CN113604612B - Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit - Google Patents
Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit Download PDFInfo
- Publication number
- CN113604612B CN113604612B CN202111032292.3A CN202111032292A CN113604612B CN 113604612 B CN113604612 B CN 113604612B CN 202111032292 A CN202111032292 A CN 202111032292A CN 113604612 B CN113604612 B CN 113604612B
- Authority
- CN
- China
- Prior art keywords
- virus
- detection
- loop
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an Almond virus loop-mediated isothermal amplification detection primer group, a kit containing the primer group and application thereof. According to the invention, three sets of primers are designed according to the conserved region of the VP2 gene of the Arlong virus genome for establishing a loop-mediated isothermal amplification method, and finally, one set of primer set for detection is screened out. A method for detecting the Almond virus based on the loop-mediated isothermal amplification technology is established according to the designed primer. The LAMP detection method established by the invention has high specificity, does not cross react with other viruses, and has the lowest detection limit of 2.86 copy/. Mu.L. The method is applied to the detection of the Almond virus, can realize the instant detection of the virus, and has high detection sensitivity and specificity, low cost of manpower and equipment and short period. The rapid detection technology can be popularized and applied to epidemiological investigation and epidemic situation monitoring of the Almond virus, and has good practical significance and wide market prospect.
Description
Technical Field
The invention relates to a loop-mediated isothermal amplification primer group for detecting Almond virus, a kit containing the primer group and application thereof. The invention belongs to the technical field of virus detection.
Background
Alongshan virus (ALSV) is a newly discovered segmented flavivirus, transmitted mainly by tick bites, infecting cattle, sheep, humans, etc. ALSV is closely related to the evolution of the Jinmen tick virus, the genome is divided into four fragments, the total length is 11350bp, and the S1 fragment length is 2995bp to code for the NS 5-like NSP1 protein of the flavivirus; the S3 fragment length 2811bp codes for a flavivirus NS2b-NS 3-like protein NSP2; s2 fragment is 2806bp long, and codes glycoprotein VP1; the S4 fragment is 2738bp long and encodes the nucleoprotein VP2 and the membrane protein VP3.
Arragan virus was first found in northeast regions of inner Mongolia in China, and subsequently found in ticks found in Finnish and Russian. Because the virus is a newly discovered segmented flavivirus, the molecular biology, the immunological detection method and the pathogenic mechanism of the Arlong virus are blank at present. By way of a review of the flaviviruses, it is inferred that regions of transmission of the aronsylvania virus are broader than those currently detected, and thus, there is a need for faster, simpler methods for more regions and more hosts.
Loop-mediated isothermal amplification (LAMP) was developed by Notomi et al. LAMP has higher specificity and sensitivity, is simple to use, and does not need special equipment. LAMP was performed with Bst DNA polymerase having strand displacement activity (i.e., modified DNA polymerase from Bacillus stearothermophilus). The temperature is from 60 ℃ to 65 ℃, and the detection is completed within 30-60min under isothermal conditions. The final amplified product is a mixture of stem-loop DNA with different stems, which can be analyzed by direct observation or by agarose gel. The LAMP method has been developed for detecting a variety of viruses including foot-and-mouth disease virus, dengue virus, rubella virus and West Nile virus, but has not been applied to the detection of ALSV.
The LAMP detection method for ALSV is a specific, stable, sensitive and efficient technical detection system, and has important application value in the aspect of ALSV detection.
Disclosure of Invention
In order to overcome the defects of the prior art, the primary aim of the invention is to provide a loop-mediated isothermal amplification primer group for detecting ALSV. The primer group can provide a simple and rapid method for detecting ALSV for the field detection of the basic layer.
The second object of the present invention is to provide a loop-mediated isothermal amplification reaction kit for detecting ALSV, which contains the primer set.
It is a third object of the present invention to provide the use of the above primer set and kit for detecting ALSV in a sample.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the invention searches and obtains the whole genome sequence of all ALSVs from a Genbank database, carries out homology analysis by BLAST software, finds the relatively conserved target gene (VP 2) sequence of the ALSV genome, designs the LAMP primer group for ALSV detection by utilizing PrimerExplorerV5 software according to the VP2 sequence, and finally obtains a set of primer composition capable of specifically and sensitively detecting the ALSV after screening.
