는 시약Reagents for each chip 시약 넣은 후 반응시간Reaction time after adding reagent AA 1One 250 ㎕의 LTM250 μl LTM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 min 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes BB 1One 250 ㎕의 ATM250 μl of ATM 10분10 minutes 22 450 ㎕의 XC3450 μl of XC3 1분1 min 33 450 ㎕의 XC3450 μl of XC3 5분5 minutes

상기 반응 종료 후, 즉시 챔버 어셈블리에서 챔버 렉을 분리하고 실온의 실험 테이블로 옮겨 평평하게 꺼내 두었다. 310 ㎖의 PB1을 세척 용기에 넣고 염색용 렉을 용기 안에 담가 두었다. 기구를 이용하여 챔버 렉의 클립을 벗기고 유리 블록을 들어서 제거한 후, 칩의 비드(bead) 부분을 건드리지 않도록 하면서 스페이스를 제거하였다. 칩에 붙였던 부착물을 모두 제거한 후, PB1에 담겨 있는 염색용 렉(staining rack)에 꽂아 PB1에 담가 두었다. 모든 칩을 순차적으로 상기와 동일하게 처리하였다. 염색용 렉을 천천히 10번 정도 위 아래로 움직여 칩을 담금질한 후, 5분 동안 담가두었다가 다른 세척용 용기에 XC4 310 ㎖을 채우고 상기와 동일하게 칩을 담금질한 후 5분 동안 담가두었다. 이후, 염색용 렉을 꺼내고 집게를 이용하여 칩을 조심스럽게 꺼내 튜브 렉 위에 올려두었다. 칩을 올린 튜브 렉을 진공 건조기에 넣고 508 mmHg(0.68 bar)의 진공 상태로 55분 동안 건조시켰다. 에탄올에 적신 티슈(KIMWIPES)를 이용하여 비드 부분을 건드리지 않도록 주의하면서 건조된 칩의 가장자리를 닦아주었다. 실험이 완료된 비드 칩은 72시간 이내에 스캐너를 이용하여 이미지화시켰다.Immediately after completion of the reaction, the chamber rack was removed from the chamber assembly, transferred to a room temperature experiment table, and placed flat. 310 ml of PB1 was put in a washing container, and the rack for dyeing was immersed in the container. After removing the clip of the chamber rack using a tool, lifting the glass block and removing it, the space was removed while not touching the bead portion of the chip. After removing all the attachments attached to the chip, it was placed in a staining rack contained in PB1 and immersed in PB1. All chips were sequentially treated in the same manner as above. The dyeing rack was slowly moved up and down about 10 times to quench the chips, and then soaked for 5 minutes. Then, 310 ml of XC4 was filled in another container for washing, and the chips were quenched in the same manner as above, and then soaked for 5 minutes. Thereafter, the dyeing rack was taken out, and the chips were carefully removed using forceps and placed on the tube rack. The tube rack on which the chips were loaded was placed in a vacuum dryer and dried for 55 minutes in a vacuum of 508 mmHg (0.68 bar). Using a tissue soaked in ethanol (KIMWIPES), the edge of the dried chip was wiped while being careful not to touch the bead. The bead chip after the experiment was completed was imaged using a scanner within 72 hours.

<실험예 1> 개의 고콜레스테롤혈증 위험도를 조기 예측 가능한 10개 SNP의 선별<Experimental Example 1> Selection of 10 SNPs capable of early predicting the risk of hypercholesterolemia in dogs

개 50두에 대한 고밀도 SNP 170K 칩 분석 및 전장유전체 연관성 분석(Genome-wide association study, GWAS)을 수행하였다.A high-density SNP 170K chip analysis and a genome-wide association study (GWAS) were performed for 50 dogs.

구체적으로, 상기 실시예 1에서 얻은 이미지를 분석하여 개 50 두의 유전자형을 분석하였다. 이후, 전장유전체 유전자형 데이터 품질관리(quality control, QC) 및 데이터베이스 구축을 위하여 SNP를 필터링하여 하디-와인버그 평형(Hardy-Weinberg equilibrium, HWE) 검사 및 MAF(minor allele frequency)에 대해 R/SNPassoc 패키지의 chi-square 검정을 실시하여, 조건에 부적합한 유전자들을 제외하였다(HWE p < 0.001, MAF < 0.001). Specifically, by analyzing the image obtained in Example 1, the genotype of 50 dogs was analyzed. Thereafter, for quality control (QC) of full-length genotype data and database construction, the SNP was filtered to test Hardy-Weinberg equilibrium (HWE) and the R/SNPassoc package for minor allele frequency (MAF). A chi-square test was performed to exclude genes unsuitable for the condition (HWE p <0.001, MAF <0.001).

