KR101024117B1 - PCR primer pair detecting Southern bean mosaic virus and method for detecting Southern bean mosaic virus using the same - Google Patents

Abstract

The present invention relates to a PCR primer pair for Southernbin mosaic virus detection and a Southern bean mosaic virus detection method using the same, more specifically, a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9; And PCR primer pairs for detecting Southern bean mosaic virus ( SBMV) selected from the group consisting of the primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5, and RT-PCR or RT-PCR and nested PCR using the same. The present invention relates to a method for detecting Southern bean mosaic virus by a binding method. The present invention provides a PCR primer pair that can specifically detect Southern bean mosaic virus in a sample, a Southern bean mosaic virus detection method using the same, and a Southern bean mosaic virus detection kit. Such PCR primer pairs, detection methods, and detection kits of the present invention can be used quickly and easily and accurately in industrial and quarantine sites, since it is possible to quickly, easily, and accurately confirm the presence of Southern bean mosaic virus in an unknown sample.

Southern Bean Mosaic Virus, RT-PCR, Nested PCR, Quarantine

Description

PCR primer pair detecting Southern bean mosaic virus and method for detecting Southern bean mosaic virus using the same}

The present invention relates to a PCR primer pair for Southernbin mosaic virus detection and a Southern bean mosaic virus detection method using the same, more specifically, a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9; And PCR primer pairs for detecting Southern bean mosaic virus selected from the group consisting of the primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5 and a method of binding RT-PCR or RT-PCR and nested PCR using the same The present invention relates to a method for detecting Southern bean mosaic virus.

In the past, electron microscopy and serological methods (ELISA) were mainly used for the diagnosis of viruses. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among the serological methods, enzyme linked immunosorbent assay (ELISA) is about 1000 times lower in sensitivity than the most commonly used diagnostic methods or PSI, and unexpected nonspecific reactions between antibodies and test samples. Often, the diagnosis fails.

Therefore, in the diagnosis of a virus, a PCR method having high detection sensitivity and convenience is most commonly used. An important point in the development of primers for PCR diagnosis of pathogens is that, first, all strains and isolates present in the viral species must be detected. To this end, primers should be designed for nucleotide sequences common to all strains and isolates of the viral species to be detected. Second, there must be specificity between different species. For this purpose, primers should be designed that do not react to the sequences of other viruses that are flexible to the virus species to be detected.

Southern bean mosaic virus is a 26 nm diameter spherical virus composed of single stranded RNA. The total nucleic acid of SBMV is about 8.4 kb, RNA 1 is about 3.2 kb, RNA 2 is about 3.1 kb, and RNA 3 is about 2.2 kb. Taxonomically it belongs to the genus Sobemovirus. SBMV is mainly transmitted by juices and beetles. SBMV is naturally associated with legumes in most hosts. At present, various kinds and large amounts of plants are imported from foreign countries, and it is urgent to develop accurate, fast and simple detection methods to quarantine them.

Therefore, the present inventors have conducted research to develop a new method for specifically detecting Southern bean mosaic virus, and as a result, we have developed 12 new primer pairs that can specifically detect Southern bean mosaic virus. The present invention was completed by confirming that Southernbin mosaic virus can be effectively detected in an unknown sample.

Accordingly, an object of the present invention is to provide a Southern primer mosaic virus detection, assay PCR primer pair, and Southern bean mosaic virus detection method using the same.

In order to achieve the above object, the present invention is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9; And it provides a PCR primer pair for Southernbin mosaic virus virus selected from the group consisting of the primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5.

In order to achieve the other object of the present invention,

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(c) provides a method for detecting Southern bean mosaic virus from a sample comprising the step of separating the PCR product by size.

In order to achieve another object of the present invention, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(D) provides a method for detecting the Southern bean mosaic virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

In order to achieve another object of the present invention, the present invention provides a Southern bean mosaic virus detection kit comprising a PCR primer pair for detection of the present invention.