The invention relates to a loop-mediated isothermal amplification primer group for detecting Alongshan virus (ALSV), which consists of 1 pair of outer primers F3/B3 and 1 pair of inner primers FIP/BIP, wherein the sequences of the primers are as follows:
F3：TGATCTACATCCTCGCCGT
B3：CTGCTCCTGCTGTGAGTG
FIP：TGATTGCAGCTGCTGTCCCAGACCATGGGCAAGCCAAAC
BIP：TCATCAAGGAATTGCCCACGCATCTCCTCACCGGTTCTCAA。
preferably, the molar ratio of the outer primer to the inner primer is 1:8.
furthermore, the invention also provides application of the primer group in preparing a loop-mediated isothermal amplification reagent for detecting the Almond virus.
Furthermore, the invention also provides a loop-mediated isothermal amplification kit for detecting the Almond virus, which comprises the primer group.
Preferably, the kit further comprises a fluorescence visual detection reagent, 10 times of reaction buffer solution, bst DNA polymerase, ultrapure water and a positive standard.
Wherein, preferably, the LAMP reaction system detected by using the kit comprises: 10 Xreaction buffer 2.5. Mu.L, 40pmol FIP and BIP each 1. Mu.L, 5pmol F3 and B3 each 1. Mu.L, 800U/mLBSTDNA polymerase 1. Mu.L, 30mM MgSO 4 5 mu L,10mM dNTP mix 2.5 mu L,5.0M betaine 4 mu L, sample to be detected1. Mu.L of the cDNA template was used, and the remainder was made up to 25. Mu.L with ultrapure water.
Compared with the prior art, the invention has the beneficial effects that:
1. the pollution is small, and the result is visual: the fluorescence visual reagent (FD) of the kit is added before the reaction, so that the pollution is small. The calcein contained therein is initially bound to manganese ions in a fluorescence quenched state. However, as the LAMP reaction proceeds, the bound manganese ions are taken away by the pyrophosphate ions in the reaction by-products, and calcein is restored to a free state to emit fluorescence, and further, is bound to the magnesium ions in the reaction solution, so that the fluorescence signal is enhanced.
2. The sensitivity is high: the invention determines the lowest detection limit of the LAMP reaction by using a method of serially diluting a positive standard by 10 times. The LAMP method of the invention has the detection lower limit on ALSV similar to that of other arboviruses: the minimum detection limit is 2.86×10 0 copy/μL。
3. The specificity is strong: the LAMP method has good specificity, and uses tick-borne encephalitis virus (TBEV); fever with thrombocytopenia syndrome (SFTSV); GETV; ALSV-LAMP detection of nucleic acid of bata virus (BATV) was performed, and no positive result was found.
4. The operation is simple and rapid: the LAMP method established by the invention is simple and convenient to operate, and does not need complex and expensive instruments. In addition, the established LAMP method is rapid and efficient, and can be completed within 60 minutes from sample extraction to result judgment (timeliness is equivalent to that of a TaqMan real-time fluorescent quantitative PCR method). The reaction result judging method is simple, the amplification product of the LAMP reaction is dyed by SYBR Green I, and the amplification product can be detected by naked eyes under the irradiation of ultraviolet light. The invention can realize the rapid and instant detection of ALSV, thereby solving the defects of time consuming, labor consuming and high cost of ALSV detection, improving the detection sensitivity and specificity, reducing the cost of manpower and equipment and shortening the detection period: the rapid detection technology provided by the method can be popularized and applied to epidemiological investigation and epidemic situation monitoring of ALSV, and has good practical significance and wide market prospect.
Drawings
FIG. 1 shows agarose electrophoresis results of a preliminary established LAMP method for detecting ALSV;
wherein 1 is positive; 2 is a negative control; m: DNA molecular weight standard 2000;
FIG. 2 shows the results of a sensitivity test for detecting ALSV by the LAMP method (agarose electrophoresis);
wherein 1:2.86×10 5 copy/μL；2：2.86×10 4 copy/μL；3：2.86×10 3 copy/μL；4：2.86×10 2 copy/μL；5：2.86×10 1 copy/μL；6：2.86×10 0 copy/. Mu.L; 7: a negative control; m: DNA molecular weight standard 2000;
FIG. 3 shows the results of a specific assay for detecting ALSV by the LAMP method (agarose electrophoresis):
wherein 1: is Almond virus (ALSV); 2: is Tick Borne Encephalitis Virus (TBEV); 3: is fever with thrombocytopenia syndrome (SFTSV); 4: is a GETV virus; 5: is a batai virus (BATV); 6 is a negative control.