개 50두에 대한 혈액을 채취하여 반려견 전용 혈중 콜레스테롤 측정기(Catalyst Dx® Chemistry Analyzer; IDEXX BioResearch)를 사용하여 개의 나이, 성별, 품종을 기록하고 혈중 콜레스테롤 수치를 측정하였다. 정상적인 개의 혈중 콜레스테롤 수치는 110mg/㎗ 내지 320mg/㎗로, 혈중 콜레스테롤 수치가 320mg/㎗ 이상인 경우 보통 동물병원에서 혈중 콜레스테롤 수치가 높다고 진단한다.Blood was collected from 50 dogs, and the age, sex, and breed of dogs were recorded using a blood cholesterol analyzer (Catalyst Dx® Chemistry Analyzer; IDEXX BioResearch) for dogs, and blood cholesterol levels were measured. A normal dog's blood cholesterol level is 110mg/㎗ to 320mg/㎗, and if the blood cholesterol level is more than 320mg/㎗, it is usually diagnosed as high in blood cholesterol at an animal hospital.

이후, 상기 개 50 두의 혈중콜레스테롤수치 위험성을 하기 일반식 1로 점수화하여 유전자형 별로 혈중콜레스테롤수치의 표현형 수치를 계산하였다. 전장유전체 연관성 분석을 통하여 SNP 칩으로부터 분석한 유전자형에 따른 혈중콜레스테롤수치 위험도와의 관련성 정도를 계산하고, Single marker regression에 대한 R-통계 패키지를 이용하여 혈중콜레스테롤수치 위험성과 각 SNP 마커와의 상가적 유전효과(additive effect)를 분석하여 유의한 SNP를 탐색하였다.Thereafter, the risk of blood cholesterol levels of the 50 dogs was scored by the following general formula 1 to calculate the phenotypic level of blood cholesterol levels for each genotype. Calculate the degree of association with the risk of blood cholesterol levels according to the genotype analyzed from the SNP chip through the full-length genetic association analysis, and use the R-statistics package for single marker regression to add to the risk of blood cholesterol levels and each SNP marker. Significant SNPs were searched by analyzing the additive effect.

[일반식 1][General Formula 1]

y = μ + Sexi + SNPj + eij y = μ + Sex i + SNP j + e ij

(상기 일반식 1에서, y는 혈중 콜레스테롤 수치, μ는 전체 평균, Sexi는 유전자형 효과(i=암컷, 수컷 및 중성화된 수컷), SNPj는 유전자형 효과(j=AA, AB, BB), eij는 임의오차, N~(0, σ2 e))(In the general formula 1, y is the blood cholesterol level, μ is the overall mean, Sex i is the genotypic effect (i = female, male and neutralized male), SNP j is the genotypic effect (j = AA, AB, BB), e ij is a random error, N~(0, σ 2 e ))

유전체전장 연관분석(genome wide association test)과 같은 다중분석(multiple testing)의 문제점인 임의 발생 오류로 인한 오류 검정(False Positive)을 위하여 10,000번의 permutation test를 수행하여 0.1% 수준으로 genome-wise P-값을 계산하였다.For the false positive, which is a problem of multiple testing, such as the genome wide association test, 10,000 permutation tests were performed and the genome-wise P- The value was calculated.

그 결과, 개의 혈중콜레스테롤수치 위험도를 조기 예측할 수 있는 10개의 SNP를 선별하였고, 선별한 각 표현형 수치들의 평균 및 표준편차(Standard Deviation, SD)를 구하고, 각 표준편차를 유전자형별 개수의 제곱으로 나누어 표준오차(Standard error, SE)를 계산하였다(표 2 내지 표 5). 각 표현형 별로 평균값이 높을수록 혈중콜레스테롤수치가 높은 것을 의미한다.As a result, 10 SNPs that can predict the risk of blood cholesterol level in dogs early were selected, the mean and standard deviation (SD) of each selected phenotype value were calculated, and each standard deviation was divided by the square of the number of each genotype. Standard error (SE) was calculated (Tables 2 to 5). The higher the average value for each phenotype, the higher the blood cholesterol level.

<개의 혈중콜레스테롤수치 위험도를 조기 예측할 수 있는 10개 SNP의 통계분석(1)><Statistical analysis of 10 SNPs that can predict the risk of blood cholesterol levels in dogs early (1)> 번호number SNP이름SNP name 염색체chromosome bp(위치)bp (location) A1A1 A2A2 유전자빈도Gene frequency 1One BICF2P72465BICF2P72465 1313 4751187647511876 GG AA 0.490.49 22 BICF2P1143493BICF2P1143493 1313 4630389246303892 AA GG 0.420.42 33 BICF2P541680BICF2P541680 1313 4724526247245262 AA GG 0.460.46 44 BICF2P519802BICF2P519802 1313 4725665747256657 AA GG 0.460.46 55 BICF2P1391612BICF2P1391612 66 5912826859128268 TT AA 0.380.38 66 BICF2S23160670BICF2S23160670 1313 4681370846813708 AA GG 0.470.47 77 TIGRP2P178665_rs8730445TIGRP2P178665_rs8730445 1313 4740606147406061 AA CC 0.410.41 88 BICF2S23625216BICF2S23625216 1313 4733199847331998 AA CC 0.450.45 99 BICF2S23715331BICF2S23715331 1313 4750370647503706 AA GG 0.460.46 1010 BICF2G630244482BICF2G630244482 3333 44309374430937 GG AA 0.100.10

<개의 혈중콜레스테롤수치 위험도를 조기 예측할 수 있는 10개 SNP의 통계분석(2)><Statistical analysis of 10 SNPs that can predict the risk of blood cholesterol levels in dogs early (2)> 번호number SNP이름SNP name 베타통계량Beta statistics 표준오차(SE)Standard error (SE) P(확률값)P (probability value) 1One BICF2P72465BICF2P72465 -16.63920 -16.63920 5.538785.53878 0.002660.00266 22 BICF2P1143493BICF2P1143493 -17.99320-17.99320 6.125396.12539 0.003310.00331 33 BICF2P541680BICF2P541680 -16.79840-16.79840 5.748875.74887 0.003480.00348 44 BICF2P519802BICF2P519802 -16.79840-16.79840 5.748875.74887 0.003480.00348 55 BICF2P1391612BICF2P1391612 15.7144015.71440 5.632855.63285 0.005270.00527 66 BICF2S23160670BICF2S23160670 -14.94330-14.94330 5.377145.37714 0.005450.00545 77 TIGRP2P178665_rs8730445TIGRP2P178665_rs8730445 -14.64870-14.64870 5.288015.28801 0.005600.00560 88 BICF2S23625216BICF2S23625216 15.8192015.81920 5.725185.72518 0.00573 0.00573 99 BICF2S23715331BICF2S23715331 15.9178015.91780 5.856935.85693 0.006570.00657 1010 BICF2G630244482BICF2G630244482 21.2341021.23410 7.897067.89706 0.00717 0.00717

