KR20240058019A - Primer sets for rapid detection of Escherichia coli O127, O128ac or O86 serotype and a method of detecting a serotype of Escherichia coli using the same - Google Patents

Abstract

The present invention relates to a primer set for rapid identification of O127, O128ac or O86 serotypes of E. coli and a method for identifying serotypes of E. coli using the same. More specifically, the present invention relates to six primers specific for genes with specific patterns for each serotype of E. coli. A method of grouping E. coli serotypes into groups including O127, O128ac, and O86 using a primer set, and a method of identifying E. coli serotypes by processing each primer set specific for the three serotypes after grouping. provides.

Description

Primer sets for rapid detection of Escherichia coli O127, O128ac or O86 serotype and a method of detecting a serotype of Escherichia coli using the same same}

The present invention relates to a primer set for rapid identification of O127, O128ac or O86 serotypes of E. coli and a method for identifying serotypes of E. coli using the same. More specifically, the present invention relates to six primers specific for genes with specific patterns for each serotype of E. coli. A method of grouping E. coli serotypes into groups including O127, O128ac, and O86 using a primer set, and a method of identifying E. coli serotypes by processing each primer set specific for the three serotypes after grouping. provides.

Escherichia coli, a representative food poisoning bacterium, has different toxicity and mechanisms in the human body depending on the serotype, and since non-pathogenic E. coli exists, discarding food or suspending distribution due to simple detection of E. coli causes enormous cost losses to the food industry. Therefore, not only detection of E. coli but also identification of serotype using selective media or 16S identification method is necessary. The existing serotype identification method is an antiserum method that utilizes an antigen-antibody reaction. Not only is the antiserum itself expensive, but it also requires a long reaction time for serotype identification, and the results must be judged with the naked eye. It has the limitation of being ambiguous. In addition, the recently used in silico serotyping method, which secures the base sequence from NGS (Next generation sequencing) and uses software, uses the genome sequence information of the strain to identify the serotype. It is necessary, and the cost of sequencing to obtain it is also very expensive, and it has the limitation that the analysis time for the equipment is at least 3 days. Although rapid serotype identification is necessary to monitor and prevent the occurrence of food poisoning caused by pathogenic E. coli, the existing serotype identification method has these limitations, and the need for the development of a new serotype identification method has been recognized.

Meanwhile, Non-Patent Document 1 discloses a method of identifying the serotype of E. coli through polymerase chain reaction (PCR) using a primer set targeting a unique gene sequence within the O-antigen gene cluster. I'm doing it. However, this method requires each primer set to individually identify the numerous serotypes of the O-group.

Under this background, the present inventors first grouped the O-group serotypes of E. coli by checking whether or not amplification products were detected using each primer set for six genes with specific patterns for each serotype of E. coli. , the present invention was completed by developing a method that can quickly identify serotypes without non-specific reaction and cross-reaction of each primer set by processing each primer set specific to the grouped serotype.

DebRoy C, Fratamico PM, Roberts E. Molecular serogrouping of Escherichia coli. Anim Health Res Rev. 2018 Jun;19(1):1-16.

The purpose of the present invention is to provide a primer set, composition, and kit for grouping O serotypes of E. coli into specific groups, and a method for grouping O serotypes using the same.

Another object of the present invention is to provide a primer set and composition kit for identifying individual O serotypes of E. coli, and a method for identifying individual O serotypes using the same.

Another object of the present invention is a kit for identifying the O serotype of E. coli, including the above-described primer set for O serotype grouping of E. coli and/or a primer set for identifying individual O serotypes of E. coli, and the O serum of E. coli using the same. It provides a type identification method.

In order to solve the above-mentioned problems, the present invention provides a set of primers for grouping E. coli O127, O128ac, and O86 serotypes, which specifically bind to genes with specific patterns for each serotype of E. coli. to provide.

Additionally, the present invention groups the O127, O128ac, and O86 serotypes of E. coli, including the above-described primer sets and probes that specifically bind to genes with specific patterns for each serotype of E. coli. Provides a composition for.

At this time, the primer set may include the following first to sixth primer sets:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

At this time, the probe may include the following first to sixth probes:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;

ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;

iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;

iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;

v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and

vi) A sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

Additionally, the present invention provides a kit for grouping E. coli into groups comprising O127, O128ac and O86 serotypes comprising the composition described above.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

Additionally, the present invention provides a method of grouping E. coli into groups including O127, O128ac, and O86 serotypes using the above-described primer set, composition, or kit.

In this case, the method includes a) a first set including a first primer set and a first probe, a second primer set and a second probe, a third primer set and a third probe, and a fourth primer set and a fourth probe, Performing a polymerase chain reaction (PCR) by treating the sample with a second set including a fifth primer set, a fifth probe, a sixth primer set, and a sixth probe, respectively; and b) confirming amplification products by each primer set and probe in the sample.

At this time, the method c) detects the amplification product by the second primer set and the second probe, the amplification product by the third primer set and the third probe, and the amplification product by the fifth primer set and the fifth probe in the sample. If the amplification product by the first primer set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, they are present in the sample. A step of grouping the serotypes of E. coli into groups including O127, O128ac, and O86 serotypes may be further included.

The present invention also provides a primer set for identification of O127, O128ac or O86 serotypes of E. coli, comprising any one or more of the following seventh to ninth primer sets:

vii) a seventh primer set for identifying the O128ac serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O127 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23; and

ix) A ninth primer set for identifying the O86 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26.

Additionally, the present invention provides a composition and kit for identifying the O127, O128ac or O86 serotype of E. coli comprising the above-described primer set and probe, and a method for identifying the O127, O128ac or O86 serotype of E. coli using the same.

At this time, the probe may be any one or more selected from the group consisting of a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21, an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27. there is.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

The present invention also provides a primer set that specifically binds to a gene having a specific pattern for each serotype of E. coli; and a set of primers for identifying the O127, O128ac or O86 serotype of E. coli.

