KR102030244B1 - Oligonucleotide set for detection of dengue virus and uses thereof - Google Patents

Abstract

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 9 and a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2; A second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 10; A third oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and a probe consisting of the nucleotide sequences of SEQ ID NO: 11; And a fourth oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequences of SEQ ID NOs: 12.

Description

Oligonucleotide set for detecting dengue virus and its use {OLIGONUCLEOTIDE SET FOR DETECTION OF DENGUE VIRUS AND USES THEREOF}

The present invention relates to a set of oligonucleotides for detecting dengue virus and uses thereof.

Dengue virus is a Flavivirus with four serotypes (DENV1, DENV2, DENV3, DENV4). According to the WHO report, 2.2 million cases of dengue virus were recorded in 2010, and the number of cases increased by 3.2 million in 2015, with an annual death rate of 2.5% per half a million people.

People who have once been infected with the dengue virus or other types of infection can lead to dengue shock syndrome or dengue haemorrhagic fever, with a poor prognosis in this case. There is a high probability of death. Therefore, it is important to early diagnose whether the dengue virus is infected.

As a method for confirming whether the dengue virus is infected, a virus gene is detected from blood and an antibody is detected from serum. Among them, ELISA is a common method for using antibodies.

ELISA is a method that can be diagnosed according to the color development by performing IgM, IgG antibody test on the patient's sample. However, those who have been exposed to the dengue virus continuously detect IgG because antibodies to it are formed in the body, and those currently infected with the dengue virus also have IgG. Thus, if there is no IgM and only IgG is detected, a diagnosis can be made according to a doctor.

Dengue virus infections have symptoms such as fever, headache, cough, and spots, which are not specific to dengue virus patients, but also show similar symptoms in viral infections such as influenza and chikungunya. Each virus has different treatments, and the use of other virus treatments in patients can pose a fatal risk. Therefore, there is a need for a method that can accurately and quickly diagnose a dengue virus infection.

Existing virus culture method has been limited in efficiency because it takes more than two weeks. Recently, as a molecular diagnostic test, a method of diagnosing dengue virus using polymerase chain reaction (PCR) has been actively researched, but it is detected with high accuracy without cross-reaction with other viruses with similar symptoms. The diagnostic method that can be done is still insufficient research.

The present invention is to solve the above-described problems of the prior art, an object of the present invention is to provide a set of oligonucleotides that can detect only dengue virus accurately and quickly and without cross-reaction to heterologous viruses.

However, the problem to be solved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 9 and a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2; A second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 10; A third oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and a probe consisting of the nucleotide sequences of SEQ ID NO: 11; And a fourth oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequences of SEQ ID NO: 12. The oligonucleotide set for detecting a dengue virus is provided.

According to one side, the dengue virus may include dengue virus types 1 to 4.

According to one side, the first to fourth oligonucleotide set may detect the dengue virus type 1 to 4, respectively.

According to one side, the first oligonucleotide set specifically binds to the nonstructural protein 4A (NS4A) gene of dengue virus type 1, the second oligonucleotide set is envelope protein (envelope protein) gene of dengue virus type 2 Specifically binds to the envelope protein gene of dengue virus type 3, wherein the third oligonucleotide set specifically binds to the envelope protein gene of dengue virus type 3, and the fourth oligonucleotide set is a nonstructural protein 5 of dengue virus type 4 ) Can bind specifically to a gene.

According to one side, a fluorophore may be labeled at the 5 'end of each probe, and a quencher may be labeled at the 3' end of each probe.

According to one side, the fluorophore is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein), tetra Chloro-6-carboxyfluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7-phenyl-1 , 4-dichloro-6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein), 5 -((2-aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5, Cyanine- 5), lucifer yellow, texas red, tetramethylrhodamine, yakima yellow, and cal fluor red 610 (CFR) Line from the military There may be more than one chosen.

According to one side, the quencher is tetramethyl rhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethylaminophenylazophenyl- It may be one or more selected from the group consisting of 4-maleimide (4-dimethylaminophenylazophenyl-4-maleimide), carboxytetramethylrhodamine and BHQ dyes.