Detailed Description
The following describes the invention in more detail. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.
The test methods used in the following experimental examples are all conventional methods unless otherwise specified: the materials, reagents and the like used, unless otherwise specified, are those commercially available.
Example 1: primer design and establishment of LAMP method
1. Preparation of ALSV Positive Standard
And searching from a Genbank database to obtain all the ALSV whole genome sequences, carrying out homology analysis by BLAST software to find a target gene (VP 2) sequence of which the ALSV genome is relatively conserved, synthesizing a target fragment by a biological company according to the obtained target gene sequence, and connecting a carrier to construct a positive standard.
2. Design and Synthesis of LAMP primer composition
The method comprises the following steps: LAMP primer compositions were designed for target gene sequences using PrimerExplorerV5 software, and primer synthesis was performed. The synthesized primers are screened, i.e., the synthesized primers are diluted and then subjected to primer screening, and amplified by conventional PCR. After screening, a set of primer composition capable of specifically and sensitively detecting ALSV is finally obtained. The primer composition consists of an outer primer F3/B3 and an inner primer FIP/BIP, and the primer sequences are as follows:
f3: TGATCTACATCCTCGCCGT (SEQ ID NO. 1);
b3: CTGCTCCTGCTGTGAGTG (SEQ ID NO. 2);
FIP: TGATTGCAGCTGCTGTCCCAGACCATGGGCAAGCCAAAC (SEQ ID NO. 3);
BIP: TCATCAAGGAATTGCCCACGCATCTCCTCACCGGTTCTCAA (SEQ ID NO. 4).
3. Establishment and optimization of the LAMP method:
(1) Extracting nucleic acid of a sample to be detected: RNA of the bovine and sheep serum samples was extracted according to the instructions of TIANGEN company Magnetic Viral DNA/RNA Kit nucleic acid extraction Kit, and the LAMP method was performed after reverse transcription.
(2) Performing LAMP reaction
LAMP reaction System contained 5.0pmol each of F3 and B3 primers 1.0. Mu.L, 40pmol each of BIP and FIP primers 1.0. Mu.L, 2.5. Mu.L of 10 Xreaction buffer, 1.0. Mu.L of 800U/mL Bst DNA polymerase (New England Biolabs), 2.5. Mu.L of 10mM dNTP mixture (Takara), 4.0. Mu.L of 5M betaine (SigmaAldrich), 5.0. Mu.L of 30mM MgSO 4 (endogenous), 1.0. Mu.L of target cDNA and 5.0. Mu.L of nuclease-free ultrapure water.
And (3) verifying results: LAMP product (10. Mu.L) was separated by 2.5% agarose gel electrophoresis and ethidium bromide stained for UV-visible results.
And (3) result judgment: LAMP amplified DNA products from ALSV agarose gel electrophoresis showed characteristic trapezoidal bands with multi-banded fragments, indicating that the final LAMP product was a mixture of stem-loop DNA of different stem lengths (FIG. 1). In contrast, the negative control lacks this characteristic multi-band ladder pattern.
Example 2: sensitivity test for detecting ALSV in combination with LAMP
The assay was performed as described in example 1, and the ALSV positive standard prepared in example 1 was subjected to 10-fold gradient dilution and combined LAMP assay using the diluted sample as a template, with a total of 6 gradients (2.86X 10 5 ～2.86×10 0 copy/. Mu.L) to determine their minimum detection limit.
Results: 10-fold serial dilutions of ALSV positive plasmid (from 10 5 To 10 -1 copy/. Mu.L) was used to determine sensitivity, and the positive reaction mixture exhibited a typical trapezoidal pattern. In three replicates, 100% of samples containing 2.86 copy/. Mu.L of LAMP positive plasmid were detected. (FIG. 2)
Example 3: specific test for detecting ALSV by LAMP method
Tick Borne Encephalitis Virus (TBEV) for this experiment; fever with thrombocytopenia syndrome virus (SFTSV); GETV; the BATV virus (BATV) was identified and stored by the Sesamum indicum Chinesemedicine, the Sesamum of Buddha science and technology, and the pig disease heavy spot detection laboratory.