At this time, the primer set that specifically binds to a gene having a specific pattern for each serotype of E. coli may include the following first to sixth primer sets:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

At this time, the kit may further include the following first to sixth probes, each specifically binding to a gene having a specific pattern for each serotype of E. coli:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;

ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;

iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;

iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;

v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and

vi) A sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

At this time, the primer set for identifying the O127, O128ac or O86 serotype of E. coli may include one or more of the following seventh to ninth primer sets:

vii) a seventh primer set for identifying the O128ac serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O127 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23; and

ix) A ninth primer set for identifying the O55 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26.

At this time, the kit includes at least one selected from the group consisting of a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21, an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27. It can be included.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

Additionally, the present invention provides a method for identifying O127, O128ac, or O86 serotypes of E. coli using the above-described kit.

At this time, the method may include the following steps a) to d):

a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;

b) confirming amplification products by each primer set and probe in the sample;

c) In the sample, an amplification product by the second primer set and the second probe, an amplification product by the third primer set and the third probe, and an amplification product by the fifth primer set and the fifth probe are detected, and the first primer If the amplification product by the set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouping into groups comprising O127, O128ac and O86 serotypes; and

d) Processing the sample with a primer set and probe to identify the O127, O128ac, or O86 serotype of E. coli.

At this time, the primer set and probe for identifying the O127, O128ac or O86 serotype of E. coli in step d) may include any one or more of the primer sets and probes selected from the following vii) to ix):

vii) a seventh primer set for identifying the O128ac serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;

viii) an eighth primer set for identifying the O127 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24; and

ix) A ninth primer set for identifying the O86 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27.

The method for identifying E. coli serotypes according to the present invention uses the first to sixth primer sets and the first to sixth probes to determine whether or not an amplification product is detected by each primer set and probe. E. coli serotypes were grouped into groups including O127, O128ac, and O86 serotypes, and then treated with each primer set specific to the grouped serotypes, thereby rapidly identifying serotypes without non-specific reactions and cross-reactions of each primer set. and can sympathize accurately. In addition, the real-time PCR technique applied to the method of the present invention is a method of detecting amplified DNA in real time as PCR progresses. Unlike general PCR, amplified DNA can be confirmed without additional electrophoresis, and real-time PCR using the Taqman probe method is possible. By applying the forward and reverse primers, a fluorescent substance is attached to the 5' and 3' ends to display a signal whenever the target gene is amplified, resulting in very high accuracy and a low detection limit. It has advantages.

Figure 1 shows the results of multiplex PCR using PCR primers and probes for grouping in Table 1 for group 6 including E. coli serotypes O127, O128ac, and O86.
Figure 2 shows the multiplex PCR results of PCR primers and probes for individual serotype identification in Table 2 for group 6, including E. coli serotypes O127, O128ac, and O86.
Figure 3 shows the results of multiplex real-time PCR using PCR primers and probes for grouping in Table 1 for group 6 including E. coli serotypes O127, O128ac, and O86.
Figure 4 shows the multiplex real-time PCR results of PCR primers and probes for individual serotype identification in Table 2 for group 6, including E. coli serotypes O127, O128ac, and O86.
Figure 5 shows multiplex real-time PCR results of PCR primers and probes for grouping in Table 1 and multiplex real-time PCR of PCR primers and probes for individual serotype identification in Table 2 for strains isolated from unknown samples obtained from the natural environment. It shows the results.
Figure 6 shows the results of serotype identification for strains isolated from unknown samples obtained from the natural environment using an antiserum method.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention, unless otherwise defined, are used with the same meaning as commonly understood by a person skilled in the art in the field related to the present invention. In addition, preferred methods and samples are described in this specification, but similar or equivalent methods are also included in the scope of the present invention.

As described above, the existing serotype identification methods, such as the antiserum method or the in silico serotyping method, have limitations in that they require a long analysis time and high cost to identify the serotype. Accordingly, the present inventors have made diligent efforts to develop a kit that is not only economical in terms of cost while shortening the analysis time, but also has high serotype identification accuracy. As a result, primers specific to six genes with specific patterns for each serotype of E. coli Using the set, E. coli having a specific serotype can be primarily grouped, and each primer set specific to the grouped serotype is processed to quickly and accurately identify the serotype without non-specific reaction or cross-reaction of each primer set. By confirming that it is possible to solve the problem described above by providing six primer sets that can group serotypes of E. coli and a primer set that can identify individual serotypes of the group grouped as containing a specific serotype, A solution was sought.

Specifically, the present inventors downloaded 1339 E. coli complete genome sequences from NCBI and then identified serotypes using in silico serotyping (Serotypefinder tool). Then, based on the identified data, 1 to 3 n values (complete genome sequences) were selected for each serotype, and then pan-genome analysis was performed. Afterwards, six genes with specific patterns were identified for each serotype, and it was discovered that E. coli serotypes were divided into nine groups depending on the presence or absence of each gene.

According to the above results, the present invention relates to a technology for identifying serotypes of E. coli grouped into Group 6, where Group 6 includes a second primer set, an amplification product by a second probe, and a third primer. The amplification product by the set and the third probe and the amplification product by the fifth primer set and the fifth probe are detected, the amplification product by the first primer set and the first probe, and the amplification by the fourth primer set and the fourth probe. serotypes O127, O128ac and O86, for which no product and amplification product by the sixth primer set and sixth probe were detected.

Accordingly, the first aspect of the present invention is a primer set, composition, kit for grouping E. coli into a group containing O127, O128ac and O86 serotypes, comprising the following first to sixth primer sets, a composition, and a kit using the same. Methods for grouping E. coli into groups comprising O127, O128ac and O86 serotypes:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

As used herein, the term “primer” refers to a polynucleotide that can act as an initiation point for nucleic acid synthesis in the template-direction when placed under conditions that initiate polynucleotide elongation. Primers can also be used in a variety of other oligonucleotide-mediated synthesis processes, including as initiators of de novo RNA synthesis and in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (e.g., oligodeoxyribonucleotides). The appropriate length of the primer depends on the intended use, typically ranging from 6 to 40 nucleotides, more typically from 15 to 35 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. Primers are not required to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize to the template for the primer to be extended. In certain embodiments, the term "primer set" includes a 5'-sense primer that hybridizes complementary to the 5'-end of the nucleic acid sequence to be amplified, and a 3'-antisense primer that hybridizes to the 3' end of the sequence to be amplified. It means a set of primers containing. Primers may be labeled, if desired, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, useful labels include: ³² P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA assays), biotin, or haptens, and proteins for which antiserum or monoclonal antibodies may be used. .