According to an embodiment of the present invention, there is provided a dengue virus detection composition comprising the oligonucleotide set.

According to one embodiment of the invention, there is provided a dengue virus detection kit comprising the composition.

According to one embodiment of the invention, (a) extracting a nucleic acid in a biological sample obtained from a subject; (b) mixing the composition with the nucleic acid; And (c) amplifying the nucleic acid to determine whether the dengue virus infection; providing a method for providing information for diagnosing dengue virus infection.

The oligonucleotide set of the present invention can specifically bind dengue virus to detect dengue virus accurately and quickly.

In addition, since the oligonucleotide set includes primer pairs and probes targeting different proteins according to the dengue virus serotype, the dengue virus serotype can be distinguished and detected with excellent detection sensitivity.

It is to be understood that the effects of the present invention are not limited to the above effects, and include all effects deduced from the configuration of the invention described in the detailed description or claims of the present invention.

Figure 1 shows the serotype detection results for the dengue virus of the oligonucleotide set according to an embodiment of the present invention.
Figure 2 is the result of measuring the detection sensitivity of the dengue virus type 1 of the oligonucleotide set according to an embodiment of the present invention.
3 is a result of measuring the detection sensitivity of the dengue virus type 2 of the oligonucleotide set according to an embodiment of the present invention.
Figure 4 is the result of measuring the detection sensitivity of dengue virus type 3 of the oligonucleotide set according to an embodiment of the present invention.
5 is a result of measuring the detection sensitivity of the dengue virus type 4 of the oligonucleotide set according to an embodiment of the present invention.
Figure 6 shows the serotype electrophoresis results for the dengue virus of the oligonucleotide set according to an embodiment of the present invention.
Figure 7 shows the results of electrophoresis for dengue virus type 1 of the oligonucleotide set according to an embodiment of the present invention.
Figure 8 shows the results of electrophoresis for dengue virus type 2 of the oligonucleotide set according to an embodiment of the present invention.
Figure 9 shows the results of electrophoresis for dengue virus type 3 of the oligonucleotide set according to an embodiment of the present invention.
Figure 10 shows the results of electrophoresis for dengue virus type 4 of the oligonucleotide set according to an embodiment of the present invention.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. Various modifications may be made to the embodiments described below. The examples described below are not intended to be limited to the embodiments and should be understood to include all modifications, equivalents, and substitutes for them.

The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting of examples. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, action, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be construed as having meanings consistent with the meanings in the context of the related art and shall not be construed in ideal or excessively formal meanings unless expressly defined in this application. Do not.

In addition, in describing the embodiment, when it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 9 and a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2; A second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 10; A third oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and a probe consisting of the nucleotide sequences of SEQ ID NO: 11; And a fourth oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequences of SEQ ID NO: 12. The oligonucleotide set for detecting a dengue virus is provided.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, which can hybridize with a complementary template to form base pairs and copy template strands. By a short nucleic acid sequence that serves as a starting point for. The primers can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) at appropriate buffers and temperatures.

The dengue virus may include four serotypes, dengue virus type 1 (DENV1), type 2 (DENV2), type 3 (DENV3) and type 4 (DENV4), and thus the first to fourth oligonucleotide sets Can detect the dengue virus types 1 to 4, respectively.

Specifically, the first oligonucleotide set specifically binds to a nonstructural protein 4A (NS4A) gene of dengue virus type 1, and the second oligonucleotide set is specific to an envelope protein gene of dengue virus type 2 The third oligonucleotide set specifically binds to an envelope protein gene of Dengue virus type 3, and the fourth oligonucleotide set binds to a nonstructural protein 5 (NS5) gene of dengue virus type 4. Can bind specifically.

Specifically, the primer pair constituting the first oligonucleotide set may correspond to the 5005 th to 5243 th sequences (238 bp) of the entire Dengue virus type 1 gene, and the probe may be the 5140 th to 5163 th bases. May correspond to sequence (24 bp).