Performing specific detection by adopting the method described in the embodiment 1, wherein the sample to be detected comprises tick-borne encephalitis virus; fever with thrombocytopenia syndrome virus; covering the tower virus; batai virus; ALSV positive standard and negative control, and the measurement results are shown in FIG. 3.
LAMP specificity analysis results show that TBEV is contained; SFTSV; GETV; no amplification product was observed in the reaction mixture of the BATV cDNA template, indicating that the LAMP established in the present invention has a high degree of specificity for ALSV (FIG. 3).
Example 4: detection of clinical samples
For 142 bovine and sheep serum samples taken from Yunnan, nucleic acid extraction and reverse transcription were performed according to commercial kits, and q-PCR upstream primer ALSV-F (5'-GGC TAA ACA CAT CAA ACA-3') and downstream primer ALSV-F (5'-GCA TCC AGG TCA TAG TTA-3') were designed based on NS3 gene of ALSV, and detection by q-PCR method was compared with LAMP method of example 1. Results the LAMP method of example 1 showed 5 positive samples with a positive rate of 3.52%, and the 5 samples were confirmed to be positive samples by virus isolation culture identification. While the q-PCR method detected three positive samples with a positive rate of 2.1%, confirming the higher sensitivity of the LAMP detection of example 1.
The embodiment shows that the primer combination and the kit for ALSV detection by combining the LAMP technology can rapidly and accurately detect ALSV, thereby overcoming the defects of time and labor waste, reducing the detection cost and labor intensity, improving the sensitivity and the specificity and shortening the detection period of the existing ALSV detection technology. The invention has the characteristics of quick and simple operation in scientific research and production practice, and is suitable for on-site instant detection.
The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.
Sequence listing
<110> academy of science and technology of Buddha mountain
<120> Arlong mountain virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> artificial sequence
<400> 1
tgatctacat cctcgccgt 19
<210> 2
<211> 18
<212> DNA
<213> artificial sequence
<400> 2
ctgctcctgc tgtgagtg 18
<210> 3
<211> 39
<212> DNA
<213> artificial sequence
<400> 3
tgattgcagc tgctgtccca gaccatgggc aagccaaac 39
<210> 4
<211> 41
<212> DNA
<213> artificial sequence
<400> 4
tcatcaagga attgcccacg catctcctca ccggttctca a 41
<210> 5
<211> 18
<212> DNA
<213> artificial sequence
<400> 5
ggctaaacac atcaaaca 18
<210> 6
<211> 18
<212> DNA
<213> artificial sequence
<400> 6
gcatccaggt catagtta 18
Claims (6)
1. A loop-mediated isothermal amplification primer set for detecting Alongshan virus (ALSV), characterized in that: the primer group consists of 1 pair of outer primers F3/B3 and 1 pair of inner primers FIP/BIP, and the primer sequences are as follows:
F3：TGATCTACATCCTCGCCGT
B3：CTGCTCCTGCTGTGAGTG
FIP：TGATTGCAGCTGCTGTCCCAGACCATGGGCAAGCCAAAC
BIP：TCATCAAGGAATTGCCCACGCATCTCCTCACCGGTTCTCAA。
2. the loop-mediated isothermal amplification primer set for detecting the Arlong mountain virus according to claim 1, wherein the molar ratio of the outer primer to the inner primer is 1:8.
3. the use of the primer set according to claim 1 or 2 for preparing a loop-mediated isothermal amplification reagent for detecting the aronskia virus.
4. A loop-mediated isothermal amplification kit for detecting an aronsylvania virus, comprising the primer set of claim 1 or 2.
5. The loop-mediated isothermal amplification kit according to claim 4, wherein the kit further comprises a fluorescent visual detection reagent, 10 x reaction buffer, bst DNA polymerase, ultrapure water, and a positive standard.