Hereinafter, the present invention will be described in detail.

The pair of PCR primers for detecting Southern Bind Mosaic Virus (SBMV) specifically detects SBMV, and does not detect other Sobemoviruses that are systematically similar to SBMV, and do not detect other viruses. . Therefore, the PCR primer pair for SBMV detection of this invention can detect SBMV specifically. PCR primer pair for detecting SBMV of the present invention is preferably a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9; And it may be a PCR primer pair for detecting the Southern Bean Mosaic Virus selected from the group consisting of the primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5. More preferably, the PCR primer pair for detecting SBMV of the present invention may be a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Or a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 5. The primer pairs do not show non-specific amplification with karavirus or other viruses and can detect all isolates present in the species, and thus can be used for more accurate detection.

The PCR primer pair of the present invention can be usefully used to detect SBMV in a sample. Accordingly, the present invention provides a method for detecting SBMV from a sample comprising performing PCR using the PCR primer pairs.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(c) provides a method for detecting Southern bean mosaic virus from a sample comprising the step of separating the PCR product by size.

The extraction of RNA in step (a) may be performed according to a method commonly used in the art, and may be performed using a commercially available RNA extraction kit.

In addition, in step (b), RT-PCR uses the isolated RNA as a template, the reverse primer among the primer pairs of the present invention is used as a primer, and synthesizes complementary DNA strands by reverse transcription using a reverse transcriptase, followed by PCR. The reaction can be carried out. The PCR reaction may be carried out using a PCR reaction mixture containing various components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to the complementary DNA synthesized by reverse transcription and the PCR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer, preferably 52-57 ° C., and more preferably 55 ° C. . The time and number of cycles in each step can be determined according to the conditions generally made in the art.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by agarose gel electrophoresis. After electrophoresis, the result of electrophoresis can be analyzed by ethidium bromide staining. General reverse transcription reactions, performing PCR and analyzing the results are well known in the art.

In addition, the present invention may further include the step of performing nested PCR to increase the accuracy of the detection reaction.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(D) provides a method for detecting the Southern bean mosaic virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

RNA extraction, RT-PCR and PCR product separation in steps (a), (b) and (d) are as described above, and nested PCR in step (c) is performed in step (b). RT-PCR may be amplified by a method of performing PCR using a nested primer (nested primer pair) to be amplified. At this time, the conditions of the PCR reaction are as described above, the nested primer pair is not limited as long as the RT-PCR product can be amplified, but for the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7 Primer pairs of SEQ ID NO: 2 and SEQ ID NO: 9; And a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 may be a primer pair of SEQ ID NO: 4 and SEQ ID NO: 6.

The addition of such a nested PCR step can minimize errors due to non-specific reactions in the detection of SBMV can be usefully used when necessary.

In another aspect, the present invention provides a kit for Southern bean mosaic virus detection comprising a PCR primer pair according to the present invention. In addition to the PCR primer pairs, the kit may further include a DNA polymerase and a PCR reaction buffer solution of the above-described composition to easily perform the PCR reaction, and perform electrophoresis to confirm whether the PCR product is amplified. Components necessary for may be further included in the kit of the present invention.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

In one embodiment of the present invention, SBMV common base by comparing the nucleotide sequence of the seven known SBMV isolates to the RNA 3 encoded in the envelope protein and the virus movement of the subgenomic RNA is made to design the SBMV diagnostic primer Sequences were searched and sequences that did not resemble viral sequences of seven Sobemoviruses that were taxonomically similar to SBMV were selected. Based on this, 10 primers were designed and 12 primer combinations were made using these primers (Tables 3 and 4).

In another embodiment of the present invention, RT-PCR assay using RNA isolated from SBMV-infected plants as a sample of the 12 primer combinations shows a combination of six primers having a low non-specific reaction and a strong reaction strength against SBMV ( Combinations 2, 3, 5, 6, 10, 11) were selected first. Then, using the different kinds of viruses, the first two selected primers were tested to respond to the different kinds of viruses to select the best two primer combinations.

In another embodiment of the present invention, SBMV was detected using a combination of primers selected from samples suspected of being infected with SBMV. As a result, each primer combination and the results of nested PCR for them were also amplified well, confirming that the sample was infected with SBMV.

Accordingly, the present invention provides a PCR primer pair capable of specifically detecting SBMV in a sample, an SBMV detection method using the same, and a kit for detecting SBMV. Such PCR primer pairs, detection methods, and detection kits of the present invention can be quickly, easily and accurately confirmed whether SBMV is present in an unknown sample, and thus can be useful in industrial and quarantine sites.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Design of SBMV Diagnostic Primer

The design of the SBMV diagnostic primers consisted of RNA 3 encoding the envelope protein and the migration of the virus from which the subgenomic RNA was made. In order to search for species-specific nucleotide sequences, nucleotide sequences of seven known SBMV isolates (Table 1) are compared to find a common nucleotide sequence, which is a virus nucleotide sequence of seven sobemoviruses that are taxonomically similar to SBMV. Compared with Table 2, SBMV species specific sequence group was found. Ten diagnostic primers were designed based on this species specific sequence group (Table 3; locations in Table 3 were prepared based on Genbank ac. No. AF055887). The positions of the designed primers are shown in FIG. 1, and 12 primer combinations were made using these primers (Table 4; positions in Table 4 were prepared based on Genbank ac. No. AF055887).

SBMV Isolates Used for Common Base Sequence Analysis Separator or System Genbank ac. no. Size (bp) SBMV-B (ARK) -Arkansas AF055887 AF055887 SBMV-S-Arkansas AF055888 AF055888 SBMV-Bean L34672 L34672 SBMV-B-spanish AJ414558 AJ414558 SBMV-Ag3 AJ748276 AJ748276 SBMV-Sao Paulo AY340586 AY340586 SBMV-Sao Paulo AY340587 AY340587

Sobemovirus sequencing used for species-specific sequencing virus Genbank ac. no. Size (bp) SeMV AY004291 4148 SCMV M23021 4194 CoMV Z48630 4082 LTSV-New Zealand isolate U31286 4275 RYMV L20893 4450 SCMoV-p23 AF208001 4258 TRoV AY177608 4037

Diagnostic primers designed from the SBMV species consensus sequence SEQ ID NO: Primer Name direction Sequence Length (bp) location One SBM-N10 Forward AACAACCATTTCCGGTCGCT 20 2,965-2,984 2 SBM-N20 Forward CGCTTACGTGAACCATCGCTTAGAA 25 3,384-3,408 3 SBM-N30 Forward AATATAGTTTGTTGTCGGT 19 3,550-3,568 4 SBM-N40 Forward GTCTGGATCCTCTGGCTTGTGCTAC 25 3,710-3,734 5 SBM-C10 Reverse AAAGAGAGGGGTGCAGGTATTA 22 4,020-4,041 6 SBM-C15 Reverse TACGACACGTATAAGCGTCCAGTA 24 3,938-3,961 7 SBM-C20 Reverse CTGTCCAACGTCCAGTGTGGTCGT 24 3,774-3,797 8 SBM-C30 Reverse GCCATTTATGTAGCACAAGCCAGAG 25 3,719-3,743 9 SBM-C40 Reverse TATGAATGGACCCAGATGTCGTTGA 25 3,597-3,621 10 SBM-C50 Reverse CACACCTCCAGCCGTTCTAAGCGAT 25 3,398-3,422

SBMV Diagnostic Primer Combination and RT-PCR Expected Products Combination Reverse location Forward location Product (bp) One SBM-C50 3,398-3,422 SBM-N10 2,965-2,984 458 2 SBM-C40 3,597-3,621 SBM-N10 2,965-2,984 657 3 SBM-N20 3,384-3,408 238 4 SBM-C30 3,719-3,743 SBM-N10 2,965-2,984 779 5 SBM-N20 3,384-3,408 360 6 SBM-C20 3,774-3,797 SBM-N10 2,965-2,984 833 7 SBM-N20 3,384-3,408 414 8 SBM-N30 3,550-3,568 248 9 SBM-C10 4,020-4,041 SBM-N10 2,965-2,984 1,077 10 SBM-N20 3,384-3,408 658 11 SBM-N30 3,550-3,568 492 12 SBM-N40 3,710-3,734 332

<Example 2>

Selection of SBMV Diagnostic Primer Combinations

Of the 12 SBMV diagnostic primer combinations of Table 4, the most effective primer combinations for SBMV diagnosis were selected as follows. First, a combination of SBMV-infected plants with a strong and non-specific response to SBMV is selected first, and then a primer that specifically reacts to SBMV using 18 other viruses infected with legumes, the natural host of SBMV. The combination was finalized.

<2-1> Selection through RT-PCR with SBMV Infected Plants

RNA was isolated using SBMV infected plants as a sample, and it was confirmed whether the genome of SBMV could be amplified by RT-PCR.

Isolation of total RNA from the sample was carried out using commercially available total RNA isolation kits (Prophenol using phenol (Promega), TRIzol (Invitrogen Co.), easy-spin TM Total RNA Kit (iNtRON Co.)). .

Reverse transcription reaction was performed with 0.5 μl total RNA isolated, 12.5 pmole downstream primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT, pH 8.5). ) 5 μl of the reaction solution containing 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out in 5 μl of reverse transcriptase and 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15). 2 μl of mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were confirmed by electrophoresis using 0.5 × TBE buffer and 1.5% agarose gel and stained with ethidium bromide.

As a result, as shown in Figure 2, in the RT-PCR assay with SBMV infected plants, it was possible to confirm the SBMV specific response in all 12 primer combinations. Among them, 6 primer combinations (combination 2, 3, 5, 6, 10, 11), which were excellent in intensity of reaction and did not show nonspecific reactions for diagnosis, were selected first.

<2-2> Analysis of reaction with other viruses related to host of SBMV

Six primer combinations selected above were analyzed by RT-PCR with 18 other viruses occurring in legumes related to SBMV host.

Viruses Used in RT-PCR Virus Display Alfalfa mosaic virus AMV Arabis mosaic virus ArMV Bean yellow mosaic virus BYMV Beet mosaic virus BtMV Cowpea chlorotic mottle virus CCMV Cowpea mild mottle virus CPMMV Cowpea severe mosaic virus CPSMV Cucumber mosaic virus CMV Grapevine fanlef virus GFLV Prune dwarf virus PDV Ribgrass mosaic virus RMV Soybean mosaic virus SMV Squash mosaic virus SqMV Tomato bushy stunt virus TBSV Tobacco rattle virus TRV Tobacco mosaic virus TMV Tomato spotted wilt virus TSWV Turnip mosaic virus TuMV

To this end, RNA and SRT-PCR reactions were performed as in <Example 2-1> using the viruses and SBMV listed in Table 5 as samples, respectively.

As a result, as shown in Figs. 3 and 4, it was confirmed that primer combinations 6 and 11 were not specifically amplified in other viruses occurring in legumes related to the host of SBMV, and the two primer combinations were used for SBMV assay. It was found that the primer combination is the most preferable.

<Example 3>

Selection of primer combinations for assaying SBMV diagnostic results

Assay primer combinations are SBMV species specific and the base sequence of the primer must be located in the diagnostic output.

Accordingly, assay primer combinations were selected from the diagnostic primer candidate groups shown in Table 4. SBM-C40 and SBM-N20 combinations were selected for the assay using the primer combination 6, and SBM-C15 and SBM-N40 combinations were selected for the assay using the primer combination 11.

Primer Combinations and PCR Anticipated Products for SBMV Assays Black target product Primer name for assay Sequence number Expected product length Combination 6
(SBM-C20 / N10, 833 bp) SBM-N20 2 238 bp SBM-C40 9 Combination 11
(SBM-C10 / N30, 492bp) SBM-N40 4 252 bp SBM-C15 6

<Example 4>

Examples of SBMV Diagnostics and Assays

Samples suspected of being infected with SBMV were crushed in RNase free state and RNA was isolated using TRIzol. Using isolated RNA, RT-PCR was performed using primer combination 6 or 11 of the present invention in the same manner as in <Example 2-1>, and the results were confirmed by electrophoresis. In addition, nested PCR was performed using primer combinations suitable for each of the results shown in Table 6 for the assay of the results obtained by RT-PCR using the primer combination 6 or 11. The result obtained by RT-PCR and the result of the nested PCR for assay were electrophoresed in the same manner as in <Example 2-1> to confirm the result.

As a result, as shown in FIG. 5, SBMV diagnosis was successfully performed using primer combinations 6 or 11, respectively. As a result, the nested PCR assay was also amplified well, confirming that the sample was infected with SBMV.

In addition, in order to use as a positive control for the detection of SBMV, a plasmid containing the entire region (base sequence 11) designed the primer was prepared. As a result of performing PCR on primer combination 6 or 11, the amplification was well performed as shown in FIG. 6.

As described above, the present invention provides a PCR primer pair capable of specifically detecting SBMV in a sample, particularly a legume sample, an SBMV detection method using the same, and a kit for detecting SBMV. Such PCR primer pairs, detection methods, and detection kits of the present invention can be quickly, easily and accurately confirmed whether SBMV is present in an unknown sample, and thus can be useful in industrial and quarantine sites.

1 is Genbank ac. no. SBMV diagnostic primer position created based on AF055887.

Figure 2 confirms the specificity of the 12 primer combinations with SBMV. Total RNA extracted from soybean leaf tissues infected with SBMV was used as RT-PCR template. M: size marker; Lanes 1 to 12 represent combinations of 1 to 12 primers in Table 4.

Figure 3 shows the RT-PCR results of taxonomically similar caraviruses and host-associated viruses using a primary selected SBMV diagnostic primer combination. M: size marker; 1: SBMV, 2: AMV, 3: ArMV, 4: CCMV, 5: CPMMV, 6: CMV, 7: RMV, 8: SMV, 9: SqMV, 10: TMV, 11: TRV, 12: TBSV, 13: TSWV, 14: TuMV.

Figure 4 shows the RT-PCR results of taxonomically similar caraviruses and host-associated viruses using a primary selected SBMV diagnostic primer combination. M: size marker; 1: SBMV, 2: CPMMV, 3: AMV, 4: ArMV, 5: BYMV, 6: BtMV, 7: CCMV, 8: CPSMV, 9: CMV, 10: GFLV, 11: PDV, 12: RMV, 13: SMV, 14: TRV, 15: TBSV.

Figure 5 shows the nested PCR results of the SBMV diagnostic primer combination and assay primer combination. (M: size marker; 1: primer combination 6 (833 bp); 2: nested PCR for assay for combination 6 (SBM-C40 / SBM) -N20) (238 bp); 3: primer combination 11 (492 bp); 4: nested PCR for assay for combination 11 (SBM-C15 / SBM-N40) (252 bp))

Fig. 6 shows the PCR result using the SBMV positive control as a sample. (M: size marker; 1: SBMV DNA fragment inserted into the positive control (1,077bp); 2: primer combination 6 (833bp); 3: primer combination 11 (492bp))