The primer pair constituting the second oligonucleotide set may correspond to the 1021st to 1174th base sequence (153bp) of the entire Dengue virus type 2 gene, and the probe may be the 1086th to 1110th base sequence (24bp). May correspond to

The primer pair constituting the third oligonucleotide set may correspond to the 1865 th to the 2000 th nucleotide sequence (136 bp) of the entire Dengue virus type 3 gene, and the probe may have the nucleotide sequence from the 1915 th to 1941 th (26 bp). May correspond to

The primer pair constituting the fourth oligonucleotide set may correspond to the 8181 th to 8342 th nucleotide sequences (161 bp) of the entire Dengue virus type 4 gene, and the probe may have the 8 280 th to 8302 th nucleotide sequences (22 bp). May correspond to

As used herein, the term “viral gene” may refer to a concept that includes not only the viral genome itself, but also any RNA or DNA (eg, cDNA) derived therefrom.

The primers are primers specific for specific protein genes of the four serotypes of dengue virus types 1, 2, 3 and 4, preferably forward and reverse nucleic acids having 10 to 50 nucleotide sequences. It may be configured as. The primers may incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.

In addition, the primer nucleic acid sequence may, if necessary, include a label that can be detected directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioisotopes (eg ³² P), fluorescent molecules, chemical groups (eg biotin), and the like. It is not limited.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several to several hundred bases capable of specific binding with mRNA. The probe is labeled so that the presence of a particular mRNA can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

A fluorophore may be labeled at the 5 'end of each probe, and a quencher may be labeled at the 3' end of each probe. Accordingly, in the state in which the probe is bound to the 5'-UTR present in the sample, color development is restricted by mutual interference between the fluorophore and the quencher, and the fluorophore labeled at the 5 'end is decomposed during the amplification process. On the other hand, the quencher labeled at the 3 'end undergoes color reaction. By such a color reaction, it is possible to determine the presence or absence of a dengue virus from a sample.

The fluorophore that can be labeled at the 5 'end is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein ), Tetrachloro-6-carboxyfluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7- phenyl-1,4-dichloro-6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein ), 5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5) , Cyanine-5), lucifer yellow, texas red, tetramethylrhodamine, yakima yellow (YG), and Cal Fluor Red 610 (CFR) Group consisting of And from one or more can be selected, and preferably may be a FAM, HEX, Cy5 or Texas Red, and the like.

In addition, the quencher which can be labeled at the 3 'end is tetramethylrhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethyl It may be one or more selected from the group consisting of 4-dimethylaminophenylazophenyl-4-maleimide, carboxytetramethylrhodamine, and BHQ dyes, but is not limited thereto. .

As described above, when the RT-PCR is performed using a fluorescently labeled probe and the amplified product is detected, the amplified product can be monitored in real time, thereby accurately quantifying DNA and RNA. In addition, this method eliminates the need for electrophoresis, which allows for quick and easy interpretation and reduces the risk of contamination.

Oligonucleotide sets comprising the primers and probes can improve detection sensitivity compared to existing primers and probes by targeting and amplifying different proteins for each of the dengue virus serotypes. At this time, the improvement of detection sensitivity includes not only the reduction of non-specific detection for other viruses other than the dengue virus, but also the improvement of the detection sensitivity of each serotype when detecting all dengue virus serotypes simultaneously.

According to one embodiment of the invention, there is provided a dengue virus detection composition comprising the oligonucleotide set, and a kit comprising the same.

When the composition or kit is used in RT-PCR, it may optionally further comprise an amplification mixture for performing RT-PCR. Amplification mixtures for carrying out RT-PCR are reagents necessary for carrying out amplification reactions, such as buffers, reverse transcriptases having RNase H activity, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermal stability DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu), DNA polymerase cofactors such as Mg ²⁺ , dNTPs (dATP, dCTP, dGTP, and dGTP) and the like. have.

The compositions and kits may include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and inhibitors that inhibit the activity of DNA polymerases. In addition, the compositions and kits may include reagents, such as the reagents required to perform negative and positive control reactions or the buffers required for hybridization reactions. The optimal amount of reagent used in a particular reaction can be readily determined by one skilled in the art. Typically, the kits of the present invention may comprise the aforementioned components in a separate package or compartment.

The kind, base sequence, target gene, etc. of specific primers and probes included in the composition and kit are the same as described above.

According to one embodiment of the invention, (a) extracting a nucleic acid in a biological sample obtained from a subject; (b) mixing the composition with the nucleic acid; And (c) amplifying the nucleic acid to determine whether the dengue virus infection; providing a method for providing information for diagnosing dengue virus infection.

In the step (a), the biological sample refers to a sample taken from the subject to check whether the dengue virus is infected, and may include a sample such as blood, serum, saliva, or phlegm, but is not limited thereto.

In the step (b), the nucleic acid may mean RNA, and the composition is the same as described above. All enzymes used in the amplification reaction may be active under the same reaction conditions. The buffer ensures that all enzymes are close to the optimum reaction conditions, so that the amplification process can be performed in a single reactant without changing conditions such as addition of the reactants.

In step (c), multiple real-time RT-PCR may be performed using each oligonucleotide set and nucleic acid. In carrying out multiple real-time RT-PCR, conditions suitable for the primers and probes to hybridize to template RNA may be employed. Suitable hybridization conditions can be determined in a series of steps by an optimization procedure. This procedure may be carried out by a person skilled in the art in a series of procedures for protocol establishment. For example, conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength depend on various factors such as oligonucleotide length and GC content, target nucleotide sequence and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are described for the purpose of illustrating the present invention, but the scope of the present invention is not limited thereto.

Example 1: Analytical Sample Preparation

For dengue virus of four serotypes (DENV1, DENV2, DENV3, DENV4) that were incubated in liquid medium (RPMI 1640, Gibco), 5 ml of each liquid medium was extracted and placed in a 15 ml tube. Centrifugation was performed for minutes. After completion of centrifugation, the pellet was discarded and only the supernatant was harvested and used as an RNA template for PCR.

Example 2: Primer and Probe Preparation

Glycoprotein, envelope protein and polyprotein genes were selected as target genes for detecting dengue virus, and the target genes were applied differently for each serotype.

Primers and probes were designed by comparing the entire sequence of each target gene to select regions with no genetic homology between different viruses and other serotypes, the specific sequences of which are shown in Table 1 below. Y in the base sequence of Table 1 means cytosine (C) or thymine (T).

At this time, 5 'ends of the probes for DENV1, DENV2, DENV3 and DENV4 were labeled with FAM, HEX, Cy5 and Texas red as fluorophores. In addition, BHQ-1 (Black Hole Quencher 1) was labeled with a quencher at the 3 'end of the probe for DENV1 and DENV2, and BHQ-2 was labeled with the quencher at the 3' end of the probe for DENV3 and DENV4.

Serotype target
gene Kinds order
number order
(5 '→ 3') location
(Length) size
(bp) DENV
One Glycoprotein primer_F One CAGTGCCATTGCCCAAGC 5005 (18) 238 primer_R 2 CGACAACTCTTGTGGGAGC 5224 (19) Probe 9 CATAGTCCGTGAGGCCATAAAAAG 5140 (24) DENV
2 coat
protein primer_F 3 AGCTGTGTGACGACGATGG 1021 (19) 153 primer_R 4 TGCCCAACACAAGGGGAA 1156 (18) probe 10 CAAACAACCTGCCACTCTAAGGAA 1086 (24) DENV
3 coat
protein primer_F 5 TCAGAAACGCAGCATGGGA 1865 (19) 136 primer_R 6 CACAGCCAACCCAGTG 1984 (16) probe 11 AGATGCACCTTGCAAGATTCCTTTCT 1915 (26) DENV
4 Polyprotein primer_F 7 AGAAGAGCTGGAGAAACTG 8181 (21) 161 primer_R 8 GATGYTGTTGAACAGGTTCAC 8321 (21) probe 12 GCGTCGGGAAACATYGTGAGYG 8280 (22)