6. The loop-mediated isothermal amplification kit according to claim 5, wherein the LAMP reaction system for detection using the kit comprises: 10 Xreaction buffer 2.5. Mu.L, 40pmol FIP and BIP each 1. Mu.L, 5pmol F3 and B3 each 1. Mu.L, 800U/mLBSTDNA polymerase 1. Mu.L, 30mM MgSO 4 5. Mu.L, 10mM dNTP mix 2.5. Mu.L, 5.0M betaine 4. Mu.L, 1. Mu.L of the sample cDNA template to be detected, and the balance of the template were made up to 25. Mu.L with ultrapure water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111032292.3A CN113604612B (en) | 2021-09-03 | 2021-09-03 | Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111032292.3A CN113604612B (en) | 2021-09-03 | 2021-09-03 | Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604612A CN113604612A (en) | 2021-11-05 |
| CN113604612B true CN113604612B (en) | 2023-08-01 |
Family
ID=78310069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111032292.3A Active CN113604612B (en) | 2021-09-03 | 2021-09-03 | Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604612B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943837A (en) * | 2021-12-03 | 2022-01-18 | 广东方道基因生物科技有限公司 | Porcine gatifloxacin virus loop-mediated isothermal amplification detection primer group and kit |
| CN115044710B (en) * | 2022-06-10 | 2023-03-21 | 广州动物园 | Primer group and kit for detecting pangolin beta coronavirus and application of primer group and kit |
| CN117210455B (en) * | 2023-11-09 | 2024-02-02 | 广东省林业科学研究院 | Primer group, kit and method for detecting east yang virus based on LAMP method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361443A (en) * | 2013-07-02 | 2013-10-23 | 中国人民解放军第二军医大学 | Kit and detection method for rapidly detecting three flaviviruses in combined manner |
| CN110273025A (en) * | 2019-06-19 | 2019-09-24 | 佛山科学技术学院 | A kind of Alon mountain virus PCR detection primer group, kit and application |
-
2021
- 2021-09-03 CN CN202111032292.3A patent/CN113604612B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361443A (en) * | 2013-07-02 | 2013-10-23 | 中国人民解放军第二军医大学 | Kit and detection method for rapidly detecting three flaviviruses in combined manner |
| CN110273025A (en) * | 2019-06-19 | 2019-09-24 | 佛山科学技术学院 | A kind of Alon mountain virus PCR detection primer group, kit and application |
Non-Patent Citations (1)
| Title |
|---|
| QHW06962.1.GenBank.2020,序列表. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604612A (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113604612B (en) | Aronia virus loop-mediated isothermal amplification detection primer set, kit containing primer set and application of kit | |
| CN110551853B (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| Boubourakas et al. | Sensitive and rapid detection of peach latent mosaic viroid by the reverse transcription loop-mediated isothermal amplification | |
| Lee et al. | One-step reverse transcription loop-mediated isothermal amplification assay for rapid detection of Cymbidium mosaic virus | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN115044710B (en) | Primer group and kit for detecting pangolin beta coronavirus and application of primer group and kit | |
| CN112430686B (en) | Kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3 | |
| KR20180054160A (en) | Primer set for multiple detection 4 kinds of virus infecting Passiflora edulis and method for detecting said viruses using the same | |
| CN113637798A (en) | Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe | |
| KR102030244B1 (en) | Oligonucleotide set for detection of dengue virus and uses thereof | |
| KR100942388B1 (en) | A primer set, internal control rna and rt-pcr kit using said primer set and internal control rna and pcr method using said rt-pcr kit thereby | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| Xia et al. | Rapid detection of Banna virus by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) | |
| CN111690759A (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN110819629A (en) | Primer combination and detection method for detecting blue tongue 8 type and/or blue tongue 16 type viruses | |
| CN108060271B (en) | Loop-mediated isothermal amplification dengue virus detection method | |
| CN110804677A (en) | Nested duplex PCR (polymerase chain reaction) detection primer and kit for distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| AU2020103479A4 (en) | Primer set for detecting canine parvovirus and its application | |
| KR101024114B1 (en) | PCR primer pair detecting Pea enation mosaic virus and method for detecting Pea enation mosaic virus using the same | |
| KR102254155B1 (en) | Method for detecting nervous necrosis virus, and primer-probe set, composition and kit for the same | |
| Gupta et al. | Preliminary Report on a Single-tube, Non-interrupted Reverse Transcription–Polymerase Chain Reaction for the Detection of Rabies Virus in Brain Tissue | |
| CN114015809A (en) | ERA method, composition and kit for rapidly detecting GI group norovirus | |
| CN113215154A (en) | Primer combination and kit for TGEV, PEDV and PDCoV triple PCR detection and application thereof | |
| KR102173154B1 (en) | Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 1 or 3 and Uses Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |