KR101024114B1 - PCR primer pair detecting Pea enation mosaic virus and method for detecting Pea enation mosaic virus using the same - Google Patents

Abstract

The present invention relates to a pair of PCR primers for detecting pea blast mosaicism virus and a method for detecting pea blast mosaicism virus using the same, more specifically, a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 6; PCR primer pair selected from the group consisting of primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5 and primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 6, and RT-PCR or RT-PCR using the same And it relates to a method for detecting pea pea mosaic virus by the method of binding nested PCR. The present invention provides a PCR primer pair that can specifically detect PEMV in a sample, particularly a legume sample, a PEMV detection method using the same, and a kit for PEMV detection. Such PCR primer pairs, detection methods, and detection kits of the present invention can be quickly, easily and accurately confirmed the presence of PEMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Pea killer virus, RT-PCR, Legumes, Nested PCR, Quarantine

Description

PCR primer pair detecting Pea enation mosaic virus and method for detecting Pea enation mosaic virus using the same}

The present invention relates to a pair of PCR primers for detecting pea blast mosaicism virus and a method for detecting pea blast mosaicism virus using the same, more specifically, a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 6; PCR primer pairs for detecting Pea enation mosaic virus selected from the group consisting of a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 and a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 6, and RT using the same The present invention relates to a method for detecting pea-produced mosaic virus by a method of combining PCR or RT-PCR and nested PCR.

 In the past, electron microscopy and serological methods (ELISA) were mainly used for the diagnosis of viruses. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among the serological methods, enzyme linked immunosorbent assay (ELISA) is about 1000 times lower in sensitivity than the most commonly used diagnostic methods or PSI, and unexpected nonspecific reactions between antibodies and test samples. Often, the diagnosis fails.

Therefore, in the current diagnosis of viruses, the PCR method having high detection sensitivity and convenience is most commonly used. An important point in the development of primers for the PCR diagnosis of pathogens is that they should be able to detect all lines and isolates present in the first viral species. To this end, primers should be designed for nucleotide sequences common to all strains and isolates of the viral species to be detected. Second, there must be specificity between different species. For this purpose, primers should be designed that do not react to the sequences of other viruses that are flexible to the virus species to be detected.

Pea projecting mosaic virus (PEMV; Pea enation mosaic virus) is a diameter of the composite of a spherical virus of 28nm recent study interdependent two kinds of viruses (Enamovirus pea enation mosaic virus-1 (PEMV-1), Umbravirus pea enation mosaic virus- 2 (PEMV-2)). In general, PEMV refers to a combination of two viruses. PEMV-1 has 5.7 kb and PEMV-2 has 4.3 kb of RNA. Depending on the isolate, it has 0.72 kb of satellite RNA. Taxonomically, PEMV-1 belongs to the genus Luteoviridae (Enamovirus), and PEMV-2 is included in the Umbravirus. It is mainly infected by legumes by succulents, aphids and seeds. Currently, various kinds and large amounts of legumes are imported from foreign countries. Therefore, it is necessary to develop accurate, fast and simple detection methods to quarantine them.

Therefore, the present inventors have conducted a series of studies to develop a new method for specifically detecting the pea-projected mosaic virus. As a result, we have developed four new primer pairs that can specifically detect the pea-projected mosaic virus. The present invention was completed by confirming that it is possible to effectively detect the pea blast mosaicism virus in an unknown sample.

Accordingly, it is an object of the present invention to provide a pea primer mosaic detection, a PCR primer pair for assaying, and a pea pea mosaic virus detection method using the same.

In order to achieve the above object, the present invention is a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 6; Provided are PCR primer pairs for detecting pea pea mosaic virus selected from the group consisting of a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 and a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 6.

In order to achieve the other object of the present invention,

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(C) provides a method for detecting the pea blast mosaic virus from the sample comprising the step of separating the PCR product by size.

In order to achieve another object of the present invention, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) it provides a method for detecting the pea-propelled mother virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

In order to achieve another object of the present invention, the present invention provides a kit for detecting pea pea mosaic virus comprising a PCR primer pair for detection of the present invention.

Hereinafter, the present invention will be described in detail.

The PCR primer pair for detecting pea pea mosaic virus (PEMV) of the present invention specifically detects PEMV, and does not detect other Luteoviridae viruses that are similar in lineage with PEMV. It does not detect other viruses that are infected. Therefore, the PCR primer pair for detecting PEMV of the present invention can specifically detect PEMV when a legume is used as a sample. PCR primer pair for PEMV detection of the present invention is preferably a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 6; Primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5; Or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 6. More preferably, the PCR primer pair for detecting PEMV of the present invention may be a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 6 or a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5, wherein the primer pair is luteobiride It does not show non-specific amplification with other viruses that are infected with viruses or legumes, and can detect all isolates present in the species and can be used for more accurate detection.

The PCR primer pair of the present invention can be usefully used for detecting PEMV in a sample, particularly a legume sample. Accordingly, the present invention provides a method for detecting PEMV from a sample comprising performing PCR using the PCR primer pairs.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(C) provides a method for detecting the pea blast mosaic virus from the sample comprising the step of separating the PCR product by size.

The extraction of RNA in step (a) may be performed according to a method commonly used in the art, and may be performed using a commercially available RNA extraction kit.

In addition, in step (b), RT-PCR uses the isolated RNA as a template, the reverse primer among the primer pairs of the present invention is used as a primer, and synthesizes complementary DNA strands by reverse transcription using a reverse transcriptase, followed by PCR. The reaction can be carried out. The PCR reaction may be carried out using a PCR reaction mixture containing various components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to the complementary DNA synthesized by reverse transcription and the PCR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer, preferably 52-57 ° C., and more preferably 55 ° C. . The time and number of cycles in each step can be determined according to the conditions generally made in the art.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by agarose gel electrophoresis. After electrophoresis, the result of electrophoresis can be analyzed by ethidium bromide staining. General reverse transcription reactions, performing PCR and analyzing the results are well known in the art.

In addition, the present invention may further include the step of performing nested PCR to increase the accuracy of the detection reaction.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) it provides a method for detecting the pea-propelled mother virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

RNA extraction, RT-PCR and PCR product separation in steps (a), (b) and (d) are as described above, and nested PCR in step (c) is performed in step (b). RT-PCR may be amplified by a method of performing PCR using a nested primer (nested primer pair) to be amplified. At this time, the conditions of the PCR reaction are as described above, the nested primer pair is not limited as long as the RT-PCR product can be amplified, but for the primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 6 Is a primer pair of SEQ ID NO: 3 and SEQ ID NO: 7; Alternatively, the primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5 may be a primer pair of SEQ ID NO: 4 and SEQ ID NO: 6.

The addition of such a nested PCR step can minimize errors due to non-specific reactions in the detection of PEMV can be usefully used when necessary.

The present invention also provides a kit for detecting pea pea mosaic virus comprising a PCR primer pair according to the present invention. In addition to the PCR primer pairs, the kit may further include a DNA polymerase and a PCR reaction buffer solution of the above-described composition to easily perform the PCR reaction, and perform electrophoresis to confirm whether the PCR product is amplified. Components necessary for may be further included in the kit of the present invention.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

In one embodiment of the present invention, in order to design a PEMV diagnostic primer, the PEMV common base sequence is searched by comparing the nucleotide sequences of eight PEMV isolates known to date, targeting RNA of PEMV-1, and taxonomically similar to PEMV. Sequences similar to the viral sequences of seven Luteoviridae strains were selected. Based on this, eight primers were designed and 12 primer combinations were made using these primers (Tables 3 and 4).

In another embodiment of the present invention, four primer combinations having low non-specific reactions and strong response strength to PEMV by RT-PCR assay using RNA isolated from plants infected with PEMV as samples of the 12 primer combinations ( Combinations 2, 3, 5, 6) were selected. Then, the most excellent two primer combinations were selected by testing whether the first four primers selected by using different kinds of viruses infected with legumes responded to the different kinds of viruses.

In one test example of the present invention, PEMV was detected using a primer combination selected from a sample suspected of being infected with PEMV. As a result, each primer combination and the results of nested PCR for them were also amplified well confirmed that the sample was infected with PEMV.

Accordingly, the present invention provides a PCR primer pair that can specifically detect PEMV in a sample, particularly a legume sample, a PEMV detection method using the same, and a kit for PEMV detection. Such PCR primer pairs, detection methods, and detection kits of the present invention can be quickly, easily and accurately confirmed the presence of PEMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Design of PEMV Diagnostic Primer

The design of the PEMV diagnostic primers consisted of the 3 ′ end region encoded by the envelope protein and aphid transmission proteins in PEMV-1. In order to search for species-specific sequences, the base sequences of eight known PEMV isolates (Table 1) were compared to find common base sequences, which were classified into seven viral bases of Luteoviridae, which are taxonomically similar to PEMV. Compared to the sequence (Table 2), a group of nucleotide sequences specific to PEMV species was found. Eight diagnostic primers were designed based on this species-specific sequence group (Table 3; locations in Table 3 were based on Genbank ac. No. L04573). The positions of the designed primers are as shown in FIG. 1 and 12 primer combinations were made using these primers (Table 4; positions in Table 4 were prepared based on Genbank ac. No. L04573).

Sequences of PEMV Isolates Used for Common Base Sequence Analysis Separator or System Genbank ac. no. Size (bp) Analysis genome PEMV-1-WSG L04573 5706 RNA-1 PEMV-1-AT- Y09100 1969 RNA-1 PEMV-1-AT + Y09099 1970 RNA-1 PEMV AT-D Y09098 1235 RNA-1 PEMV-1-SP AF082833 1485 RNA-1 PEMV1-cp Z48507 1482 RNA-1 PEMV1-UP58 AY661882 570 RNA-1 PEMV1-LAN AY007257 711 RNA-1

Ruteoviride virus sequencing used for species-specific sequencing virus Genbank ac. no. Size (bp) Analysis genome BYDV-MAV-P-PAV D11028 5273 RNA-1 BYDV-PAV-Australia X07653 5677 RNA-1 CYDV-RPV-NY L25299 5723 RNA-1 BLRV AF441393 5964 RNA-1 SbDV-YS-M93-1 AB038147 5853 RNA-1 BWYV-USA AF473561 5666 RNA-1 PLRV-Wageningen Y07496 5882 RNA-1 CtRLV-UK-1 AY695933 5723 RNA-1

Diagnostic primers designed from PEMV species consensus sequences order
number Primer Name direction Sequence Length
(bp) location One PEM-N10 Forward GCTATCGGCCCTCCAATCCA 20 3,708 3,727 2 PEM-N20 Forward TGCGACATATGCCCCAAGATTTT 23 3,740 3,762 3 PEM-N30 Forward ACCCAGTCTCGCCGTCCTA 19 4,089 4,107 4 PEM-N40 Forward AAGAAGGCCGCCGATGTAGTGTTGC 25 4,359 4,383 5 PEM-C10 Reverse GAGATTCGGGTACGCCTTCATA 22 4,668 4,689 6 PEM-C20 Reverse GTGCCGCGATATAGGAAAAAGAACT 25 4,474 4,498 7 PEM-C30 Reverse TACATCGGCGGCCTTCTTAGTTC 23 4,354 4,376 8 PEM-C40 Reverse GGCCTTCTCCTCCGTTGATTAGC 23 4,023 4,045

PEMV Diagnostic Primer Combination and RT-PCR Anticipated Products Combination Reverse location Forward location Product (bp) One PEM-C10 4,668-4,689 PEM-N40 4,359-4,383 331 2 PEM-N30 4,089-4,107 601 3 PEM-N20 3,740-3,762 950 4 PEM-N10 3,708-3,727 982 5 PEM-C20 4,474-4,498 PEM-N30 4,089-4,107 410 6 PEM-N20 3,740-3,762 759 7 PEM-N10 3,708-3,727 791 8 PEM-C30 4,354-4,376 PEM-N30 4,089-4,107 288 9 PEM-N20 3,740-3,762 637 10 PEM-N10 3,708-3,727 669 11 PEM-C40 4,023-4,045 PEM-N20 3,740-3,762 306 12 PEM-N10 3,708-3,727 338

<Example 2>

Selection of PEMV Diagnostic Primer Combinations

Among the 12 PEMV diagnostic primer combinations of Table 4, the most effective primer combinations for PEMV diagnosis were selected as follows. First, a combination of PEMV-infected plants with a strong response to PEMV and a low non-specific response was selected first, and then a primer combination that specifically reacts to PEMV was selected using another virus infected with legumes.

<2-1> Selection through RT-PCR with PEMV Infected Plants

RNA was isolated from the PEMV infected plant as a sample, and it was confirmed whether the genome of PEMV could be amplified by RT-PCR.

Separation of total RNA from the sample was carried out using a commercially available total RNA separation kit (method using phenol (Promega), TRIzol (Invitrogen Co.), easy-spin TM Total RNA Kit (iNtRON Co.).

Reverse transcription reaction was performed with 0.5 μl total RNA isolated, 12.5 pmole downstream primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT, pH 8.5). ) 5 μl of the reaction solution containing 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out in 5 μl of reverse transcriptase and 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15). 2 μl of mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were confirmed by electrophoresis using 0.5 × TBE buffer and 1.5% agarose gel and stained with ethidium bromide.