In the present invention, the forward primer of the first primer set is referred to as 'DR-F' and the reverse primer is referred to as 'DR-R', the forward primer of the second primer set is referred to as 'CD-F', and the reverse primer is referred to as 'CD-F'. -R', the forward primer of the third primer set is referred to as 'G4E-F', the reverse primer is referred to as 'G4E-R', the forward primer of the fourth primer set is referred to as 'A4E-F', and the reverse primer is referred to as 'A4E-F'. It is referred to as 'A4E-R', the forward primer of the fifth primer set is referred to as 'BGT-F', the reverse primer is referred to as 'BGT-R', and the forward primer of the sixth primer set is referred to as 'D2E-F', reverse primer. The primer is referred to as 'D2E-R'.

The composition for grouping E. coli into a group containing O127, O128ac and O86 serotypes according to the present invention may include the above-described primer set and a probe that specifically binds to a gene having a specific pattern for each serotype of E. coli. You can.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA that is as short as a few bases or as long as several hundreds of bases, capable of forming a specific binding to a complementary base sequence, and is labeled so that it has a specific base. The presence or absence of a sequence can be confirmed. Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. Additionally, fluorescently labeled probes can be used to perform real-time PCR. More specifically, when using a TaqMan probe, an oligonucleotide labeled with a fluorescent substance at the 5' end and a quencher at the 3' end is added to the PCR reaction solution. In addition, real-time PCR using a cycling probe is a highly sensitive detection method consisting of a chimeric probe made of RNA and DNA and RNAse H. In this case, the 5' end of the probe is labeled with a fluorescent substance and the 3' end with a quencher.

The probe anneals to a specific target sequence located between the forward and reverse primers during the amplification process and is cleaved by the 5'nuclease activity of Taq polymerase during the extension phase of the PCR cycle to produce a fluorescent substance (reporter dye). Separation from the quencher (quenching dye) increases the fluorescence intensity. Fluorescence intensity can be monitored at each PCR cycle by a real-time PCR system.

In the present invention, the probes that specifically bind to genes having a specific pattern for each serotype of E. coli may include the following first to sixth probes:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3; ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6; iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9; iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12; v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and vi) a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

In the present invention, the first probe is 'DR-P', the second probe is 'CD-P', the third probe is 'G4E-P', the fourth probe is 'A4E-P', and the fifth probe is 'BGT-P' and the sixth probe are referred to as 'D2E-P' and can be used together with the first to sixth primer sets in each order.

A kit for grouping E. coli into groups containing O127, O128ac and O86 serotypes according to the present invention may include the composition of the above-described composition.

The kit of the present invention may further include one or more other component compositions, solutions, or devices suitable for the analysis method. Preferably, the kit may include essential elements required to perform multiplex PCR or multiplex real-time PCR. Specifically, the kit may further include a reaction buffer, dNTPs, and DNA polymerase. For example, the kit of the present invention may optionally include reagents necessary to perform a target nucleic acid amplification reaction (e.g., PCR reaction), such as buffer, DNA polymerase cofactor, and deoxyribonucleotide-5-triphosphate. . Optionally, the kits of the invention may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the optimal amount of reagents used in the kit for a specific reaction can be easily determined by a person skilled in the art who has learned the disclosure herein. Typically, the equipment of the present invention may be manufactured in separate packaging or compartments containing the previously mentioned components.

In the present invention, the kit may further include a negative control and a positive control. A negative control is a control without the DNA mixture and is necessary to eliminate the possibility of contamination when performing PCR. Positive controls are necessary to validate that the PCR performed as intended.

The method of grouping E. coli into groups including O127, O128ac, and O86 serotypes according to the present invention can be performed using the primer set, composition, or kit described above.

Specifically, the method includes a first set including a first primer set and a first probe, a second primer set and a second probe, a third primer set and a third probe, and a fourth primer set and a fourth probe, Performing a polymerase chain reaction (PCR) by treating the sample with a second set including a fifth primer set, a fifth probe, a sixth primer set, and a sixth probe, respectively; and b) confirming amplification products by each primer set and probe in the sample.

In the present invention, the description of the primer set and probe used in step a) is the same as described above, so the description thereof is omitted.

The method of the present invention is implemented by PCR, where primers are used for gene amplification reactions.

The grouping method of the present invention includes a sample treated with the first set including the first primer set and the first probe, the second primer set and the second probe, the third primer set and the third probe, and the fourth primer set. PCR may be performed on each sample treated with the fourth probe, the fifth primer set, the fifth probe, the sixth primer set, and the second set including the sixth probe.

PCR is the best-known nucleic acid amplification method, and many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to improve the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information about PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

As used herein, the term “amplification reaction” refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR; US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR); Sambrook et al., A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), method of Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822), multiplex PCR (McPherson and Moller, 2000), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) ; WO 88/10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence priming Consensus sequence primed polymerase chain reaction (CP-PCR; U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR; U.S. Patent Nos. 5,413,909 and 5,861,245) , nucleic acid sequence based amplification (NASBA; U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification and ring-mediated homeothermic amplification ( loop-mediated isothermal amplification; LAMP), but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617, and US Patent 09/854,317.

The method according to the present invention performs a gene amplification reaction using a primer set, thereby simultaneously amplifying target genes from the analysis target (e.g., DNA samples isolated from food as well as clinical specimens such as sputum, blood, saliva, or urine). It can be detected.

Therefore, in the method of the present invention, the sample in step a) may be a sample derived from food, but is not limited thereto, and a sample derived from a clinical specimen may also be used. The clinical specimens include, but are not limited to, sputum, saliva, blood, and urine.

Extraction of DNA from a sample can be performed according to conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al., Plant Mol. Rep., 9:242 (1991); Current Protocols in Molecular Biology, John Willey & Sons (1987); al., Biochem. 162:156 (1987).

The primer used in the present invention hybridizes or anneals to one site of the template to form a double-stranded structure. Conditions for nucleic acid hybridization suitable for forming these double-chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B.D., et al., Nucleic Acid Hybridization. , A Practical Approach, IRL Press, Washington, D.C. (1985).

A variety of DNA polymerases can be used in the amplification of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Includes.

When carrying out a polymerization reaction, it is desirable to provide an excess amount of the components necessary for the reaction in the reaction vessel. The excess amount of components required for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. It is desirable to provide cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to the reaction mixture in such an amount that the required degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer solution allows all enzymes to approximate optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as adding reactants.

In the present invention, annealing is performed under stringent conditions that enable specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary depending on environmental variables.

As described above, the method of the present invention can group serotypes of E. coli by checking whether amplification products are detected by the first to sixth primer sets and the first to sixth probes.

The term “hybridization” used herein means forming a duplex structure by pairing complementary base sequences of two single-stranded nucleic acids. Hybridization may occur when the complementarity between single-stranded nucleic acid sequences is perfect (perfect match) or even when some mismatched bases exist. The degree of complementarity required for hybridization may vary depending on hybridization reaction conditions, and may be particularly controlled by temperature. There is no difference between the terms “annealing” and “hybridization” used in this specification, and they are used interchangeably in this specification.

The method according to the invention can be performed by multiplex PCR or multiplex real-time PCR.

The “real-time PCR” can monitor the process in real time when performing PCR. Therefore, data is collected throughout the PCR process, not at the end of the PCR. In real-time PCR, the reaction is characterized by the point during the cycle when amplification is first detected, rather than by the amount of target accumulated after a fixed number of cycles. Mainly two methods are used to perform quantitative PCR: dye-based detection and probe-based detection.

The method of the present invention may additionally include the step of confirming the amplification result by PCR by measuring the Ct (cycle threshold) value.

The Ct (cycle threshold) value refers to the number of cycles at which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The Ct value is the cycle in which an increase in ΔRn was first detected. Rn refers to the size of the fluorescence signal generated during PCR at each time point, and ΔRn refers to the fluorescence emission intensity of the reporter dye divided by the fluorescence emission intensity of the reference dye (normalized reporter signal). The Ct value is also called Cp (crossing point) in LightCycler. The Ct value indicates the point at which the system begins to detect an increase in fluorescent signal associated with exponential growth of the PCR product in log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

In PCR, PCR amplification products can be detected through fluorescence. Detection methods largely include an interchelating method (SYBR Green I method) and a method using a fluorescently labeled probe (TaqMan probe method). Since the interchelating method detects all double-stranded DNA, there is no need to prepare probes for each gene, so a reaction system can be constructed at low cost. The method using fluorescently labeled probes is expensive, but has high detection specificity, allowing even similar sequences to be distinguished and detected.

TaqMan probes typically contain a primer (e.g., 20-30 nucleotides long) containing a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ)) at the 3'-end. ) is a longer oligonucleotide. The excited fluorescent substance transfers energy to a nearby quencher rather than emitting fluorescence (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al., Proc Natl Acad Sci USA, 94(20): 10756- 61 (1997)). Therefore, if the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to internal regions of PCR products.

The TaqMan probe specifically hybridizes to the template DNA during the annealing step, but fluorescence is suppressed by a quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5' to 3' nuclease activity of Taq DNA polymerase, and the fluorescent dye is released from the probe, thereby releasing the inhibition by the quencher and causing fluorescence. At this time, the 5'-end of the TaqMan probe must be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of this polymerase to form the reporter molecule. A fluorescent signal is generated.

The reporter molecules and quencher molecules bound to the TaqMan probe include fluorescent substances and non-fluorescent substances. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any known in the art, examples of which are as follows (numbers in parentheses are maximum emission wavelengths in nanometers): Cy2 ^TM (506), YOPRO ^TM -1 (509), YOYO ^TM -1 (509), Calcein (517), FITC (518), FluorX ^TM (519), Alexa ^TM (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green ^TM 500 (522), Oregon Green ^TM 488 (524), RiboGreen ^TM (525), Rhodamine Green ^TM (527), Rhodamine 123 (529), Magnesium Green ^TM (531), Calcium Green ^TM (533), TO-PRO ^TM -1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568) , BODIPY564/570 (570), Cy3 ^TM (570), Alexa ^TM 546 (570), TRITC (572), Magnesium Orange ^TM (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ^TM (576) ), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ^TM (590), Cy3.5 ^TM (596), ROX (608), Calcium Crimson ^TM (615), Alexa ^TM 594 ( 615), Texas Red (615), Nile Red (628), YO-PRO ^TM -3 (631), YOYO ^TM -3 (631), R-phycocyanin (642), CPhycocyanin (648), TO-PRO ^TM - 3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ^TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546) ), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 ( 591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum wavelength of emission expressed in nanometers.

Suitable reporter-quencher pairs are described in many publications: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, ^2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

Additionally, the non-fluorescent material used for the reporter molecule and quencher molecule bound to the TaqMan probe may include a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" herein refers to a TaqMan probe conjugated with MGB at the 3'-end of the probe.

MGB is a substance that binds to the minor groove of DNA with high affinity, including netropsin, distamycin, lexitropsin, mithramycin, chromomycin A3, and olivo. Olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenil, CC-1065, Hoechst 33258, DAPI (4-6- diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, MPC (N-methylpyrrole-4-carbox-2-amide) and its dimers, trimers, tetramers and pentamers. It doesn't work.

Conjugation of the probe and MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, the increased stability (i.e., increased degree of hybridization) results in an increased melting temperature (Tm) of the hybrid duplex formed by the MGB-conjugated probe compared to the normal probe. Therefore, MGB stabilizes van der Waals forces, increasing the melting temperature (Tm) of MGB-conjugated probes without increasing probe length, thereby allowing shorter probes (e.g., 21 nucleotides or less) in Taqman real-time PCR under more stringent conditions. It makes possible the use of.

Additionally, the MGB-conjugated probe removes background fluorescence more efficiently. Accordingly, the probe of the present invention may be in the form of a TaqMan MGB-conjugate, where the length of the probe includes, but is not limited to, 15-30 nucleotides.