<110> Republic of Korea (Management: Rural Development Administration) <120> PCR primer pair detecting Southern bean mosaic virus and method          for detecting Southern bean mosaic virus using the same <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SBM-N10: forward primer for detecting Southern bean mosaic          virus (SBMV) <400> 1 aacaaccatt tccggtcgct 20 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SBM-N20: forward primer for detecting Southern bean mosaic          virus (SBMV) <400> 2 cgcttacgtg aaccatcgct tagaa 25 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SBM-N30: forward primer for detecting Southern bean mosaic          virus (SBMV) <400> 3 aatatagttt gttgtcggt 19 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SBM-N40: forward primer for detecting Southern bean mosaic          virus (SBMV) <400> 4 gtctggatcc tctggcttgt gctac 25 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SBM-C10: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 5 aaagagaggg gtgcaggtat ta 22 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SBM-C15: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 6 tacgacacgt ataagcgtcc agta 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SBM-C20: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 7 ctgtccaacg tccagtgtgg tcgt 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SBM-C30: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 8 gccatttatg tagcacaagc cagag 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SBM-C40: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 9 tatgaatgga cccagatgtc gttga 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SBM-C50: reverse primer for detecting Southern bean mosaic          virus (SBMV) <400> 10 cacacctcca gccgttctaa gcgat 25 <210> 11 <211> 1077 <212> DNA <213> Southern bean mosaic virus <400> 11 aacaaccatt tccggtcgct tatacgaggt agagttctgc tctcacgtta taagggaaga 60 tcgatgttgg ttggcgtcgt ggcctaaaac tctgtttaaa tatttgtctg agggcaagtg 120 gttctttgag gacttggagc gagagctcag ttcatcaccc cactggccta gaatcagaca 180 ctacgtagtg gggaatactc catcgcccca caaaattaat ttagaaaatc aaagtccgcg 240 ctatggcgaa gaggttgaca aaacaacagt tagccaaggc tatagcgaac actctggaag 300 ccccggccac tcaatcgagg aggcccagga accggaggcg gcgtcgttct gctgcgaggc 360 agcctcagtc tacccaggct ggggtatcca tggcccctat tgctcagggg actatggttc 420 gcttacgtga accatcgctt agaacggctg gaggtgtgac agtcctaacg caccctgagc 480 tctcaactga gctctcagtg acgaatgcga tagtcatcac ctctgagctc gttatgccct 540 acacaatggg cacctggctt cgaggcgttg cggccaattg gtcaaaatat agtttgttgt 600 cggtgagata tacgtatctc ccctcttgtc cttcaacgac atctgggtcc attcatatgg 660 gtttccaata tgatatggct gacactcttc ccgtatccgt taaccagtta tccaacctta 720 gaggttatgt atcagggcag gtctggtctg gatcctctgg cttgtgctac ataaatggca 780 cgaggtgtct tgacacggcc aatgctatca cgaccacact ggacgttgga cagcttggca 840 agaagtggta tcctttcaag actagcacag atttcacaac ggctgttggc gtaaatgtca 900 acattgctac tcccctggtc ccggcgaggc tgataatagc catgctggat gggtcgagtt 960 ctacggctgt gagtactgga cgcctatacg tgtcgtatac tattcaactg atagagccca 1020 ctgctttggc cttgaacaac tgaggagttg tataataata cctgcacccc tctcttt 1077  

Claims (6)

Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 5; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9; And a PCR primer pair for detecting Southern bean mosaic virus selected from the group consisting of primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5. The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Or PCR primer pairs for Southern bean mosaic virus detection, which are primer pairs represented by SEQ ID NO: 3 and SEQ ID NO: 5. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And (C) method for detecting the Southern bean mosaic virus from the sample comprising the step of separating the PCR product by size. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 2; (c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And (D) a method for detecting Southern bean mosaic virus from a sample comprising the step of separating the nested PCR product of step (c) by size. The method according to claim 4, wherein the nested primer pair is a primer pair of SEQ ID NO: 2 and SEQ ID NO: 9 for the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 7; Or about a primer pair represented by SEQ ID NO: 3 and SEQ ID NO: 5 is a primer pair of SEQ ID NO: 4 and SEQ ID NO: 6. Southern bean mosaic virus kit comprising a primer pair of claim 1.

Images