As a result, as shown in Figure 2, in the RT-PCR assay with PEMV infected plants, it was possible to confirm the PEMV-specific response in all 12 primer combinations. Among them, five primer combinations (combination 2, 3, 5, 6, 11) were selected which were excellent in intensity of reaction and did not show nonspecific reactions that interfere with diagnosis. Of these, Combination 11 was so difficult to nested PCR because the size of the PCR product was too small, except for this, four (combination 2, 3, 5, 6) primers were selected first.

<2-2> Analysis of reaction with other viruses infected with legumes

The four primer combinations selected above were analyzed by RT-PCR with 14 viruses infected with legumes.

Viruses Used in RT-PCR Virus Display Alfalfa mosaic virus AMV Arabis mosaic virus ArMV Bean yellow mosaic virus BYMV Beet mosaic virus BtMV Cowpea chlorotic mottle virus CCMV Cowpea mild mottle virus CPMMV Cowpea severe mosaic virus CPSMV Cucumber mosaic virus CMV Grapevine fanlef virus GFLV Prune dwarf virus PDV Ribgrass mosaic virus RMV Soybean mosaic virus SMV Tobacco rattle virus TRV Tomato bushy stunt virus TBSV

To this end, RNA and P-RT reaction were performed as shown in <Example 2-1> using the viruses and PEMV listed in Table 5, respectively.

As a result, as shown in Figure 3, it was confirmed that the primer combinations 2 and 6 are not specifically amplified in 14 viruses infected with legumes, and the two primer combinations are the most preferable primer combinations for PEMV assay. Could know.

<Example 3>

Selection of primer combinations for assaying PEMV diagnostic results

Assay primer combinations are PEMV species specific and the base sequences of the primers must be located in the diagnostic results.

Accordingly, assay primer combinations were selected from the diagnostic primer candidate groups shown in Table 3. PEM-C20 and PEM-N40 combinations were selected for the assay using the primer combination 2, and PEM-C30 and PEM-N30 were selected for the assay using the primer combination 6.

Primer Combinations and PCR Anticipated Products for PEMV Assays Black target product Primer name for assay Sequence number Expected product length Combination 2
(PEM-C10 / N30, 601bp) PEM-C20 6 140 bp PEM-N40 4 Combination 6
(PEM-C20 / N20, 759 bp) PEM-C30 7 288bp PEM-N30 3

<Example 4>

Examples of PEMV Diagnostics and Assays

Samples suspected of being infected with PEMV were crushed in RNase free state and RNA was isolated using TRIzol. Using isolated RNA, RT-PCR was performed using primer combinations 2 and 6 of the present invention in the same manner as in <Example 2-1>, and the results were confirmed by electrophoresis. In addition, nested PCR was performed using primer combinations suitable for each of the results shown in Table 6 for the assay of the results obtained by RT-PCR using the primer combinations 2 and 6. The result obtained by RT-PCR and the result of the nested PCR for assay were electrophoresed in the same manner as in <Example 2-1> to confirm the result.

As a result, as shown in FIG. 4, PEMV diagnosis was successfully performed using primer combinations 2 and 6, respectively. As a result, the nested PCR for the assay was also amplified well and confirmed that the sample was infected with PEMV.

In addition, in order to use as a positive control for PEMV detection, a plasmid containing the entire region (base sequence 9) designed the primer was prepared. As a result of PCR for primer combinations 2 and 6, it was found that amplification was well performed as shown in FIG. 5.

As described above, the present invention provides a PCR primer pair that can specifically detect PEMV in a sample, particularly a legume sample, a PEMV detection method using the same, and a kit for PEMV detection. Such PCR primer pairs, detection methods, and detection kits of the present invention can be quickly, easily and accurately confirmed the presence of PEMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

1 is Genbank ac. no. Primer position for PEMV diagnosis based on L04573.

Figure 2 confirms the specificity of 12 primer combinations with PEMV. Total RNA extracted from tobacco leaf tissues infected with PEMV was used as RT-PCR template. M: size marker; Lanes 1 to 12 represent combinations of 1 to 12 primers in Table 4.

Figure 3 shows the RT-PCR results of legume-associated virus using the primary selected PEMV diagnostic primer combination. M: size marker; 1: PEMV, 2: CPMMV, 3: AMV, 4: ArMV, 5: BYMV, 6: BtMV, 7: CCMV, 8: CPSMV, 9: CMV, 10: GFLV, 11: PDV, 12: RMV, 13: SMV, 14: TRV, 15: TBSV.

Figure 4 shows the PEMV diagnostic primer combination and nested PCR results. (M: size marker; 1: primer combination 2 (601bp); 2: assay for nested PCR (PEM-C20 / PEM-N40) (140bp) 3; primer combination 6 (759 bp); 4: nested PCR for assay for combination 6 (PEM-C30 / PEM-N30) (288 bp))

Fig. 5 shows the results of PCR using PEMV positive control as a sample. (M: size marker; 1: PEMV DNA fragment inserted into the positive control (982 bp); 2: primer combination 6 (759 bp); 3: primer combination 2 (601 bp))

<110> Republic of Korea (Management: Rural Development Administration) <120> PCR primer pair detecting Pea enation mosaic virus and method for          detecting Pea enation mosaic virus using the same <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for detecting Pea enation mosaic virus (PEMV) <400> 1 gctatcggcc ctccaatcca 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for detecting Pea enation mosaic virus (PEMV) <400> 2 tgcgacatat gccccaagat ttt 23 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for detecting Pea enation mosaic virus (PEMV) <400> 3 acccagtctc gccgtccta 19 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for detecting Pea enation mosaic virus (PEMV) <400> 4 aagaaggccg ccgatgtagt gttgc 25 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for detecting Pea enation mosaic virus (PEMV) <400> 5 gagattcggg tacgccttca ta 22 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for detecting Pea enation mosaic virus (PEMV) <400> 6 gtgccgcgat ataggaaaaa gaact 25 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for detecting Pea enation mosaic virus (PEMV) <400> 7 tacatcggcg gccttcttag ttc 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for detecting Pea enation mosaic virus (PEMV) <400> 8 ggccttctcc tccgttgatt agc 23 <210> 9 <211> 982 <212> DNA <213> Pea enation mosaic virus <400> 9 gctatcggcc ctccaatcca tattggagga aatgcgacat atgccccgag gttttgtgga 60 catgcttata gaacatctcg gggttgggga tctggtagag tgattcccca gggatattgg 120 aatagggaag ccggctacgg ccaccatgaa ttgacatggt tccagtccgg aaagacttta 180 aactatttta ccgctggcaa gcggtcttac aaatatgcgg gttgagtact tgggaccctc 240 cttatccaag tgaaaattag ataaggaaaa tccaggaccc tccagtaagc gatgccgact 300 agatcgagat cgaaaactaa tcaacggagg agaaggccta gaagggtagt cgtggtggca 360 ccctctatgg ctcaacctag gactcagtct cgccgtccta ggcgcagaaa taagcgaggc 420 gggggattga atggctccca caccgtggat ttctccatgg tgcatgggcc atttaatggc 480 aatgccactg gcacagttaa attcggaccc tcctccgact gtcagtgtat aaagggaaac 540 ctagccgctt accaaaagta taggatcgta tggttgaggg ttgtctatca atctgaggcc 600 gcagccactg atcgtggttg catagcctac catgtggaca cctccacaac caagaaggcc 660 gccgatgtag tgttgcttga cacttggaat attcgttcca atgggtccgc cactttcggt 720 cgtgaaattc ttggtgacca gccgtggtac gagtccaata aagatcagtt ctttttccta 780 tatcgcggca cgggtggtac cgacgtggct ggacactacc ggatttctgg taggatccag 840 ctaatgaatg cctccctctg aggggacgac gctcccccgt caccagggcc cgatcccggg 900 tcccaaccac caccacctcc acccccaagt cccactcccg taggagctcg tttctggggc 960 tatgaaggcg tacccgaatc tc 982  

Claims (6)

Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 6; PCR primer pair for detecting Pea enation mosaic virus selected from the group consisting of a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 and a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 6. The PCR primer pair according to claim 1, which is a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 6 or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 5. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And (c) detecting pea pea mosaic virus from a sample comprising separating the PCR products by size. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 2; (c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And (d) detecting pea pea mosaic virus from a sample comprising the step of separating the nested PCR product of step (c) by size. The method according to claim 4, wherein the nested primer pair is a primer pair of SEQ ID NO: 3 and SEQ ID NO: 7 for the primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 6; Or about a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 is a primer pair of SEQ ID NO: 4 and SEQ ID NO: 6. Pea protrusion moxa virus detection kit comprising a primer pair of claim 1.

Images