In the present invention, the method includes c) an amplification product using a second primer set and a second probe, an amplification product using a third primer set and a third probe, and an amplification product using a fifth primer set and a fifth probe in the sample. If the product is detected and the amplification product by the first primer set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, A step of grouping the serotypes of E. coli present in the sample into groups including O127, O128ac, and O86 serotypes may be further included.

In a specific embodiment of the present invention, multiplex PCR was performed using the primer set and probe for serotype grouping described above for E. coli O127, E. coli O128ac, and E. coli O86, and then the amplification product was electroporated. Confirmed as Yeongdong. As a result, as shown in Figure 1, all of the three serotypes of E. coli contain the second primer set (CD-F and CD-R), the second probe (CD-P), and the third primer set (G4E- F and G4E-R) and the third probe (G4E-P) and the fifth primer set (BGT-F and BGT-R) and the fifth probe (BGT-P) were confirmed, but the first primer set (DR-F and DR-R) and the first probe (DR-P), the fourth primer set (A4E-F and A4E-R) and the fourth probe (A4E-P) and the sixth primer set (D2E-F) and D2E-R) and the sixth probe (D2E-P) were not identified, so it was confirmed to have one serotype among O127, O128ac, and O86, and these results were E. coli O127, E. coli This was consistent with the use of O128ac and E. coli O86 as test strains.

In another specific embodiment of the present invention, multiplex real-time PCR was performed on E. coli O127, E. coli O128ac, and E. coli O86 using the primer set and probe for serotype grouping described above through fluorescence detection. Amplification curves for each primer set and probe were confirmed. As a result, as shown in Figure 3, E. coli O127, E. coli O128ac, and E. coli O86 used as experimental strains each had a second primer set (CD-F and CD-R) and a second probe (CD-F). -P), the third primer set (G4E-F and G4E-R) and the third probe (G4E-P), and the fifth primer set (BGT-F and BGT-R) and the fifth probe (BGT-P). The amplification curve was confirmed, but the first primer set (DR-F and DR-R) and the first probe (DR-P), the fourth primer set (A4E-F and A4E-R) and the fourth probe (A4E- P) and the amplification curve by the sixth primer set (D2E-F and D2E-R) and the sixth probe (D2E-P) were not confirmed. These results are consistent with the results of confirming the amplification product by electrophoresis after performing the multiplex PCR, and mean that the strain used in the experiment has one of the serotypes of O127, O128ac, and O86.

If the E. coli serotype detected in the sample through the above steps is determined to be one of the serotypes O127, O128ac, and O86, only the primer sets specific for the three serotypes are processed to prevent non-specific reaction of each primer set. And individual serotypes can be identified quickly and accurately without cross-reaction.

Accordingly, the second aspect of the present invention relates to a primer set, composition, and kit for identifying the O127, O128ac, or O86 serotype of E. coli, and a method for identifying the O127, O128ac, or O86 serotype of E. coli using the same.

The primer set for serotype identification according to the present invention may include any one or more of the following seventh to ninth primer sets:

vii) a seventh primer set for identifying the O128ac serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O127 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23; and

ix) A ninth primer set for identifying the O86 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26.

The composition for serotype identification according to the present invention may include the above-described primer set and a probe that specifically binds to the unique gene region of the O127, O128ac or O86 serotype.

In the present invention, the probe that specifically binds to the unique gene region of the O128ac serotype may be the seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21; The probe that specifically binds to the unique gene region of the O127 serotype may be the eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24; The probe that specifically binds to the unique gene region of the O86 serotype may be the ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27.

The kit for identifying the O127, O128ac or O86 serotype of E. coli according to the present invention may include the primer set or composition according to the second aspect, and other kit configurations are described in the kit according to the first aspect. Since it is the same as above, its description is omitted.

The method for identifying the O127, O128ac or O86 serotype of E. coli according to the present invention can be performed using the primer set, composition or kit according to the second aspect.

The serotype identification method according to the present invention can identify the serotype by processing the primer set, composition, or kit according to the second aspect and confirming the amplification product by each primer set and probe. For example, if the amplification product by the 7th primer set and the 7th probe is confirmed, the O128ac serotype, if the amplification product by the 8th primer set and the 8th probe is confirmed, the O127 serotype, the 9th primer set and the 8th probe 9 If the amplification product using the probe is confirmed, each can be identified as O86 serotype.

The method of carrying out the serotype identification method according to the present invention is in accordance with the first aspect described above, except that the primer set, composition or kit according to the second aspect is processed to identify amplification products by each primer set and probe. Since it is the same as the following grouping method, its description is omitted.

In a specific embodiment of the present invention, multiplex PCR was performed using the primer set and probe for serotype identification described above for E. coli O127, E. coli O128ac, and E. coli O86, and then the amplification product was electroporated. Confirmed as Yeongdong. As a result, as shown in Figure 2, PCR products corresponding to the three serotypes (87 bp, 134 bp, and 170 bp, respectively) were observed, confirming that they were identified as the same serotype as the serotype of the test strain. .

In another specific embodiment of the present invention, multiplex real-time PCR was performed using the primer set and probe for serotype identification described above for E. coli O127, E. coli O128ac, and E. coli O86, and fluorescence detection was performed. The amplification curve for each gene was confirmed. As a result, as shown in Figure 4, E. coli O127, E. coli O128ac, and E. coli O86 used as test strains had genes specifically targeting each serotype amplified, producing the corresponding genes for each serotype. The amplification curve was confirmed. These results are consistent with the results of confirming the amplification product by electrophoresis after performing the multiplex PCR, meaning that it was identified as the same serotype as that of the test strain.

The primer set for serotype grouping and the primer set for serotype identification of the present invention are provided in the form of one kit and can be used to identify the O127, O128ac or O86 serotypes of E. coli.

Accordingly, the third aspect of the present invention is a set of primers each specific for six genes having a specific pattern for each serotype of E. coli; and a set of primers for identifying the O127, O128ac or O86 serotypes of E. coli.

The kit according to the third aspect of the present invention may include the primer set according to the first aspect and the primer set according to the second aspect, and since the description thereof is the same as that described above, the description thereof is omitted.

In addition, the kit according to the third aspect of the present invention may include the probe according to the above-described first aspect and the probe according to the second aspect, and similarly, the description thereof is the same as the above-described, so the description thereof is omitted. .

The kit according to the third aspect of the present invention may further include a reaction buffer, dNTPs, and DNA polymerase, and since the components included in the kit are the same as described above, their description is omitted.

The kit according to the third aspect of the present invention can be used to identify O127, O128ac or O86 serotypes of E. coli, and can specifically be performed including the following steps a) to d):

a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;

b) confirming amplification products by each primer set and probe in the sample;

c) In the sample, an amplification product by the second primer set and the second probe, an amplification product by the third primer set and the third probe, and an amplification product by the fifth primer set and the fifth probe are detected, and the first primer If the amplification product by the set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouping into groups comprising O127, O128ac and O86 serotypes; and

d) Processing the sample with a primer set and probe to identify the O127, O128ac, or O86 serotype of E. coli.

The serotype identification method according to the third aspect of the present invention may be to first perform the serotype grouping method according to the above-described first aspect, and then perform the serotype identification method according to the second aspect, description of which Since is the same as described above, its description is omitted.

In a specific embodiment of the present invention, to verify the effectiveness of the method for identifying the O127, O128ac or O86 serotype of E. coli using the primer set and probe for serotype grouping and the primer set and probe for serotype identification according to the present invention. , the serotypes of strains isolated from unknown samples were identified and compared with the results of existing antiserum methods and in silico methods. As a result, as confirmed in Figures 5, 6, and Table 5, in the serotype identification results according to the present invention and the results of the existing antiserum method and in silico method, Eco516 was identified as O127 serotype, and Eco307 was identified as O86. It was identified as a serotype, and it was found that all identification results were consistent.

Sequences corresponding to the primer and probe sets used in the present invention are indicated by sequence numbers, but the primers and probes are interpreted as equivalent to the present invention if some sequences are substituted, deleted, or added within the range where functional identity is maintained. It can be.

As used herein, the term “identification” may be used interchangeably with terms such as discrimination, detection, or identification.

Hereinafter, the present invention will be described in more detail through examples. However, since the present invention can make various changes and take various forms, the specific embodiments and descriptions described below are only intended to aid understanding of the present invention and do not limit the present invention to the specific disclosed form. That's not what I'm trying to do. The scope of the present invention should be understood to include all changes, equivalents, and substitutes included in the spirit and technical scope of the present invention.

experimental strain E. coli O127, E. coli O128ac and E. coli Performing multiplex PCR for O86

1-1. Experimental strains and cultures

E. coli strains E. coli O127 (L-EC 014, SNU culture collection), E. coli O128ac (Eco401, SNU culture collection), and E. coli O86 (L-EC 065, SNU culture collection) were treated with tryptone, yeast extract, and The cultures were cultured in LB liquid medium supplemented with sodium chloride at 3°C using a stirred incubator.

1-2. Design of primer sets and probes for serotype grouping and identification

Primer sets and probes that specifically bind to each of the six target genes for grouping E. coli serotypes were designed as shown in Table 1.

set designation order sequence number Amplicon length/bp ^b Primer content
(F, R respectively) probe
content set 1 DR-F CCGGACCAGCTGGGGTATATG One 195 15 pmol 15 pmol DR-R TGGTACAAGCCTGCGACTTC 2 DR-P FAM-TGCGCCAACTGGGCGAGAGTTGC-TAMRA 3 CD-F AAGACATCATCGTGACCAAA 4 158 15 pmol 15 pmol CD-R TTGCTGAAAATGTCCGGTAT 5 CD-P CY5-GACCAGCGGGTTGGCGACAA-BHQ1 6 G4E-F ATGCACTTGCCTTACCCACT 7 124 15 pmol 15 pmol G4E-R ACTGTGTTGTTGCGCAGAAT 8 G4E-P HEX-ACGCTGTCAGCTCAGTGCGCGTGA-BHQ3 9 set 2 A4E-F GCGCAAGCAGGTGTACGTTA 10 98 10 pmol 10 pmol A4E-R TTATAGCGGCATCCTTCCAGT 11 A4E-P FAM-CCCAATGCATATGCAGATGCAAACC-TAMRA 12 BGT-F GGGGTACTTGTGGAAAAATACT 13 149 15 pmol 15 pmol BGT-R AAAATAATGCTTTTATATGCTGAAG 14 BGT-P CY5-CGGGAACAGGCAATTCGTGCCTCTCGG-BHQ1 15 D2E-F AAGAACTCACGAGCTGTGCT 16 171 20 pmol 20 pmol D2E-R ATCCAGCGCTTGTAATACGC 17 D2E-P HEX-AGCGCATGAGCGTCCGGAAGGCT-BHQ3 18

In addition, as shown in Table 2, each primer set and probe were designed to identify O127, O128ac, and O86 serotypes as individual serotypes, and accuracy and sensitivity experiments were conducted to determine the primer sets and probes as shown in Table 2. Final selection was made. Primers and probes used in the present invention were manufactured by Bionics Co., Ltd. (http://www.bionicsro.co.kr/).

group serotype designation order sequence number Amplicon length/bp ^b Primer content
(F, R respectively) Probe content Group 6 O128ac O128ac-F ACAAACTTTAGCAATCGCTTT 19 134 15 pmol 15 pmol O128ac-R AGTAAAATGGGAGCAATACAAC 20 O128ac-P FAM-GCATCTATGATTCATGCGGGCGGCG-BHQ1 21 O127 O127-F TGCAAGTTGTGTTATATTTGGTTGC 22 128 15 pmol 15 pmol O127-R CCATTTCAAATATCATCATGTATGCGT 23 O127-P HEX-ACACCATCGCATTAAGTGGCGTC-BHQ1 24 O86 O86-F TTTGTTGCTTTTCCCCAACAAGT 25 161 15 pmol 15 pmol O86-R TGAACGCACCCTCCCCATA 26 O86-P CY5-CCATGTTAATAACAGGGTTGCTGCCATGC-BHQ1 27

1-3. Accuracy evaluation of PCR primer sets for grouping using experimental strains

Using the culture medium obtained in Example 1-1 or the G-spin Genomic DNA Extraction Kit (for bacteria) (Intronbio), 40ng of total DNA was isolated and prepared from each strain in Example 1-1 according to the manufacturer's instructions. Next, in order to proceed with the grouping PCR step to divide the serotypes of E. coli into groups, reagent mix (enzyme, dNTP, buffer, etc.), primer set in Table 1, probe, and molecular water were mixed at the concentration in Table 3. It was prepared with The total DNA and the mixture prepared above were added to a real-time PCR tube, and PCR was performed under the conditions in Table 4. PCR products were loaded on a 4% agarose gel, electrophoresed, and confirmed by EtBr staining. A sample without a DNA mixture was used as a negative control (-), and a mixture of genomic DNA of each serotype was used as a positive control (+) to determine whether PCR was performed accurately. The detection results of the amplification products are shown in Figure 1 as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of the primer sets and probes for serotype grouping.

Sample volume sheep template DNA One 40 ng R primer (20 μM) 0.75 15 pmol F primer (20 μM) 0.75 15 pmol qPCR mix (2X) 10 TaqMan probe (20 μM) 0.75 15 pmol molecule water 6.75 gun 20

step Temperature (℃) hour cycle Pre-denaturation 95 5 minutes One Denaturation 95 30 seconds 35 Annealing 60 1 min 35

As seen in Figure 1, the amplification products by the second primer set and the second probe (CD-F, CD-R, and CD-P), the third primer set and the third probe (G4E-F, G4E-R) and G4E-P) and the fifth primer set and fifth probe (BGT-F, BGT-R and BGT-P) were detected, but the first primer set and first probe (DR-F, DR- R and DR-P), the fourth primer set and the fourth probe (A4E-F, A4E-R and A4E-P) and the sixth primer set and the sixth probe (D2E-F, D2E-R and D2E-P) The amplification product was not detected, and it was confirmed that the strain used in the experiment had one of the serotypes of O127, O128ac, and O86. These results are consistent with the use of E. coli O127, E. coli O128ac, and E. coli O86 as test strains.

1-4. Accuracy evaluation of PCR primer sets for serotype identification using experimental strains

Under the same conditions as grouping PCR, multiplex PCR was performed using primer sets and probes for a total of three serotypes in Table 2. As shown in Figure 2, PCR products corresponding to each serotype (87 bp, 134 bp, and 170 bp, respectively) were observed specifically only in O127, O128ac, and O86 serotype strains.

experimental strain E. coli O127, E. coli O128ac and E. coli Performance of multiplex real-time PCR for O86

2-1. Accuracy evaluation of PCR primer sets for grouping using experimental strains

Multiplex real-time PCR was performed on the experimental strain of Example 1-1 under the same conditions as Example 1-3. At this time, the fluorescence generated by the probe during the binding and extension steps during real-time PCR was measured using the CFX96 Touch Deep Well Real-Time PCR Detection system (Bio-rad, USA). The amplification curves by primer sets and probes for serotype grouping are shown in Figure 3 as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of each primer set and probe.

As shown in Figure 3, E. coli O127, E. coli O128ac, and E. coli O86 used as experimental strains each had a second primer set and a second probe (CD-F, CD-R, and CD-P). amplification curve by the third primer set and the third probe (G4E-F, G4E-R and G4E-P) and the amplification curve by the fifth primer set and the fifth probe (BGT-F, BGT-R and BGT- P), the amplification curve was confirmed, but the first primer set and first probe (DR-F, DR-R and DR-P), the fourth primer set and fourth probe (A4E-F, A4E-R and A4E -P) and the amplification curve by the sixth primer set and sixth probe (D2E-F, D2E-R and D2E-P) was not confirmed. These results are consistent with the multiplex PCR results of Example 1-3, meaning that the strain used in the experiment had one of the serotypes O127, O128ac, and O86.

2-2. Accuracy evaluation of PCR primer sets for serotype identification using experimental strains

Multiplex real-time PCR was performed on the experimental strain of Example 1-1 under the same conditions as Example 1-4. At this time, the fluorescence generated by the probe during the binding and extension steps during real-time PCR was measured using the CFX96 Touch Deep Well Real-Time PCR Detection system (Bio-rad, USA).

As can be seen in Figure 4, E. coli O127, E. coli O128ac, and E. coli O86 used as experimental strains had genes specifically targeting each serotype amplified, and the amplification curve corresponding to each serotype was amplified. This has been confirmed. These results are consistent with the results of confirming the amplification product by electrophoresis after performing the multiplex PCR, meaning that it was identified as the same serotype as that of the test strain.

Performance of multiplex real-time PCR on unknown samples and comparative validation with existing serotype identification methods

In order to verify the effectiveness of the primer set and probe for serotype grouping in Table 1 and the primer set and probe for serotype identification in Table 2, 78 strains isolated from unknown samples obtained from nature were tested in Example 2 and Multiplex real-time PCR was performed under the same conditions, and the results were compared with the results of the existing serotype identification methods, the Antisera method and the In silico serotype method. The amplification curves by primer sets and probes for serotype grouping are shown in Figure 5 as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of each primer set and probe.

As a result of performing the serotype identification method according to the present invention, as shown in Figure 5, the Eco516 and Eco307 strains isolated from the unknown sample had a second primer set and a second probe (CD-F, CD-R and CD-P), amplification curve by the third primer set and the third probe (G4E-F, G4E-R and G4E-P), and the amplification curve by the fifth primer set and the fifth probe (BGT-F, BGT- R and BGT-P), the first primer set and first probe (DR-F, DR-R and DR-P), and the fourth primer set and fourth probe (A4E-F, A4E) were confirmed. -R and A4E-P) and the amplification curve by the sixth primer set and sixth probe (D2E-F, D2E-R and D2E-P) was not confirmed, primarily in one of the sera of O127, O128ac and O86. Grouped by having an older brother. In addition, in the multiplex real-time PCR step for individual serotype identification, Eco516 was confirmed to have an amplification curve specific to the O127 serotype, and Eco307 was confirmed to have an amplification curve specific to the O86 serotype, with Eco516 being the O127 serotype and Eco307 being the O127 serotype. O86 serotype was identified.

Next, as a result of performing an antiserum method on the Eco516 strain using E. COLI O ANTISERA FOR USE WITH BOILED CULTURE:O116 (SSI DIAGNOSTICA), as confirmed in Figure 6, Eco516 was identified as O127 serotype, and the present invention It was consistent with the results of the serotype identification method according to .

Finally, as a result of performing an in silico serotyping method on the Eco516 and Eco307 strains, as shown in Table 5, the Eco516 strain was identified as the O127 serotype and the Eco307 strain as the O86 serotype, and similarly, the serotype according to the present invention It was found to be consistent with the results of the identification method.

PCR serotype
result Antiserum serotyping results In silico serotyping results strain Expected serotype Expected serotype gene sameness Expected serotype Eco516 O127 O127 wzy 99.91 (1167 / 1167) O127 Eco307 O86 O86 wzy 100 (1401/1401) O86 wzx 99.92 (1203/1203)

Through the results of this example, it was possible to verify the effectiveness of the primer set and probe for serotype grouping and the primer set and probe for individual serotype identification of the present invention.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (20)

Primer sets for grouping into groups comprising the O127, O128ac and O86 serotypes of E. coli, comprising the following primer sets i) to vi):
i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;
ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;
iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;
iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;
v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and
vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17. A composition for grouping into groups comprising the O127, O128ac and O86 serotypes of E. coli, comprising the following primer sets and probes i) to vi):
i) a first primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, and a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;
ii) a second primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5, and a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;
iii) a third primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8, and a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;
iv) a fourth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11, and a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;
v) a fifth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14, and a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and
vi) a sixth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17, and a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18. A kit for grouping E. coli into groups containing O127, O128ac and O86 serotypes, comprising the composition of claim 2. The kit according to claim 3, further comprising a reaction buffer, dNTPs, and DNA polymerase. The primer set of claim 1; Or a method of grouping E. coli into a group containing O127, O128ac and O86 serotypes using the composition of claim 2. 6. The method of claim 5, wherein the method comprises the following steps a) and b):
a) a first set comprising the first primer set and the first probe, the second primer set and the second probe, and the third primer set and the third probe, and the fourth primer set and the fourth probe, Performing a polymerase chain reaction (PCR) by treating a sample with a fifth primer set, a fifth probe, and a second set including the sixth primer set and the sixth probe, respectively; and
b) Confirming the amplification products by each primer set and probe in the sample. The method of claim 6, wherein c) in the sample, the amplification product by the second primer set and the second probe, the amplification product by the third primer set and the third probe, and the amplification product by the fifth primer set and the fifth probe are is detected, and if the amplification product by the first primer set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the sample The method further comprising grouping the serotypes of E. coli present into groups comprising O127, O128ac and O86 serotypes. A primer set for identification of the O127, O128ac or O86 serotype of E. coli, comprising any one or more of the following primer sets vii) to ix):
vii) a seventh primer set for identifying the O128ac serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;
viii) an eighth primer set for identifying the O127 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23; and
ix) A ninth primer set for identifying the O86 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26. A composition for identifying the O127, O128ac or O86 serotype of E. coli, comprising any one or more of the following primer sets and probes vii) to ix):
vii) a seventh primer set for identifying the O128ac serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;
viii) an eighth primer set for identifying the O127 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24; and
ix) A ninth primer set for identifying the O86 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27. A kit for identifying the O127, O128ac or O86 serotype of E. coli, comprising the composition of claim 9. The kit according to claim 10, further comprising a reaction buffer, dNTPs, and DNA polymerase. The primer set of claim 8; Or a method for identifying O127, O128ac or O86 serotypes of E. coli using the composition of claim 9. i) A first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4, and a nucleotide sequence of SEQ ID NO: 5 A second primer set containing a reverse primer, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a third primer set containing a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10, and A fourth primer set comprising a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11, a fifth primer set containing a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14, and SEQ ID NO: A primer set for grouping into a group comprising the O127, O128ac and O86 serotypes of E. coli, comprising a sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17; and
ii) a set of primers for identifying the O127, O128ac or O86 serotype of E. coli; a kit for identifying the O127, O128ac or O86 serotype of E. coli. The method of claim 13, wherein the first probe consists of the nucleotide sequence of SEQ ID NO: 3, the second probe consists of the nucleotide sequence of SEQ ID NO: 6, the third probe consists of the nucleotide sequence of SEQ ID NO: 9, and the nucleotide sequence of SEQ ID NO: 12 A kit further comprising a fourth probe, a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15, and a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18. The kit according to claim 13, wherein the primer set for identifying the O127, O128ac or O86 serotype of E. coli includes any one or more selected from the following vii) to ix):
vii) a seventh primer set for identifying the O128ac serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;
viii) an eighth primer set for identifying the O127 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23; and
ix) A ninth primer set for identifying the O86 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26. The method of claim 13, wherein at least one selected from the group consisting of a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21, an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27 A kit, further comprising a probe. The kit according to claim 13, further comprising a reaction buffer, dNTPs, and DNA polymerase. A method for identifying the O127, O128ac or O86 serotype of E. coli using the kit of any one of claims 13 to 17. 19. The method of claim 18, wherein the method comprises the following steps a) to d):
a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;
b) confirming amplification products by each primer set and probe in the sample;
c) In the sample, an amplification product by the second primer set and the second probe, an amplification product by the third primer set and the third probe, and an amplification product by the fifth primer set and the fifth probe are detected, and the first primer If the amplification product by the set and the first probe, the amplification product by the fourth primer set and the fourth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouping into groups comprising O127, O128ac and O86 serotypes; and
d) Processing the sample with a primer set and probe to identify the O127, O128ac, or O86 serotype of E. coli. The method of claim 19, wherein the primer set and probe for identifying the O127, O128ac or O86 serotype of E. coli in step d) comprises at least one of the primer sets and probes selected from the following vii) to ix). , method:
vii) a seventh primer set for identifying the O128ac serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;
viii) an eighth primer set for identifying the O127 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24; and
ix) A ninth primer set for identifying the O86 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27.