서열번호Sequence number SNP이름SNP name 염색체chromosome 염기서열 변이영역Base sequence variation region 혈중콜레스테롤수치 위험성 유전자형Blood Cholesterol Level Risk Genotype 1One BICF2P72465BICF2P72465 1313 AAAATCGGTTGGGGTCTGTAATGGCATTGCCATTAAAGAYAAGACCAAGTTAGATTCCCC[A/G]AGGTTGGGAGAATCTCCAAGTCAGGGCAGAGATTAACTTGAAGCCTAGATGCTTTCTCTCAAAATCGGTTGGGGTCTGTAATGGCATTGCCATTAAAGAYAAGACCAAGTTAGATTCCCC [A/G] AGGTTGGGAGAATCTCCAAGTCAGGGCAGAGATTAACTTGAAGCCTAGATGCTTTCTCTC AA 22 BICF2P1143493BICF2P1143493 1313 AAATAAATTTGTCTCAACAGTTTTGAGTTTATGAATTCTAGAGATTAAAATCTTTTACTC[A/G]AGTAGAAAAAAATGAAAGTAACGCTGTTACGTCTGCATTTCTGTGTCTGATTGGGAGGGTAAATAAATTTGTCTCAACAGTTTTGAGTTTATGAATTCTAGAGATTAAAATCTTTTACTC [A/G] AGTAGAAAAAAATGAAAGTAACGCTGTTACGTCTGCATTTCTGTGTCTGATTGGGAGGGT GG 33 BICF2P541680BICF2P541680 1313 ACCTGTAAGGTCTTGAGCCTGTCAAGACCGCTGGCTATGTGCTGTTTTAYTTACTGACAG[A/G]TCTTGAAATAGCGCAGTGTTTCTAAAAAGACAATCCTGAACAACAAGATTCCCTATTAAGACCTGTAAGGTCTTGAGCCTGTCAAGACCGCTGGCTATGTGCTGTTTTAYTTACTGACAG [A/G] TCTTGAAATAGCGCAGTGTTTCTAAAAAGACAATCCTGAACAACAAGATTCCCTATTAAG GG 44 BICF2P519802BICF2P519802 1313 TCCTATTCTAGAGATGAGTACTCTCTGATTTTCCCTGATTCTTGAATAAAAGGTAGGAGA[A/G]GGCTAGACCTACTCCCATGAAGAACCCAGAGCTCAATCTTCCCATTTTGTTTCCAAACACTCCTATTCTAGAGATGAGTACTCTCTGATTTTCCCTGATTCTTGAATAAAAGGTAGGAGA [A/G] GGCTAGACCTACTCCCATGAAGAACCCAGAGCTCAATCTTCCCATTTTGTTTCCAAACAC GG 55 BICF2P1391612BICF2P1391612 66 TCTTAGTATAAAAGTATAAAAAAAAAAAAACAATGCTTGTTTTTTATGTTTCTACAAAAG[A/T]CTGAGGAGAAACCTGTCAGTCACTTAGGGTCTCAAGTAAGAGGCCAGACTCGCCATCACCTCTTAGTATAAAAGTATAAAAAAAAAAAAACAATGCTTGTTTTTTATGTTTCTACAAAAG [A/T] CTGAGGAGAAACCTGTCAGTCACTTAGGGTCTCAAGTAAGAGGCCAGACTCGCCATCACC TT 66 BICF2S23160670BICF2S23160670 1313 AGGGAGAAAATGCCTGGACAATTCAGGTGCCGCTCAAAAGCTGAGGTTTGGGAACTGGTT[A/G]CTAAAGCGGCTGGATCTGGAATTATTTCCTAGATAGGTTGCATGACCTTTGTCTAAATAAAGGGAGAAAATGCCTGGACAATTCAGGTGCCGCTCAAAAGCTGAGGTTTGGGAACTGGTT [A/G] CTAAAGCGGCTGGATCTGGAATTATTTCCTAGATAGGTTGCATGACCTTTGTCTAAATAA GG 77 TIGRP2P178665_rs8730445TIGRP2P178665_rs8730445 1313 CCCCTGCCCCCAGCCACTTATCAAAATGTGTTGTCCTACCTTCTACAGTTTCCTTAGTCT[A/C]TCCTGCCTTCTGTTCCCAGAGCCACTTAACTTGGTTCAGGCCTCTCTTCATTATCATCTGCCCCTGCCCCCAGCCACTTATCAAAATGTGTTGTCCTACCTTCTACAGTTTCCTTAGTCT [A/C] TCCTGCCTTCTGTTCCCAGAGCCACTTAACTTGGTTCAGGCCTCTCTTCATTATCATCTG CC 88 BICF2S23625216BICF2S23625216 1313 ATTATCTTAATCAATAATTTGAGCACCTTTCATAGTAAAGAGCCATACCAACTGTATATG[A/C]GAGGTAGGAACTAGTGCCATGGATAAAACAATCAAATAACTCAAATGGAATTCTACCAAAATTATCTTAATCAATAATTTGAGCACCTTTCATAGTAAAGAGCCATACCAACTGTATATG [A/C] GAGGTAGGAACTAGTGCCATGGATAAAACAATCAAATAACTCAAATGGAATTCTACCAAA AA 99 BICF2S23715331BICF2S23715331 1313 CCAATAGAACCATTAGCTTCTTTGTGAAGACTTTTCAGATTGGACCCCCTTTCCTGGCAT[A/G]ATTATTTCTCTACCACATACATACAACTATTAGATTTCAAAYTGAAGAYAGGACTTAAGTCCAATAGAACCATTAGCTTCTTTGTGAAGACTTTTCAGATTGGACCCCCTTTCCTGGCAT [A/G] ATTATTTCTCTACCACATACATACAACTATTAGATTTCAAAYTGAAGAYAGGACTTAAGT AA 1010 BICF2G630244482BICF2G630244482 3333 ATGGGCTTATCTCGTAGCTGAATGCTGTACAGAAAAGCAATGTAAATAAAGGGACGATCC[A/G]TGCTTATTAAACTTACTATTTGCCAATATACTTTCCACCACCTCTGAAACCTGCGCTACCATGGGCTTATCTCGTAGCTGAATGCTGTACAGAAAAGCAATGTAAATAAAGGGACGATCC [A/G] TGCTTATTAAACTTACTATTTGCCAATATACTTTCCACCACCTCTGAAACCTGCGCTACC GG

<개의 혈중콜레스테롤수치 위험성과 연관된 유전자형별 평균치와 표준오차 값><Mean and standard error values for each genotype associated with the risk of blood cholesterol levels in dogs> 서열번호Sequence number SNP이름SNP name 염색체chromosome 항목Item 유전자형-1Genotype-1 유전자형-2Genotype-2 유전자형-3Genotype-3 1One BICF2P72465BICF2P72465 1313 변이(개체수)Variation (number of individuals) AA(12)AA(12) AG(27)AG(27) GG(11)GG(11) 평균Average 136.75136.75 125.26125.26 115.09115.09 표준오차Standard error 9.889.88 4.574.57 5.775.77 22 BICF2P1143493BICF2P1143493 1313 변이(개체수)Variation (number of individuals) AA(6)AA(6) AG(30)AG(30) GG(14)GG(14) 평균Average 121.83121.83 123.27123.27 132.86132.86 표준오차Standard error 5.075.07 4.444.44 9.099.09 33 BICF2P541680BICF2P541680 1313 변이(개체수)Variation (number of individuals) AA(9)AA(9) AG(28)AG(28) GG(13)GG(13) 평균Average 112.56112.56 126.39126.39 133.62133.62 표준오차Standard error 6.816.81 4.274.27 9.629.62 44 BICF2P519802BICF2P519802 1313 변이(개체수)Variation (number of individuals) AA(9)AA(9) AG(28)AG(28) GG(13)GG(13) 평균Average 112.56112.56 126.39126.39 133.62133.62 표준오차Standard error 6.816.81 4.274.27 9.629.62 55 BICF2P1391612BICF2P1391612 66 변이(개체수)Variation (number of individuals) AA(19)AA(19) AT(24)AT(24) TT(7)TT(7) 평균Average 119.21119.21 125.33125.33 145.14145.14 표준오차Standard error 4.064.06 6.216.21 9.269.26 66 BICF2S23160670BICF2S23160670 1313 변이(개체수)Variation (number of individuals) AA(11)AA(11) AG(25)AG(25) GG(14)GG(14) 평균Average 115.09115.09 126.24126.24 133.36133.36 표준오차Standard error 5.775.77 4.794.79 8.918.91 77 TIGRP2P178665_rs8730445TIGRP2P178665_rs8730445 1313 변이(개체수)Variation (number of individuals) AA(9)AA(9) AC(23)AC(23) CC(18)CC(18) 평균Average 111.00111.00 125.78125.78 133.17133.17 표준오차Standard error 6.186.18 3.413.41 8.558.55 88 BICF2S23625216BICF2S23625216 1313 변이(개체수)Variation (number of individuals) AA(9)AA(9) AC(27)AC(27) CC(14)CC(14) 평균Average 133.44133.44 129.63129.63 113.43113.43 표준오차Standard error 12.2412.24 4.554.55 5.545.54 99 BICF2S23715331BICF2S23715331 1313 변이(개체수)Variation (number of individuals) AA(9)AA(9) AG(28)AG(28) GG(13)GG(13) 평균Average 133.44133.44 129.50129.50 112.46112.46 표준오차Standard error 12.2412.24 4.384.38 5.895.89 1010 BICF2G630244482BICF2G630244482 3333 변이(개체수)Variation (number of individuals) AA(42)AA(42) AG(6)AG(6) GG(2)GG(2) 평균Average 121.81121.81 132.83132.83 188.00188.00 표준오차Standard error 3.443.44 12.5112.51 9.009.00