Example 3: Dengue Virus Detection by Serotype

Using the DiaStar ^TM OneStep Multiplex qRT-PCR kit (SRQ11-K100, Solgent) to confirm the operation of the primer and probe of Example 2 for RNA of each dengue virus serotype prepared according to Example 1 above RT-PCR was performed. Specific components and conditions for the PCR reaction are shown in Tables 2 and 3, respectively.

ingredient Volume (μl) 5X Reaction buffer 5 Enzyme buffer 2 primer_F (10pmol) One primer_R (10 pmol) One probe (10 pmol) One template RNA 5 Distilled water 10 all 25

step Temperature (℃) time Cycle reverse transcription 50 30min - pre-denaturation 95 15min - denaturation 95 30sec 35 annealing 60 40sec elongation 72 30sec

Real-time RT-PCR was performed by adding each dengue virus template RNA with all four oligonucleotide sets (primers and probes) mixed to confirm the detection result for each dengue virus serotype. 4 and FIG. 1. As a negative control, RNA extracted from human plasma was used.

Sample Ct RFU DENV1 20.06 10506 DENV2 19.1 4452 DENV3 25.38 3674 DENV4 27.06 8115 Negative control N / A 206 Distilled water N / A 145

Referring to Table 4 and Figure 1, the oligonucleotide set according to Example 2 is specifically specific to the NS4A gene (DENV1), envelope protein genes (DENV2, 3) and NS5 gene (DENV4) of each dengue virus It can be confirmed that all of them specifically detect only dengue virus.

Example 4: Detection limit measurement

In order to confirm the detection sensitivity of the primer and probe of Example 2, RT-PCR for each serotype was performed by step dilution of the template RNA sample prepared according to Example 1 at a concentration of 10 ⁹ to 10 ⁰ copy number. . Except for the concentration of RNA samples, specific experimental conditions were performed in the same manner as in Example 3.

For comparison of detection sensitivity, an oligonucleotide set (primer and probe) described in Korean Patent Publication No. 10-1541987 (hereinafter referred to as "Comparative Example") was used as a control. Experimental results are shown in Table 5 and FIGS. 2 to 5.

Log10
Dilution Ct value Oligonucleotide Set of Comparative Example Oligonucleotide Set of Example 2 DENV1 DENV2 DENV3 DENV4 DENV1 DENV2 DENV3 DENV4 10 ⁸ 10.51 10.52 8.40 9.87 12.17 13.21 16.34 11.44 10 ⁷ 14.09 13.76 12.34 13.53 17.16 17.39 19.42 14.94 10 ⁶ 17.93 17.46 15.85 16.90 20.09 21.24 22.86 19.53 10 ⁵ 21.84 20.59 19.27 20.49 23.75 25.03 25.83 22.93 10 ⁴ 25.44 24.18 22.96 23.85 26.90 28.65 27.48 25.49 10 ³ 30.60 27.40 26.48 26.91 29.29 32.01 31.01 29.56 10 ² N / A 36.84 33.49 29.86 32.71 35.28 34.20 32.61 10 ¹ N / A N / A N / A N / A 36.16 36.66 36.18 35.47 10 ⁰ N / A N / A N / A N / A 39.42 N / A N / A 39.04

Referring to Table 5 and the results of FIGS. 2 to 5, the oligonucleotide set of Example 2 was detected up to 1 × 10 ⁰ for DENV1 and DENV3 and up to 1 × 10 ¹ for DENV2 and DENV4. On the other hand, oligonucleotide sets of Comparative Examples were detected up to 1 × 10 ³ for DENV1 and up to 1 × 10 ² for DENV2, DENV3 and DENV4.

These results confirm that the oligonucleotide set of Example 2 shows a detection sensitivity of 10 times to 100 times higher than that of the comparative example, so that the detection efficiency is better.

Example 5: Electrophoresis Analysis

The PCR products amplified in Examples 3 and 4 were electrophoresed on 3% agarose gel, and the bands shown were confirmed. 6 is an electrophoresis result for the PCR product of Example 3, Figures 7 to 10 are electrophoresis results for the PCR product of Example 4.

6 to 10, the oligonucleotide set of Example 2 can be detected to a lower concentration than that of the comparative example, the non-specific response to other viruses other than the dengue virus is also significantly reduced to excellent detection sensitivity You can see that.

Although the embodiments have been described by the limited embodiments and the drawings as described above, various modifications and variations are possible to those skilled in the art from the above description. For example, the techniques described may be performed in a different order than the described method, and / or the components described may be combined or combined in a different form than the described method, or replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the following claims.

<110> KOREA UNIVERSITY <120> OLIGONUCLEOTIDE SET FOR DETECTION OF DENGUE VIRUS AND USES          THEREOF <130> APC-2017-0283 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DENV1 specific forward primer <400> 1 cagtgccatt gcccaagc 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DENV1 specific reverse primer <400> 2 cgacaactct tgtgggagc 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DENV2 specific forward primer <400> 3 agctgtgtga cgacgatgg 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DENV2 specific reverse primer <400> 4 tgcccaacac aaggggaa 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DENV3 specific forward primer <400> 5 tcagaaacgc agcatggga 19 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> DENV3 specific reverse primer <400> 6 cacagccaac ccagtg 16 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DENV4 specific forward primer <400> 7 agaagagctg gagaaactg 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DENV4 specific reverse primer <400> 8 gatgytgttg aacaggttca c 21 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DENV1 specific probe <400> 9 catagtccgt gaggccataa aaag 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> DENV2 specific probe <400> 10 catagtccgt gaggccataa aaag 24 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DENV3 specific probe <400> 11 agatgcacct tgcaagattc ctttct 26 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DENV4 specific probe <400> 12 gcgtcgggaa acatygtgag yg 22

Claims (10)

A first oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and a probe consisting of the nucleotide sequences of SEQ ID NO: 9;
A second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 10;
A third oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and a probe consisting of the nucleotide sequences of SEQ ID NO: 11; And
And a fourth oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequences of SEQ ID NOs: 12, and an oligonucleotide set for detecting a dengue virus.
The method of claim 1,
The dengue virus comprises a dengue virus type 1 to 4, dengue virus detection oligonucleotide set.
The method of claim 2,
The first to fourth oligonucleotide sets are the dengue virus type 1 to 4 detection, respectively, dengue virus detection oligonucleotide set.
The method of claim 3, wherein
The first oligonucleotide set specifically binds to the nonstructural protein 4A (NS4A) gene of dengue virus type 1,
The second oligonucleotide set specifically binds to an envelope protein gene of Dengue virus type 2,
The third oligonucleotide set specifically binds to an envelope protein gene of Dengue virus type 3,
The fourth oligonucleotide set specifically binds to the nonstructural protein 5 (NS5) gene of dengue virus type 4, dengue virus detection oligonucleotide set.
The method of claim 1,
Fluorophore is labeled at the 5 'end of each probe,
Oligonucleotide set for detecting a dengue virus, a quencher is labeled at the 3 'end of each probe.
The method of claim 5,
The fluorophore is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein), tetrachloro-6-carboxy Fluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7-phenyl-1,4-dichloro- 6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein), 5-((2- Aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5, Cyanine-5), lucifer yellow one selected from the group consisting of lucifer yellow, texas red, tetramethylrhodamine, Yakima Yellow (YG), and Cal Fluor Red 610 (CFR) this Of the oligonucleotide sets for detecting Dengue virus.
The method of claim 5,
The quencher is tetramethylrhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethylaminophenylazophenyl-4-maleimide ( A set of oligonucleotides for detecting a dengue virus, which is at least one selected from the group consisting of 4-dimethylaminophenylazophenyl-4-maleimide), carboxytetramethylrhodamine and BHQ dyes.
A dengue virus detection composition comprising the oligonucleotide set of any one of claims 1 to 7.
A dengue virus detection kit comprising the composition of claim 8.
(a) extracting the nucleic acid in the biological sample obtained from the subject;
(b) mixing the nucleic acid with the composition of claim 8; And
(C) amplifying the nucleic acid to determine whether the dengue virus infection; comprising, providing information for diagnosing a dengue virus infection.

Images