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for early predicting or diagnosing hypercholesterolemia in dog <130> 2019P-09-018 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P72465 <220> <221> variation <222> (61) <223> n is A or G <400> 1 aaaatcggtt ggggtctgta atggcattgc cattaaagay aagaccaagt tagattcccc 60 naggttggga gaatctccaa gtcagggcag agattaactt gaagcctaga tgctttctct 120 c 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1143493 <220> <221> variation <222> (61) <223> n is A or G <400> 2 aaataaattt gtctcaacag ttttgagttt atgaattcta gagattaaaa tcttttactc 60 nagtagaaaa aaatgaaagt aacgctgtta cgtctgcatt tctgtgtctg attgggaggg 120 t 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P541680 <220> <221> variation <222> (61) <223> n is A or G <400> 3 acctgtaagg tcttgagcct gtcaagaccg ctggctatgt gctgttttay ttactgacag 60 ntcttgaaat agcgcagtgt ttctaaaaag acaatcctga acaacaagat tccctattaa 120 g 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P519802 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tcctattcta gagatgagta ctctctgatt ttccctgatt cttgaataaa aggtaggaga 60 nggctagacc tactcccatg aagaacccag agctcaatct tcccattttg tttccaaaca 120 c 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1391612 <220> <221> variation <222> (61) <223> n is A or T <400> 5 tcttagtata aaagtataaa aaaaaaaaaa caatgcttgt tttttatgtt tctacaaaag 60 nctgaggaga aacctgtcag tcacttaggg tctcaagtaa gaggccagac tcgccatcac 120 c 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23160670 <220> <221> variation <222> (61) <223> n is A or G <400> 6 agggagaaaa tgcctggaca attcaggtgc cgctcaaaag ctgaggtttg ggaactggtt 60 nctaaagcgg ctggatctgg aattatttcc tagataggtt gcatgacctt tgtctaaata 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P178665_rs8730445 <220> <221> variation <222> (61) <223> n is A or C <400> 7 cccctgcccc cagccactta tcaaaatgtg ttgtcctacc ttctacagtt tccttagtct 60 ntcctgcctt ctgttcccag agccacttaa cttggttcag gcctctcttc attatcatct 120 g 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23625216 <220> <221> variation <222> (61) <223> n is A or C <400> 8 attatcttaa tcaataattt gagcaccttt catagtaaag agccatacca actgtatatg 60 ngaggtagga actagtgcca tggataaaac aatcaaataa ctcaaatgga attctaccaa 120 a 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23715331 <220> <221> variation <222> (61) <223> n is A or G <400> 9 ccaatagaac cattagcttc tttgtgaaga cttttcagat tggaccccct ttcctggcat 60 nattatttct ctaccacata catacaacta ttagatttca aaytgaagay aggacttaag 120 t 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630244482 <220> <221> variation <222> (61) <223> n is A or G <400> 10 atgggcttat ctcgtagctg aatgctgtac agaaaagcaa tgtaaataaa gggacgatcc 60 ntgcttatta aacttactat ttgccaatat actttccacc acctctgaaa cctgcgctac 120 c 121 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for early predicting or diagnosing hypercholesterolemia in dog <130> 2019P-09-018 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P72465 <220> <221> variation <222> (61) <223> n is A or G <400> 1 aaaatcggtt ggggtctgta atggcattgc cattaaagay aagaccaagt tagattcccc 60 naggttggga gaatctccaa gtcagggcag agattaactt gaagcctaga tgctttctct 120 c 121 <210> 2 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1143493 <220> <221> variation <222> (61) <223> n is A or G <400> 2 aaataaattt gtctcaacag ttttgagttt atgaattcta gagattaaaa tcttttactc 60 nagtagaaaa aaatgaaagt aacgctgtta cgtctgcatt tctgtgtctg attgggaggg 120 t 121 <210> 3 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P541680 <220> <221> variation <222> (61) <223> n is A or G <400> 3 acctgtaagg tcttgagcct gtcaagaccg ctggctatgt gctgttttay ttactgacag 60 ntcttgaaat agcgcagtgt ttctaaaaag acaatcctga acaacaagat tccctattaa 120 g 121 <210> 4 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P519802 <220> <221> variation <222> (61) <223> n is A or G <400> 4 tcctattcta gagatgagta ctctctgatt ttccctgatt cttgaataaa aggtaggaga 60 nggctagacc tactcccatg aagaacccag agctcaatct tcccattttg tttccaaaca 120 c 121 <210> 5 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2P1391612 <220> <221> variation <222> (61) <223> n is A or T <400> 5 tcttagtata aaagtataaa aaaaaaaaaa caatgcttgt tttttatgtt tctacaaaag 60 nctgaggaga aacctgtcag tcacttaggg tctcaagtaa gaggccagac tcgccatcac 120 c 121 <210> 6 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23160670 <220> <221> variation <222> (61) <223> n is A or G <400> 6 agggagaaaa tgcctggaca attcaggtgc cgctcaaaag ctgaggtttg ggaactggtt 60 nctaaagcgg ctggatctgg aattatttcc tagataggtt gcatgacctt tgtctaaata 120 a 121 <210> 7 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> TIGRP2P178665_rs8730445 <220> <221> variation <222> (61) <223> n is A or C <400> 7 cccctgcccc cagccactta tcaaaatgtg ttgtcctacc ttctacagtt tccttagtct 60 ntcctgcctt ctgttcccag agccacttaa cttggttcag gcctctcttc attatcatct 120 g 121 <210> 8 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23625216 <220> <221> variation <222> (61) <223> n is A or C <400> 8 attatcttaa tcaataattt gagcaccttt catagtaaag agccatacca actgtatatg 60 ngaggtagga actagtgcca tggataaaac aatcaaataa ctcaaatgga attctaccaa 120 a 121 <210> 9 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2S23715331 <220> <221> variation <222> (61) <223> n is A or G <400> 9 ccaatagaac cattagcttc tttgtgaaga cttttcagat tggaccccct ttcctggcat 60 nattatttct ctaccacata catacaacta ttagatttca aaytgaagay aggacttaag 120 t 121 <210> 10 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> BICF2G630244482 <220> <221> variation <222> (61) <223> n is A or G <400> 10 atgggcttat ctcgtagctg aatgctgtac agaaaagcaa tgtaaataaa gggacgatcc 60 ntgcttatta aacttactat ttgccaatat actttccacc acctctgaaa cctgcgctac 120 c 121

Claims (14)

서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 단일염기다형성(single nucleotide polymorphism, SNP);
서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 T인 SNP;
서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP;
서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 C인 SNP;
서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP; 및
서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드에서 61번째 염기가 A 또는 G인 SNP;
를 검출 또는 증폭할 수 있는 제제를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단용 조성물.
Single nucleotide polymorphism (SNP) in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4;
SNP in which the 61st base is A or T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6;
SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7;
SNP in which the 61st base is A or C in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8;
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9; And
SNP in which the 61st base is A or G in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10;
A composition for predicting or diagnosing hypercholesterolemia in dogs, including an agent capable of detecting or amplifying.
제1항에 있어서, 상기 SNP를 검출 또는 증폭할 수 있는 제제는 프라이머 또는 프로브인 것을 특징으로 하는, 개의 고콜레스테롤혈증 예측 또는 진단용 조성물.
The composition for predicting or diagnosing hypercholesterolemia of a dog according to claim 1, wherein the agent capable of detecting or amplifying the SNP is a primer or a probe.
제1항의 조성물을 포함하는 것을 특징으로 하는, 개의 고콜레스테롤혈증 예측 또는 진단용 키트.
A kit for predicting or diagnosing hypercholesterolemia in dogs, comprising the composition of claim 1.
1) 개로부터 분리된 시료의 DNA로부터 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 부위를 증폭시키는 단계로서,
상기 SNP는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기 및 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드의 61번 염기인, 단계; 및
2) 상기 증폭된 SNP를 포함하는 부위에서 SNP의 염기 종류를 결정하는 단계를 포함하는, 개의 고콜레스테롤혈증 예측 또는 진단 방법.
1) Polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and Polynucleotide consisting of nucleotide sequence, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 5, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 6, polynucleotide consisting of nucleotide sequence of SEQ ID NO: 7, nucleotide sequence of SEQ ID NO: 8 As a step of amplifying a site including a SNP of a polynucleotide consisting of, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 9, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 10 or a complementary polynucleotide thereof,
The SNP is base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 , Base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 4, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 5, base 61 of a polynucleotide consisting of the base sequence of SEQ ID NO: 6, and sequence Base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, base 61 of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9, and SEQ ID NO: 10 The step, which is the 61st base of the polynucleotide consisting of the nucleotide sequence of; And
2) A method for predicting or diagnosing hypercholesterolemia in dogs, comprising the step of determining the base type of SNP at the site containing the amplified SNP.
제4항에 있어서, 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is all A, or when a base complementary to the genotype is identified at a corresponding position of a complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 2의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 T인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is all T, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 6의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The case of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 7의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 C인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is all C, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 8의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is all A, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 9의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 A인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is all A, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
제4항에 있어서, 서열번호 10의 염기서열로 구성되는 폴리뉴클레오티드의 SNP인 61번 염기가 모두 G인 경우, 또는 이의 상보적인 폴리뉴클레오티드의 대응되는 위치에서 상기 유전자형에 상보적인 염기가 확인되는 경우, 개의 고콜레스테롤혈증의 위험도가 증가된 것으로 판단하는 것인, 방법.
The method of claim 4, wherein the SNP of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is all G, or when a base complementary to the genotype is identified at the corresponding position of the complementary polynucleotide thereof. , To determine that the risk of hypercholesterolemia in dogs is increased.
KR1020190121850A 2019-10-01 2019-10-01 Composition for early predicting or diagnosing hypercholesterolemia in dog KR102185440B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190121850A KR102185440B1 (en) 2019-10-01 2019-10-01 Composition for early predicting or diagnosing hypercholesterolemia in dog

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190121850A KR102185440B1 (en) 2019-10-01 2019-10-01 Composition for early predicting or diagnosing hypercholesterolemia in dog

Publications (1)

Publication Number Publication Date
KR102185440B1 true KR102185440B1 (en) 2020-12-01

Family

ID=73790712

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190121850A KR102185440B1 (en) 2019-10-01 2019-10-01 Composition for early predicting or diagnosing hypercholesterolemia in dog

Country Status (1)

Country Link
KR (1) KR102185440B1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004113570A2 (en) * 2003-06-16 2004-12-29 Mars, Incorporated Genotype test for dogs
EP2873738A1 (en) * 2013-11-15 2015-05-20 Latvian Biomedical Research and Study Centre SNP composition and method for diagnosing risk for dyslipidemia
KR20170056726A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's food consumption and prediction method using the same
KR20170056723A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's body weight and prediction method using the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004113570A2 (en) * 2003-06-16 2004-12-29 Mars, Incorporated Genotype test for dogs
EP2873738A1 (en) * 2013-11-15 2015-05-20 Latvian Biomedical Research and Study Centre SNP composition and method for diagnosing risk for dyslipidemia
KR20170056726A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's food consumption and prediction method using the same
KR20170056723A (en) * 2015-11-13 2017-05-24 대한민국(농촌진흥청장) SNP marker for prediction of dog's body weight and prediction method using the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BMC Research Notes (2014) 7:904* *

Similar Documents

Publication Publication Date Title
EP2502994A1 (en) Primer set for amplification of mthfr gene, mthfr gene amplification reagent comprising same, and use of same
KR102124652B1 (en) Composition for early predicting or diagnosing anxiety disorder in dog
KR101450792B1 (en) Novel SNP marker for discriminating Black Coat Colour of Pig and use thereof
KR102194878B1 (en) Composition for early predicting or diagnosing mental stability in dog
KR101312480B1 (en) Novel snp marker for discriminating number of rib of pig and use thereof
KR102124770B1 (en) Composition for early predicting or diagnosing hip dysplasia in dog
KR102185440B1 (en) Composition for early predicting or diagnosing hypercholesterolemia in dog
KR102167792B1 (en) Composition for early predicting or diagnosing hypercalcemia in dog
JP2008545444A (en) IL10SNP associated with acute rejection
KR102194880B1 (en) SNP marker for prediction of dog&#39;s diabetes risk and prediction method using the same
KR102194881B1 (en) SNP marker for prediction of dog&#39;s obesity and prediction method using the same
KR102470954B1 (en) Development of genetic markers for early prediction of body length of Jindo dogs
KR102470958B1 (en) Development of genetic markers for early prediction of weight of Jindo dogs
KR102470971B1 (en) Development of genetic markers for early prediction of body length vs. height ratio in Jindo dogs
KR102470966B1 (en) Development of genetic markers for early prediction of body height of Jindo dogs
KR102475362B1 (en) SNP marker for prediction of dog&#39;s activity and prediction method using the same
KR102475364B1 (en) SNP marker for prediction of dog&#39;s environmental adaptability and prediction method using the same
JP2006254735A (en) Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes
KR102141607B1 (en) Composition for predicting or diagnosing progressive retinal atrophy in dog
KR102194879B1 (en) SNP marker for prediction of dog&#39;s owner friendliness and prediction method using the same
KR102141604B1 (en) Composition for predicting or diagnosing luxating patella in dog
KR102182740B1 (en) Composition for identifying a bovine backfat thickness comprising an agent capable of detecting or amplifying a haplotype
KR102083674B1 (en) Composition for identifying a bovine carcass weight trait comprising an agent capable of detecting or amplifying a haplotype
JP2006254739A (en) Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes
JP2008545446A (en) IMPDH2SNP associated with acute rejection

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant