KR20240058021A - Primer sets for rapid detection of Escherichia coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype and a method of detecting a serotype of Escherichia coli using the same - Google Patents

Abstract

The present invention provides rapid identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli. This relates to a primer set for E. coli and a method for identifying serotypes of E. coli using the same. More specifically, it relates to serotypes of E. coli such as O103, O121, and O103 using six primer sets specific for genes with specific patterns for each serotype of E. coli. A method of grouping into groups including O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111, and the above 21 after grouping A method for identifying the serotype of E. coli is provided by processing each primer set specific for the serotype of the species.

Description

Primer set for rapid identification of E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype and a method for identifying serotypes of Escherichia coli using the same {Primer sets for rapid detection of Escherichia coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype and a method of detecting a serotype of Escherichia coli using the same}

The present invention provides rapid identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli. This relates to a primer set for E. coli and a method for identifying serotypes of E. coli using the same. More specifically, it relates to serotypes of E. coli such as O103, O121, and O103 using six primer sets specific for genes with specific patterns for each serotype of E. coli. A method of grouping into groups including O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111, and the above 21 after grouping A method for identifying the serotype of E. coli is provided by processing each primer set specific for the serotype of the species.

Escherichia coli, a representative food poisoning bacterium, has different toxicity and mechanisms in the human body depending on the serotype, and since non-pathogenic E. coli exists, discarding food or suspending distribution due to simple detection of E. coli causes enormous cost losses to the food industry. Therefore, not only detection of E. coli but also identification of serotype using selective media or 16S identification method is necessary. The existing serotype identification method is an antiserum method that utilizes an antigen-antibody reaction. Not only is the antiserum itself expensive, but it also requires a long reaction time for serotype identification, and the results must be judged with the naked eye. It has the limitation of being ambiguous. In addition, the recently used in silico serotyping method, which secures the base sequence from NGS (Next generation sequencing) and uses software, uses the genome sequence information of the strain to identify the serotype. It is necessary, and the cost of sequencing to obtain it is also very expensive, and it has the limitation that the analysis time for the equipment is at least 3 days. Although rapid serotype identification is necessary to monitor and prevent the occurrence of food poisoning caused by pathogenic E. coli, the existing serotype identification method has these limitations, and the need for the development of a new serotype identification method has been recognized.

Meanwhile, Non-Patent Document 1 discloses a method of identifying the serotype of E. coli through polymerase chain reaction (PCR) using a primer set targeting a unique gene sequence within the O-antigen gene cluster. I'm doing it. However, this method requires each primer set to individually identify the numerous serotypes of the O-group.

Under this background, the present inventors first grouped the O-group serotypes of E. coli by checking whether or not amplification products were detected using each primer set for six genes with specific patterns for each serotype of E. coli. , the present invention was completed by developing a method that can quickly identify serotypes without non-specific reaction and cross-reaction of each primer set by processing each primer set specific to the grouped serotype.

DebRoy C, Fratamico PM, Roberts E. Molecular serogrouping of Escherichia coli. Anim Health Res Rev. 2018 Jun;19(1):1-16.

The purpose of the present invention is to provide a primer set, composition, and kit for grouping O serotypes of E. coli into specific groups, and a method for grouping O serotypes using the same.

Another object of the present invention is to provide a primer set and composition kit for identifying individual O serotypes of E. coli, and a method for identifying individual O serotypes using the same.

Another object of the present invention is a kit for identifying the O serotype of E. coli, including the above-described primer set for O serotype grouping of E. coli and/or a primer set for identifying individual O serotypes of E. coli, and the O serum of E. coli using the same. It provides a type identification method.

In order to solve the above-described problems, the present invention relates to E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, which specifically binds to genes with specific patterns for each serotype of E. coli. Primer sets are provided for grouping into groups including O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes.

Additionally, the present invention relates to E. coli O103, O121, O123, O136, O156, O168, O170, including the above-described primer set and probes that specifically bind to genes with specific patterns for each serotype of E. coli. Compositions are provided for grouping into groups comprising O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes.

At this time, the primer set may include the following first to sixth primer sets:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

At this time, the probe may include the following first to sixth probes:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;

ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;

iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;

iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;

v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and

vi) A sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

Additionally, the present invention relates to O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, A kit is provided for grouping into groups including O91, O181 and O111 serotypes.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

Additionally, the present invention relates to E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, A method of grouping into groups including O88, O8, O91, O181 and O111 serotypes is provided.

In this case, the method includes a) a first set including a first primer set and a first probe, a second primer set and a second probe, a third primer set and a third probe, and a fourth primer set and a fourth probe, Performing a polymerase chain reaction (PCR) by treating the sample with a second set including a fifth primer set, a fifth probe, a sixth primer set, and a sixth probe, respectively; and b) confirming amplification products by each primer set and probe in the sample.

At this time, the method is c) the amplification product by the second primer set and the second probe is detected in the sample, the amplification product by the first primer set and the first probe, and the amplification product by the third primer set and the third probe. If the product, the amplification product by the fourth primer set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, they are present in the sample. The serotypes of E. coli are O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. An additional step of grouping into a containing group may be additionally included.

The present invention also provides O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66 of E. coli, comprising any one or more of the following 7th to 27th primer sets. Primer sets are provided for identification of O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotypes:

vii) a seventh primer set for identifying the O103 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O121 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23;

ix) a ninth primer set for identifying the O136 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26;

x) a tenth primer set for identifying the O123 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29;

xi) an 11th primer set for identifying the O6 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32;

xii) a twelfth primer set for identifying the O156 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35;

xiii) a 13th primer set for identifying the O168 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38;

xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41;

xv) a 15th primer set for identifying the O3 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44;

xvi) a 16th primer set for identifying the O40 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47;

xvii) a 17th primer set for identifying the O64 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50;

xviii) an 18th primer set for identifying the O66 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53;

xix) a 19th primer set for identifying the O78 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56;

xx) a 20th primer set for identifying the O80 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59;

xxi) a 21st primer set for identifying the O82 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62;

xxii) a 22nd primer set for identifying the O88 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65;

xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68;

xxiv) a 24th primer set for identifying the O91 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71;

xxv) a 25th primer set for identifying the O181 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74;

xxvi) a 26th primer set for identifying the O111 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77; and

xxvii) The 27th primer set for identifying the O174 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80.

Additionally, the present invention provides O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88 of E. coli containing the above-described primer sets and probes. , O8, O91, O181 or O111 composition and kit for identifying serotypes and O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80 of E. coli using the same. , O82, O88, O8, O91, O181 or O111 serotype identification method is provided.

At this time, the probe is the 7th probe composed of the nucleotide sequence of SEQ ID NO: 21, the 8th probe composed of the nucleotide sequence of SEQ ID NO: 24, the 9th probe composed of the nucleotide sequence of SEQ ID NO: 27, and the 7th probe composed of the nucleotide sequence of SEQ ID NO: 30 10 probe, the 11th probe composed of the nucleotide sequence of SEQ ID NO: 33, the 12th probe composed of the nucleotide sequence of SEQ ID NO: 36, the 13th probe composed of the nucleotide sequence of SEQ ID NO: 39, the 14th probe composed of the nucleotide sequence of SEQ ID NO: 42 , the 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45, the 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48, the 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51, the 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54, sequence The 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57, the 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60, the 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63, the 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66, SEQ ID NO: 69 The 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 72, the 24th probe consisting of the nucleotide sequence of SEQ ID NO: 75, the 25th probe consisting of the nucleotide sequence of SEQ ID NO: 78, and the 26th probe consisting of the nucleotide sequence of SEQ ID NO: 81 It may be any one or more selected from the group consisting of the 27th probe consisting of the sequence.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

The present invention also provides a primer set that specifically binds to a gene having a specific pattern for each serotype of E. coli; and primers for identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotypes of E. coli. Set of E. coli serotypes, including O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 Kits for identification are provided.

At this time, the primer set that specifically binds to a gene having a specific pattern for each serotype of E. coli may include the following first to sixth primer sets:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

At this time, the kit may further include the following first to sixth probes, each specifically binding to a gene having a specific pattern for each serotype of E. coli:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;

ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;

iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;

iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;

v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and

vi) A sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

At this time, identification of the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli The primer set for may include any one or more of the following 7th to 27th primer sets:

vii) a seventh primer set for identifying the O103 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O121 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23;

ix) a ninth primer set for identifying the O136 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26;

x) a tenth primer set for identifying the O123 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29;

xi) an 11th primer set for identifying the O6 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32;

xii) a twelfth primer set for identifying the O156 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35;

xiii) a 13th primer set for identifying the O168 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38;

xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41;

xv) a 15th primer set for identifying the O3 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44;

xvi) a 16th primer set for identifying the O40 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47;

xvii) a 17th primer set for identifying the O64 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50;

xviii) an 18th primer set for identifying the O66 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53;

xix) a 19th primer set for identifying the O78 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56;

xx) a 20th primer set for identifying the O80 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59;

xxi) a 21st primer set for identifying the O82 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62;

xxii) a 22nd primer set for identifying the O88 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65;

xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68;

xxiv) a 24th primer set for identifying the O91 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71;

xxv) a 25th primer set for identifying the O181 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74;

xxvi) a 26th primer set for identifying the O111 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77; and

xxvii) The 27th primer set for identifying the O174 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80.

At this time, the kit includes a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21, an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24, a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27, and a first probe consisting of the nucleotide sequence of SEQ ID NO: 30. 10 probe, the 11th probe composed of the nucleotide sequence of SEQ ID NO: 33, the 12th probe composed of the nucleotide sequence of SEQ ID NO: 36, the 13th probe composed of the nucleotide sequence of SEQ ID NO: 39, the 14th probe composed of the nucleotide sequence of SEQ ID NO: 42 , the 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45, the 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48, the 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51, the 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54, sequence The 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57, the 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60, the 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63, the 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66, SEQ ID NO: 69 The 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 72, the 24th probe consisting of the nucleotide sequence of SEQ ID NO: 75, the 25th probe consisting of the nucleotide sequence of SEQ ID NO: 78, and the 26th probe consisting of the nucleotide sequence of SEQ ID NO: 81 It may include any one or more selected from the group consisting of the 27th probe consisting of the sequence.

At this time, the kit may additionally include reaction buffer, dNTP, and DNA polymerase.

Additionally, the present invention relates to O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91 of E. coli using the above-described kit. , provides a method for identifying O181 or O111 serotypes.

At this time, the method may include the following steps a) to d):

a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;

b) confirming amplification products by each primer set and probe in the sample;

c) The amplification product by the second primer set and the second probe is detected in the sample, the amplification product by the first primer set and the first probe, the amplification product by the third primer set and the third probe, and the fourth primer. If the amplification product by the set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouped into groups containing the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes. steps; and

d) Identify the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli. Processing the sample with a set of primers and probes.

At this time, in step d), E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 Primer sets and probes for identifying serotypes may include any one or more of the primer sets and probes selected from the following vii) to xxvii):

vii) a seventh primer set for identifying the O103 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;

viii) an eighth primer set for identifying the O121 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24;

ix) a ninth primer set for identifying the O136 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27;

x) a tenth primer set for identifying the O123 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29, and a tenth probe consisting of the nucleotide sequence of SEQ ID NO: 30;

xi) an 11th primer set for identifying the O6 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32, and an 11th probe consisting of the nucleotide sequence of SEQ ID NO: 33;

xii) a twelfth primer set for identifying the O156 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35, and a twelfth probe consisting of the nucleotide sequence of SEQ ID NO: 36;

xiii) a 13th primer set for identifying the O168 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38, and a 13th probe consisting of the nucleotide sequence of SEQ ID NO: 39;

xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41, and a fourteenth probe consisting of the nucleotide sequence of SEQ ID NO: 42;

xv) a 15th primer set for identifying the O3 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44, and a 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45;

xvi) a 16th primer set for identifying the O40 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47, and a 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48;

xvii) a 17th primer set for identifying the O64 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50, and a 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51;

xviii) an 18th primer set for identifying the O66 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53, and an 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54;

xix) a 19th primer set for identifying the O78 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56, and a 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57;

xx) a 20th primer set for identifying the O80 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59, and a 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60;

xxi) a 21st primer set for identifying the O82 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62, and a 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63;

xxii) a 22nd primer set for identifying the O88 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65, and a 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66;

xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68, and a 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 69;

xxiv) a 24th primer set for identifying the O91 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71, and a 24th probe consisting of the nucleotide sequence of SEQ ID NO: 72;

xxv) a 25th primer set for identifying the O181 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74, and a 25th probe consisting of the nucleotide sequence of SEQ ID NO: 75;

xxvi) a 26th primer set for identifying the O111 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77, and a 26th probe consisting of the nucleotide sequence of SEQ ID NO: 78; and

xxvii) A 27th primer set for identifying the O174 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80, and a 27th probe consisting of the nucleotide sequence of SEQ ID NO: 81.

The method for identifying E. coli serotypes according to the present invention uses the first to sixth primer sets and the first to sixth probes to determine whether or not an amplification product is detected by each primer set and probe. E. coli serotypes include O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. After grouping into groups and processing each primer set specific for the grouped serotypes, serotypes can be quickly and accurately identified without non-specific reaction or cross-reaction of each primer set. In addition, the real-time PCR technique applied to the method of the present invention is a method of detecting amplified DNA in real time as PCR progresses. Unlike general PCR, amplified DNA can be confirmed without additional electrophoresis, and real-time PCR using the Taqman probe method is possible. By applying the forward and reverse primers, a fluorescent substance is attached to the 5' and 3' ends to display a signal whenever the target gene is amplified, resulting in very high accuracy and a low detection limit. It has advantages.

Figure 1 shows E. coli serotypes O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. The results of multiplex PCR using PCR primers and probes for grouping in Table 1 for group 9 are shown.
Figure 2 shows E. coli serotypes O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. Table 2 shows the multiplex PCR results of PCR primers and probes for individual serotype identification for group 9.
Figure 3 shows E. coli serotypes O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. The results of multiplex real-time PCR using PCR primers and probes for grouping in Table 1 for group 9 are shown.
Figure 4 shows E. coli serotypes O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. Table 2 shows the multiplex real-time PCR results of PCR primers and probes for individual serotype identification for group 9.
Figures 5a and 5b show the results of multiplex real-time PCR of the grouping PCR primers and probes in Table 1 and the PCR primers and probes for individual serotype identification in Table 2 for strains isolated from unknown samples obtained from the natural environment, respectively. This shows the results of multiplex real-time PCR.
Figure 6 shows the results of serotype identification for strains isolated from unknown samples obtained from the natural environment using an antiserum method.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention, unless otherwise defined, are used with the same meaning as commonly understood by a person skilled in the art in the field related to the present invention. In addition, preferred methods and samples are described in this specification, but similar or equivalent methods are also included in the scope of the present invention.

As described above, the existing serotype identification methods, such as the antiserum method or the in silico serotyping method, have limitations in that they require a long analysis time and high cost to identify the serotype. Accordingly, the present inventors have made diligent efforts to develop a kit that is not only cost-effective while shortening the analysis time, but also has high serotype identification accuracy. As a result, primers specific to six genes with specific patterns for each serotype of E. coli Using the set, E. coli having a specific serotype can be primarily grouped, and each primer set specific to the grouped serotype is processed to quickly and accurately identify the serotype without non-specific reaction or cross-reaction of each primer set. By confirming that it is possible to solve the problem described above by providing six primer sets that can group serotypes of E. coli and a primer set that can identify individual serotypes of the group grouped as containing a specific serotype, A solution was sought.

Specifically, the present inventors downloaded 1339 E. coli complete genome sequences from NCBI and then identified serotypes using in silico serotyping (Serotypefinder tool). Then, based on the identified data, 1 to 3 n values (complete genome sequences) were selected for each serotype, and then pan-genome analysis was performed. Afterwards, six genes with specific patterns were identified for each serotype, and it was discovered that E. coli serotypes were divided into nine groups depending on the presence or absence of each gene.

According to the above results, the present invention relates to a technology for identifying the serotype of E. coli grouped into Group 9, wherein the amplification product by the second primer set and the second probe is detected in Group 9, An amplification product using a first primer set and a probe, an amplification product using a third primer set and a third probe, an amplification product using a fourth primer set and a fourth probe, an amplification product using a fifth primer set and a fifth probe, and O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, for which amplification products by the sixth primer set and sixth probe were not detected. , O8, O91, O181 and O111 serotypes.

Therefore, the first aspect of the present invention includes the following first to sixth primer sets, O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66 of E. coli, Primer sets, compositions, and kits for grouping into groups including O6, O78, O80, O82, O88, O8, O91, O181, and O111 serotypes, and O103, O121, O123, O136, O156, O168, Methods for grouping into groups comprising O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes:

i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;

ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;

iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;

iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;

v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and

vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17.

As used herein, the term “primer” refers to a polynucleotide that can act as an initiation point for nucleic acid synthesis in the template-direction when placed under conditions that initiate polynucleotide elongation. Primers can also be used in a variety of other oligonucleotide-mediated synthesis processes, including as initiators of de novo RNA synthesis and in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (e.g., oligodeoxyribonucleotides). The appropriate length of the primer depends on the intended use, typically ranging from 6 to 40 nucleotides, more typically from 15 to 35 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. Primers are not required to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize to the template for the primer to be extended. In certain embodiments, the term "primer set" includes a 5'-sense primer that hybridizes complementary to the 5'-end of the nucleic acid sequence to be amplified, and a 3'-antisense primer that hybridizes to the 3' end of the sequence to be amplified. It means a set of primers containing. Primers may be labeled, if desired, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, useful labels include: ³² P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA assays), biotin, or haptens, and proteins for which antiserum or monoclonal antibodies may be used. .

In the present invention, the forward primer of the first primer set is referred to as 'DR-F' and the reverse primer is referred to as 'DR-R', the forward primer of the second primer set is referred to as 'CD-F', and the reverse primer is referred to as 'CD-F'. -R', the forward primer of the third primer set is referred to as 'G4E-F', the reverse primer is referred to as 'G4E-R', the forward primer of the fourth primer set is referred to as 'A4E-F', and the reverse primer is referred to as 'A4E-F'. It is referred to as 'A4E-R', the forward primer of the fifth primer set is referred to as 'BGT-F', the reverse primer is referred to as 'BGT-R', and the forward primer of the sixth primer set is referred to as 'D2E-F', reverse primer. The primer is referred to as 'D2E-R'.

O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes of E. coli according to the present invention. A composition for grouping into a containing group may include the above-described primer set and a probe that specifically binds to a gene having a specific pattern for each serotype of E. coli.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA that is as short as a few bases or as long as several hundreds of bases, capable of forming a specific binding to a complementary base sequence, and is labeled so that it has a specific base. The presence or absence of a sequence can be confirmed. Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. Additionally, fluorescently labeled probes can be used to perform real-time PCR. More specifically, when using a TaqMan probe, an oligonucleotide labeled with a fluorescent substance at the 5' end and a quencher at the 3' end is added to the PCR reaction solution. In addition, real-time PCR using a cycling probe is a highly sensitive detection method consisting of a chimeric probe made of RNA and DNA and RNAse H. In this case, the 5' end of the probe is labeled with a fluorescent substance and the 3' end with a quencher.

The probe anneals to a specific target sequence located between the forward and reverse primers during the amplification process and is cleaved by the 5' nuclease activity of Taq polymerase during the extension phase of the PCR cycle to produce a fluorescent substance (reporter dye). Separation from the quencher (quenching dye) increases the fluorescence intensity. Fluorescence intensity can be monitored at each PCR cycle by a real-time PCR system.

In the present invention, the probes that specifically bind to genes having a specific pattern for each serotype of E. coli may include the following first to sixth probes:

i) a first probe consisting of the nucleotide sequence of SEQ ID NO: 3; ii) a second probe consisting of the nucleotide sequence of SEQ ID NO: 6; iii) a third probe consisting of the nucleotide sequence of SEQ ID NO: 9; iv) a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12; v) a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and vi) a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18.

In the present invention, the first probe is 'DR-P', the second probe is 'CD-P', the third probe is 'G4E-P', the fourth probe is 'A4E-P', and the fifth probe is 'BGT-P' and the sixth probe are referred to as 'D2E-P' and can be used together with the first to sixth primer sets in each order.

O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes of E. coli according to the present invention. A kit for grouping into a containing group may include the composition of the above-described composition.

The kit of the present invention may further include one or more other component compositions, solutions, or devices suitable for the analysis method. Preferably, the kit may include essential elements required to perform multiplex PCR or multiplex real-time PCR. Specifically, the kit may further include a reaction buffer, dNTPs, and DNA polymerase. For example, the kit of the present invention may optionally include reagents necessary to perform a target nucleic acid amplification reaction (e.g., PCR reaction), such as buffer, DNA polymerase cofactor, and deoxyribonucleotide-5-triphosphate. . Optionally, the kits of the invention may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the optimal amount of reagents used in the kit for a specific reaction can be easily determined by a person skilled in the art who has learned the disclosure herein. Typically, the equipment of the present invention may be manufactured in separate packaging or compartments containing the previously mentioned components.

In the present invention, the kit may further include a negative control and a positive control. A negative control is a control without the DNA mixture and is necessary to eliminate the possibility of contamination when performing PCR. Positive controls are necessary to validate that the PCR performed as intended.

O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes of E. coli according to the present invention. The method of grouping into a containing group can be performed using the primer set, composition, or kit described above.

Specifically, the method includes a first set including a first primer set and a first probe, a second primer set and a second probe, a third primer set and a third probe, and a fourth primer set and a fourth probe, Performing a polymerase chain reaction (PCR) by treating the sample with a second set including a fifth primer set, a fifth probe, a sixth primer set, and a sixth probe, respectively; and b) confirming amplification products by each primer set and probe in the sample.

In the present invention, the description of the primer set and probe used in step a) is the same as described above, so the description thereof is omitted.

The method of the present invention is implemented by PCR, where primers are used for gene amplification reactions.

The grouping method of the present invention is a sample treated with the first set including the first primer set and the first probe, the second primer set and the second probe, the third primer set and the third probe, and the fourth primer set. and a second set including a fourth probe, a fifth primer set, a fifth probe, a sixth primer set, and a sixth probe.

PCR is the best-known nucleic acid amplification method, and many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to improve the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information about PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

As used herein, the term “amplification reaction” refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR; US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR); Sambrook et al., A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), method of Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822), multiplex PCR (McPherson and Moller, 2000), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) ; WO 88/10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence priming Consensus sequence primed polymerase chain reaction (CP-PCR; U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR; U.S. Patent Nos. 5,413,909 and 5,861,245) , nucleic acid sequence based amplification (NASBA; U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification and ring-mediated homeothermic amplification ( loop-mediated isothermal amplification; LAMP), but is not limited to this. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617, and US Patent 09/854,317.

The method according to the present invention performs a gene amplification reaction using a primer set, thereby simultaneously amplifying target genes from the analysis target (e.g., DNA samples isolated from food as well as clinical specimens such as sputum, blood, saliva, or urine). It can be detected.

Therefore, in the method of the present invention, the sample in step a) may be a sample derived from food, but is not limited thereto, and a sample derived from a clinical specimen may also be used. The clinical specimens include, but are not limited to, sputum, saliva, blood, and urine.

Extraction of DNA from a sample can be performed according to conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al., Plant Mol. Rep., 9:242 (1991); Current Protocols in Molecular Biology, John Willey & Sons (1987); al., Biochem. 162:156 (1987).

The primer used in the present invention hybridizes or anneals to one site of the template to form a double-stranded structure. Conditions for nucleic acid hybridization suitable for forming these double-chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B.D., et al., Nucleic Acid Hybridization. , A Practical Approach, IRL Press, Washington, D.C. (1985).

A variety of DNA polymerases can be used in the amplification of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Includes.

When carrying out a polymerization reaction, it is desirable to provide an excess amount of the components necessary for the reaction in the reaction vessel. The excess amount of components required for the amplification reaction refers to an amount such that the amplification reaction is not substantially limited by the concentration of the components. It is desirable to provide cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to the reaction mixture in such an amount that the required degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer solution allows all enzymes to approximate optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as adding reactants.

In the present invention, annealing is performed under stringent conditions that enable specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary depending on environmental variables.

As described above, the method of the present invention can group serotypes of E. coli by checking whether amplification products are detected by the first to sixth primer sets and the first to sixth probes.

The term “hybridization” used herein means forming a duplex structure by pairing complementary base sequences of two single-stranded nucleic acids. Hybridization may occur when the complementarity between single-stranded nucleic acid sequences is perfect (perfect match) or even when some mismatched bases exist. The degree of complementarity required for hybridization may vary depending on hybridization reaction conditions, and may be particularly controlled by temperature. There is no difference between the terms “annealing” and “hybridization” used in this specification, and they are used interchangeably in this specification.

The method according to the invention can be performed by multiplex PCR or multiplex real-time PCR.

The “real-time PCR” can monitor the process in real time when performing PCR. Therefore, data is collected throughout the PCR process, not at the end of the PCR. In real-time PCR, the reaction is characterized by the point during the cycle when amplification is first detected, rather than by the amount of target accumulated after a fixed number of cycles. Mainly two methods are used to perform quantitative PCR: dye-based detection and probe-based detection.

The method of the present invention may additionally include the step of confirming the amplification result by PCR by measuring the Ct (cycle threshold) value.

The Ct (cycle threshold) value refers to the number of cycles at which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The Ct value is the cycle in which an increase in ΔRn was first detected. Rn refers to the size of the fluorescence signal generated during PCR at each time point, and ΔRn refers to the fluorescence emission intensity of the reporter dye divided by the fluorescence emission intensity of the reference dye (normalized reporter signal). The Ct value is also called Cp (crossing point) in LightCycler. The Ct value indicates the point at which the system begins to detect an increase in fluorescent signal associated with exponential growth of the PCR product in log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

In PCR, PCR amplification products can be detected through fluorescence. Detection methods largely include an interchelating method (SYBR Green I method) and a method using a fluorescently labeled probe (TaqMan probe method). Since the interchelating method detects all double-stranded DNA, there is no need to prepare probes for each gene, so a reaction system can be constructed at low cost. The method using fluorescently labeled probes is expensive, but has high detection specificity, allowing even similar sequences to be distinguished and detected.

TaqMan probes typically contain a primer (e.g., 20-30 nucleotides long) containing a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ)) at the 3'-end. ) is a longer oligonucleotide. The excited fluorescent substance transfers energy to a nearby quencher rather than emitting fluorescence (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al., Proc Natl Acad Sci USA, 94(20): 10756- 61(1997)). Therefore, if the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to internal regions of PCR products.

The TaqMan probe specifically hybridizes to the template DNA during the annealing step, but fluorescence is suppressed by a quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5' to 3' nuclease activity of Taq DNA polymerase, and the fluorescent dye is released from the probe, thereby releasing the inhibition by the quencher and causing fluorescence. At this time, the 5'-end of the TaqMan probe must be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of this polymerase to form the reporter molecule. A fluorescent signal is generated.

The reporter molecules and quencher molecules bound to the TaqMan probe include fluorescent substances and non-fluorescent substances. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any known in the art, examples of which are as follows (numbers in parentheses are maximum emission wavelengths in nanometers): Cy2 ^TM (506), YOPRO ^TM -1 (509), YOYO ^TM -1 (509), Calcein (517), FITC (518), FluorX ^TM (519), Alexa ^TM (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green ^TM 500 (522), Oregon Green ^TM 488 (524), RiboGreen ^TM (525), Rhodamine Green ^TM (527), Rhodamine 123 (529), Magnesium Green ^TM (531), Calcium Green ^TM (533), TO-PRO ^TM -1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568) , BODIPY564/570 (570), Cy3 ^TM (570), Alexa ^TM 546 (570), TRITC (572), Magnesium Orange ^TM (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ^TM (576) ), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ^TM (590), Cy3.5 ^TM (596), ROX (608), Calcium Crimson ^TM (615), Alexa ^TM 594 ( 615), Texas Red (615), Nile Red (628), YO-PRO ^TM -3 (631), YOYO ^TM -3 (631), R-phycocyanin (642), CPhycocyanin (648), TO-PRO ^TM - 3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ^TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546) ), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 ( 591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum wavelength of emission expressed in nanometers.

Suitable reporter-quencher pairs are described in many publications: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, ^2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

Additionally, the non-fluorescent material used for the reporter molecule and quencher molecule bound to the TaqMan probe may include a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" herein refers to a TaqMan probe conjugated with MGB at the 3'-end of the probe.

MGB is a substance that binds to the minor groove of DNA with high affinity, including netropsin, distamycin, lexitropsin, mithramycin, chromomycin A3, and olivo. Olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenil, CC-1065, Hoechst 33258, DAPI (4-6- diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, MPC (N-methylpyrrole-4-carbox-2-amide) and its dimers, trimers, tetramers and pentamers. It doesn't work.

Conjugation of the probe and MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, the increased stability (i.e., increased degree of hybridization) results in an increased melting temperature (Tm) of the hybrid duplex formed by the MGB-conjugated probe compared to the normal probe. Therefore, MGB stabilizes van der Waals forces, increasing the melting temperature (Tm) of MGB-conjugated probes without increasing probe length, thereby allowing shorter probes (e.g., 21 nucleotides or less) in Taqman real-time PCR under more stringent conditions. It makes possible the use of.

Additionally, the MGB-conjugated probe removes background fluorescence more efficiently. Accordingly, the probe of the present invention may be in the form of a TaqMan MGB-conjugate, where the length of the probe includes, but is not limited to, 15-30 nucleotides.

In the present invention, the method c) detects the amplification product by the second primer set and the second probe in the sample, the amplification product by the first primer set and the first probe, the third primer set, and the third probe. If the amplification product by, the amplification product by the fourth primer set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, Serotypes of E. coli present in the sample were O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181, and O111. A step of grouping into groups containing serotypes may be additionally included.

In a specific embodiment of the present invention, E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. After performing multiplex PCR using the primer set and probe for serotype grouping described above for E. coli O181, E. coli O111, and E. coli O174, the amplification product was confirmed by electrophoresis. As a result, as shown in Figure 1, amplification products by the second primer set (CD-F and CD-R) and the second probe (CD-P) were confirmed for all of the 21 serotypes of E. coli. First primer set (DR-F and DR-R) and first probe (DR-P), third primer set (G4E-F and G4E-R) and third probe (G4E-P), fourth primer set (A4E-F and A4E-R) and the fourth probe (A4E-P), the fifth primer set (BGT-F and BGT-R) and the fifth probe (BGT-P) and the sixth primer set (D2E-F). and D2E-R) and the sixth probe (D2E-P) were not identified as amplification products, O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78. , were confirmed to have one of the following serotypes: O80, O82, O88, O8, O91, O181, and O111, and these results showed that E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. coli O111, and E. coli O174 were used as test strains.

In another specific embodiment of the present invention , E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. Multiplex real-time PCR was performed using the primer sets and probes for serotype grouping described above for E. coli O181, E. coli O111, and E. coli O174, and amplification curves for each primer set and probe were obtained through fluorescence detection. Confirmed. As a result, as shown in Figure 3, E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, Amplification curves for E. coli O91, E. coli O181, E. coli O111, and E. coli O174 were confirmed by the second primer set (CD-F and CD-R) and the second probe (CD-P), respectively. , first primer set (DR-F and DR-R) and first probe (DR-P), third primer set (G4E-F and G4E-R) and third probe (G4E-P), fourth primer. sets (A4E-F and A4E-R) with a fourth probe (A4E-P), a fifth primer set (BGT-F and BGT-R) with a fifth probe (BGT-P), and a sixth primer set (D2E- The amplification curves by probe F and D2E-R) and the sixth probe (D2E-P) were not confirmed. These results are consistent with the results of confirming the amplification product by electrophoresis after performing the multiplex PCR, and the strains used in the experiment were O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, It means having one of the following serotypes: O66, O6, O78, O80, O82, O88, O8, O91, O181, and O111.

E. coli serotypes detected in the sample through the above steps were O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, If it is determined to be one of the serotypes among O91, O181, and O111, only the primer sets specific for the above 21 serotypes are processed to quickly and accurately identify the individual serotype without non-specific reaction or cross-reaction of each primer set. there is.

Therefore, the second aspect of the present invention is O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 of E. coli. Or primer sets, compositions, and kits for identifying O111 serotypes and O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82 of E. coli using the same. It relates to a method for identifying O88, O8, O91, O181 or O111 serotypes.

The primer set for serotype identification according to the present invention may include any one or more of the following 7th to 27th primer sets:

vii) a seventh primer set for identifying the O103 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;

viii) an eighth primer set for identifying the O121 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23;

ix) a ninth primer set for identifying the O136 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26;

x) a tenth primer set for identifying the O123 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29;

xi) an 11th primer set for identifying the O6 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32;

xii) a twelfth primer set for identifying the O156 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35;

xiii) a 13th primer set for identifying the O168 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38;

xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41;

xv) a 15th primer set for identifying the O3 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44;

xvi) a 16th primer set for identifying the O40 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47;

xvii) a 17th primer set for identifying the O64 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50;

xviii) an 18th primer set for identifying the O66 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53;

xix) a 19th primer set for identifying the O78 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56;

xx) a 20th primer set for identifying the O80 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59;

xxi) a 21st primer set for identifying the O82 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62;

xxii) a 22nd primer set for identifying the O88 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65;

xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68;

xxiv) a 24th primer set for identifying the O91 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71;

xxv) a 25th primer set for identifying the O181 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74;

xxvi) a 26th primer set for identifying the O111 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77; and

xxvii) The 27th primer set for identifying the O174 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80.

The composition for serotype identification according to the present invention includes the above-described primer set and O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8 , may include a probe that specifically binds to a unique genetic region of the O91, O181, or O111 serotype.

In the present invention, the probe that specifically binds to the unique gene region of the O103 serotype may be the seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21; The probe that specifically binds to the unique gene region of the O121 serotype may be the eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24; The probe that specifically binds to the unique gene region of the O136 serotype may be the ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27; The probe that specifically binds to the unique gene region of the O123 serotype may be the 10th probe consisting of the nucleotide sequence of SEQ ID NO: 30; The probe that specifically binds to the unique gene region of the O6 serotype may be the 11th probe consisting of the nucleotide sequence of SEQ ID NO: 33; The probe that specifically binds to the unique gene region of the O156 serotype may be the twelfth probe consisting of the nucleotide sequence of SEQ ID NO: 36; The probe that specifically binds to the unique gene region of the O168 serotype may be the 13th probe consisting of the nucleotide sequence of SEQ ID NO: 39; The probe that specifically binds to the unique gene region of the O170 serotype may be the 14th probe consisting of the nucleotide sequence of SEQ ID NO: 42; The probe that specifically binds to the unique gene region of the O3 serotype may be the 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45; The probe that specifically binds to the unique gene region of the O40 serotype may be the 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48; The probe that specifically binds to the unique gene region of the O64 serotype may be the 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51; The probe that specifically binds to the unique gene region of the O66 serotype may be the 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54; The probe that specifically binds to the unique gene region of the O78 serotype may be the 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57; The probe that specifically binds to the unique gene region of the O80 serotype may be the 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60; The probe that specifically binds to the unique gene region of the O82 serotype may be the 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63; The probe that specifically binds to the unique gene region of the O88 serotype may be the 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66; The probe that specifically binds to the unique gene region of the O8 serotype may be the 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 69; The probe that specifically binds to the unique gene region of the O91 serotype may be the 24th probe consisting of the nucleotide sequence of SEQ ID NO: 72; The probe that specifically binds to the unique gene region of the O181 serotype may be the 25th probe consisting of the nucleotide sequence of SEQ ID NO: 75; The probe that specifically binds to the unique gene region of the O111 serotype may be the 26th probe consisting of the nucleotide sequence of SEQ ID NO: 78; The probe that specifically binds to the unique gene region of the O174 serotype may be the 27th probe consisting of the nucleotide sequence of SEQ ID NO: 81.

Identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli according to the present invention. The kit for may include the primer set or composition according to the second aspect, and since the description of other kit components is the same as that described for the kit according to the first aspect, the description thereof is omitted.

Identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli according to the present invention. The method may be performed using the primer set, composition or kit according to the second aspect.

The serotype identification method according to the present invention can identify the serotype by processing the primer set, composition, or kit according to the second aspect and confirming the amplification product by each primer set and probe. For example, if the amplification product by the 7th primer set and the 7th probe is confirmed, serotype O103, if the amplification product by the 8th primer set and the 8th probe is confirmed, serotype O121, if the amplification product by the 9th primer set and the 8th probe is confirmed, 9 When the amplification product by the probe is confirmed O136 serotype, when the amplification product by the 10th primer set and the 10th probe is confirmed O123 serotype, when the amplification product by the 11th primer set and the 11th probe is confirmed O6 serotype, if the amplification product by the 12th primer set and the 12th probe is confirmed O156 serotype, if the amplification product by the 13th primer set and the 13th probe is confirmed O168 serotype, the 14th primer set and the 13th probe 14 When the amplification product is confirmed by the probe O170 serotype, when the amplification product by the 15th primer set and the 15th probe is confirmed O3 serotype, when the amplification product by the 16th primer set and the 16th probe is confirmed O40 serotype, if the amplification product by the 17th primer set and the 17th probe is confirmed O64 serotype, if the amplification product by the 18th primer set and the 18th probe is confirmed O66 serotype, if the amplification product by the 19th primer set and the 18th probe is confirmed 19 When an amplification product by the probe is confirmed O78 serotype, when an amplification product by the 20th primer set and the 20th probe is confirmed O80 serotype, when an amplification product by the 21st primer set and the 21st probe is confirmed O82 serotype, if the amplification product by the 22nd primer set and the 22nd probe is confirmed O88 serotype, if the amplification product by the 23rd primer set and the 23rd probe is confirmed O8 serotype, the 24th primer set and the 23rd probe When an amplification product by the 24 probe is confirmed O91 serotype, when an amplification product by the 25th primer set and the 25th probe is confirmed O181 serotype, when an amplification product by the 26th primer set and the 26th probe is confirmed If an amplification product using the O111 serotype, the 27th primer set, and the 27th probe is confirmed, it can be identified as the O174 serotype.

The method of carrying out the serotype identification method according to the present invention is in accordance with the first aspect described above, except that the primer set, composition or kit according to the second aspect is processed to identify amplification products by each primer set and probe. Since it is the same as the following grouping method, its description is omitted.

In a specific embodiment of the present invention, E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. After performing multiplex PCR using the primer set and probe for serotype identification described above for E. coli O181, E. coli O111, and E. coli O174, the amplification product was confirmed by electrophoresis. As a result, as shown in Figure 2, PCR products corresponding to the 21 serotypes (137 bp, 112 bp, 190 bp, 153 bp, 131 bp, 187 bp, 197 bp, 77 bp, 167 bp, respectively) 139 bp, 100 bp, 197 bp, 145 bp, 196 bp, 73 bp, 192 bp, 136 bp, 101 bp, 139 bp, 90 bp, and 197 bp) were observed and were identified as the same serotype as that of the test strain. It was confirmed that it had been identified.

In another specific embodiment of the present invention, E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, Multiplex real-time PCR was performed on E. coli O181, E. coli O111, and E. coli O174 using the primer set and probe for serotype identification described above, and the amplification curve for each gene was confirmed through fluorescence detection. . As a result, as shown in Figure 4, E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, In E. coli O91, E. coli O181, E. coli O111, and E. coli O174, genes specifically targeting each serotype were amplified, and amplification curves corresponding to each serotype were confirmed. These results are consistent with the results of electrophoresis confirming the amplification product after performing the multiplex PCR, meaning that it was identified as the same serotype as that of the test strain.

The primer set for serotype grouping and the primer set for serotype identification of the present invention are provided in the form of one kit, O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66 of E. coli. , O6, O78, O80, O82, O88, O8, O91, O181 or O111.

Accordingly, the third aspect of the present invention is a set of primers each specific for six genes having a specific pattern for each serotype of E. coli; and primers for identification of O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotypes of E. coli. Set of E. coli serotypes, including O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 It's about sympathy kits.

The kit according to the third aspect of the present invention may include the primer set according to the first aspect and the primer set according to the second aspect, and since the description thereof is the same as that described above, the description thereof is omitted.

In addition, the kit according to the third aspect of the present invention may include the probe according to the above-described first aspect and the probe according to the second aspect, and similarly, the description thereof is the same as the above-described, so the description thereof is omitted. .

The kit according to the third aspect of the present invention may further include a reaction buffer, dNTPs, and DNA polymerase, and since the components included in the kit are the same as described above, their description is omitted.

The kit according to the third aspect of the present invention is a kit for E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, It can be used to identify O181 or O111 serotypes, and can specifically be performed including the following steps a) to d):

a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;

b) confirming amplification products by each primer set and probe in the sample;

c) The amplification product by the second primer set and the second probe is detected in the sample, the amplification product by the first primer set and the first probe, the amplification product by the third primer set and the third probe, and the fourth primer. If the amplification product by the set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouped into groups containing the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes. steps; and

d) Identify the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli. Processing the sample with a primer set and probe for.

The serotype identification method according to the third aspect of the present invention may be to first perform the serotype grouping method according to the above-described first aspect, and then perform the serotype identification method according to the second aspect, description of which Since is the same as described above, its description is omitted.

In a specific embodiment of the present invention, O103, O121, O123, O136, O156, O168, O170, and O174 of E. coli using the primer set and probe for serotype grouping and the primer set and probe for serotype identification according to the present invention. , O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 To verify the effectiveness of the serotype identification method, serotypes were identified for strains isolated from unknown samples. and compared with the results of existing antiserum methods and in silico methods. As a result, as confirmed in Figures 5a, 5b, 6 and Table 5, in the serotype identification results according to the present invention and the results of the existing antiserum method and in silico method, Eco415 and STEC-084-M were O103 K-EC009 was identified as O136 serotype, Eco545 and C-EC-0005 were identified as O121 serotype, Eco452 and K-EC196 were identified as O123 serotype, and Eco453 and Eco502 were identified as O156 serotype. Eco435 and Eco551 were identified as O6 serotypes, Eco481 and STEC-089-M were identified as O168 serotypes, Eco288 and Eco464 were identified as O3, and Eco269 was identified as O170 serotypes. A79 and A80 were identified as O40 serotype, K-EC271 was identified as O78 serotype, Eco300 and Eco548 were identified as O82 serotype, E77 was identified as O80 serotype, and Eco368 and Eco 363 were identified as O88 serotype. K-EC324 and K-EC124 were identified as O91 serotype, Eco383 was identified as O181 serotype, Eco419 and K-EC100 were identified as O174 serotype, and STEC-017-S and STEC-051 -M was identified as O111 serotype, and it was found that all identification results were consistent.

Sequences corresponding to the primer and probe sets used in the present invention are indicated by sequence numbers, but the primers and probes are interpreted as equivalent to the present invention if some sequences are substituted, deleted, or added within the range where functional identity is maintained. It can be.

As used herein, the term “identification” may be used interchangeably with terms such as discrimination, detection, or identification.

Hereinafter, the present invention will be described in more detail through examples. However, since the present invention can make various changes and take various forms, the specific embodiments and descriptions described below are only intended to aid understanding of the present invention and do not limit the present invention to the specific disclosed form. That's not what I'm trying to do. The scope of the present invention should be understood to include all changes, equivalents, and substitutes included in the spirit and technical scope of the present invention.

experimental strain E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. coli O111 and E. coli Performing multiplex PCR for O174

1-1. Experimental strains and cultures

E. coli strains E. coli O103 (NCCP 15956, NCCP), E. coli O121 (L-EC 012, SNU culture collection), E. coli O136 (L-EC 018, SNU culture collection), E. coli O123 (L- EC 013, SNU culture collection), E. coli O6 (NCCP 15732, NCCP), E. coli O156 (L-EC 027, SNU culture collection), E. coli O168 (L-EC 030, SNU culture collection), E coli O170 (L-EC 032, SNU culture collection), E. coli O3 (L-EC 048, SNU culture collection), E. coli O40 (L-EC 051, SNU culture collection), E. coli O64 (L-EC 051, SNU culture collection). -EC 055, SNU culture collection), E. coli O66 (L-EC 056, SNU culture collection), E. coli O78 (ATCC 35401, ATCC), E. coli O80 (L-EC 062, SNU culture collection), E. coli O82 (L-EC 064, SNU culture collection), E. coli O88 (L-EC 066, SNU culture collection), E. coli O8 (L-EC 061, SNU culture collection), E. coli O91 ( L-EC 067, SNU culture collection), E. coli O181 (L-EC 041, SNU culture collection), E. coli O111 (ATCC 43887, ATCC) and E. coli O174 (L-EC 035, SNU culture collection) were cultured in LB liquid medium supplemented with tryptone, yeast extract, and sodium chloride using a stirred incubator at 3°C.

1-2. Design of primer sets and probes for serotype grouping and identification

Primer sets and probes that specifically bind to each of the six target genes for grouping E. coli serotypes were designed as shown in Table 1.

set designation order sequence number Amplicon length/bp ^b Primer content
(F, R respectively) Probe content set 1 DR-F CCGGACCAGCTGGGGTATATG One 195 15 pmol 15 pmol DR-R TGGTACAAGCCTGCGACTTC 2 DR-P FAM-TGCGCCAACTGGGCGAGAGTTGC-TAMRA 3 CD-F AAGACATCATCGTGACCAAA 4 158 15 pmol 15 pmol CD-R TTGCTGAAAATGTCCGGTAT 5 CD-P CY5-GACCAGCGGGTTGGCGACAA-BHQ1 6 G4E-F ATGCACTTGCCTTACCCACT 7 124 15 pmol 15 pmol G4E-R ACTGTGTTGTTGCGCAGAAT 8 G4E-P HEX-ACGCTGTCAGCTCAGTGCGCGTGA-BHQ3 9 set 2 A4E-F GCGCAAGCAGGTGTACGTTA 10 98 10 pmol 10 pmol A4E-R TTATAGCGGCATCCTTCCAGT 11 A4E-P FAM-CCCAATGCATATGCAGATGCAAACC-TAMRA 12 BGT-F GGGGTACTTGTGGAAAAATACT 13 149 15 pmol 15 pmol BGT-R AAAATAATGCTTTTATATGCTGAAG 14 BGT-P CY5-CGGGAACAGGCAATTCGTGCCTCTCGG-BHQ1 15 D2E-F AAGAACTCACGAGCTGTGCT 16 171 20 pmol 20 pmol D2E-R ATCCAGCGCTTGTAATACGC 17 D2E-P HEX-AGCGCATGAGCGTCCGGAAGGCT-BHQ3 18

Additionally, as shown in Table 2, individual serotypes include O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, and O91. , each primer set and probe to identify O181 and O111 serotypes was designed, accuracy and sensitivity experiments were conducted, and the primer sets and probes shown in Table 2 were finally selected. The primers and probes used in the present invention were manufactured by Bionics Co., Ltd. (http://www.bionicsro.co.kr/).

group serotype designation order sequence number Amplicon length/bp ^b Primer content
(F, R respectively) Probe content group
9-1 O103 O103-F TTGGAGCGTTAACTGGACCT 19 137 23 pmol 23 pmol O103-R TGCCGTAGTAAGAACAGCCA 20 O103-P HEX-ACAGCTTGCCAATATCCGGCATCC-TAMRA 21 O121 O121-F TGCTGGCATAAACTATCTGT 22 112 11 pmol 11 pmol O121-R TGAGCTAAAATAACCTGCGT 23 O121-P CY5-TCAACATGTCGGCCATTTAGCGTTGA-BHQ1 24 O136 O136-F TGAAGGTGGCGTAATAGCTTTG 25 190 11 pmol 11 pmol O136-R TGCAGAAGCAACAACTTGCAC 26 O136-P FAM-GGAGTGTCATTTTGGGGGCGGGCGA-BHQ1 27 group
9-2 O123 O123-F TAGGCACCTGTCATCCGTA 28 153 30 pmol 30 pmol O123-R AAGCATTATACCACCCGCACA 29 O123-P HEX-GGAGGGGAAAAACTATGTGCACTTACGTGG-TAMRA 30 O6 O6-F TGAGCTTGCCGGAAAATAAGC 31 131 7.5 pmol 7.5 pmol O6-R ACATCCAATCAGACCAAATGCT 32 O6-P FAM-TGGCCTCATACACAGCA AACCCAGA-BHQ1 33 O156 O156-F TGCGTATGCAGGAGGTAACG 34 187 7.5 pmol 7.5 pmol O156-R TCCCAAACCTCCCTTAAAATAACG 35 O156-P CY5-TGATGAACCCGGGGCATTCAGTTTTGT-BHQ1 36 Group 9-3 O168 O168-F TGGGGGAGGAATATTTAGTCA 37 197 15 pmol 15 pmol O168-R ATTTATCGCAGCGTTTCATC 38 O168-P HEX-TGCTGGTGGAGGACCACGCA-TAMRA 39 O170 O170-F TAGTGATACAGATGGACAGGGG 40 77 8 pmol 8 pmol O170-R ATCCAACACCCGCATTTTGC 41 O170-P FAM-CGATCAGCACTTCTTCAAGCCGCAA-BHQ1 42 O3 O3-F AGTAAAACCACTAAAATATCCTGT 43 167 22 pmol 22 pmol O3-R GCACCGCTTGTTTATATTTTGT 44 O3-P CY5-TTTTTGGCAATTGAGCGCAAGCGCA-BHQ1 45 Group 9-4 O40 O40-F ATGCATTAGGCGCACTTCCT 46 139 18 pmol 18 pmol O40-R ACTGAACGACCATTTAACATTGC 47 O40-P HEX-AGTGTGTTGCGGATTAGGGGTGTCA-TAMRA 48 O64 O64-F ACAGGTTTGGATTTGGCGTGA 49 100 9 pmol 9 pmol O64-R ACATCCCTGAAGAAACAAGAAT 50 O64-P CY5-TCGCAGTATTTCCCTGGTTGGCTTAGATT-BHQ1 51 O66 O66-F TTAGCGTTCTTTGTGCGGGG 52 197 18 pmol 18 pmol O66-R ACGGCCAAGTGCTAGTGAAA 53 O66-P FAM-GCGCCATATTCATCCT AATGCTTTTGTCGC-BHQ1 54 Group 9-5 O78 O78-F TGCAAGTTATTTGATGCCTAC 55 145 26 pmol 26 pmol O78-R CGCAACAGGAATACCTAACA 56 O78-P HEX-GCTCTCAAAGCGTTTCCATGATGGTGT-TAMRA 57 O80 O80-F ACTTATTGGCTTTGGGCCAT 58 196 13 pmol 13 pmol O80-R AGCTCCTTCAAACTGGGATA 59 O80-P FAM-TGCCTGCTTGGATCTTGGCTCTCAT-BHQ1 60 O82 O82-F TGTTTTACATCGATGGTCGTT 61 73 6 pmol 6 pmol O82-R AACTGCGGAAAACTGTTAGAA 62 O82-P CY5-ACGGAAAAGTTCCTACGTTTGGCTTCGA-BHQ1 63 Group 9-6 O88 O88-F CTGATTGCAGCTCATTTGTC 64 192 17 pmol 17 pmol O88-R CAATTTACGTCGACCAGA 65 O88-P HEX-TGGGTTTCCCAATTGTCAGCATCTGGCA-TAMRA 66 O8 O8-F TGTCTGCCGATCATCGTGAC 67 136 17 pmol 17 pmol O8-R GCAAAAGCAGGACCGGTATC 68 O8-P FAM-GTCACCGGTAACTTCCCCGGCTGGC-BHQ1 69 O91 O91-F GAAGGCAAGTAGCGTTTTGACA 70 101 11 pmol 11 pmol O91-R GTATCGCAGGCCACTTCCAT 71 O91-P CY5-TGGATTTCTGTGCTTTTTGTCACTTTGGCC-BHQ1 72 Group 9-7 O181 O181-F TTGGGCCATCTGGAATTGCT 73 139 21 pmol 21 pmol O181-R TCGAGATTTTCTGGTGAGTGCT 74 O181-P HEX-CGCAGGGAGGTATATTGTCTGGAGTAACG-TAMRA 75 O111 O111-F GTCCCTTGCCTTCAACTAG 76 90 12 pmol 12 pmol O111-R TGCTTTCATTCTAGCAAACATTG 77 O111-P FAM-TGATGTTCACTCTTTCTGCGTTCTGCA-BHQ1 78 O174 O174-F TTTCGTATTCAGCAATTGTACTCA 79 197 12 pmol 12 pmol O174-R GGTTTTGCTAAGTTTCTGCCCC 80 O174-P CY5-TTTTAGGCCCGCTTACTGGGAAGCA-BHQ1 81

1-3. Accuracy evaluation of PCR primer sets for grouping using experimental strains

40ng of total DNA was isolated and prepared from each strain in Example 1-1 using the culture medium obtained in Example 1-1 or the G-spin Genomic DNA Extraction Kit (for bacteria) (Intronbio) according to the manufacturer's instructions. Next, in order to proceed with the grouping PCR step to divide E. coli serotypes into groups, reagent mix (enzyme, dNTP, buffer, etc.), primer set in Table 1, probe, and molecular water were mixed at the concentration in Table 3. It was prepared with The total DNA and the mixture prepared above were added to a real-time PCR tube, and PCR was performed under the conditions in Table 4. PCR products were loaded on a 4% agarose gel, electrophoresed, and confirmed by EtBr staining. A sample without a DNA mixture was used as a negative control (-), and a mixture of genomic DNA of each serotype was used as a positive control (+) to determine whether PCR was performed accurately. The detection results of the amplification products are shown in Figure 1 as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of the primer sets and probes for serotype grouping.

Sample volume sheep template DNA One 40 ng R primer (20 μM) 0.75 15 pmol F primer (20 μM) 0.75 15 pmol qPCR mix (2X) 10 TaqMan probe (20 μM) 0.75 15 pmol molecule water 6.75 gun 20

step Temperature (℃) hour cycle Pre-denaturation 95 5 minutes One Denaturation 95 30 seconds 35 Annealing 60 1 min 35

As can be seen in Figure 1, the amplification products by the second primer set and the second probe (CD-F, CD-R, and CD-P) were detected, but the amplification products by the first primer set and the first probe (DR-F, DR-R and DR-P), a third primer set and a third probe (G4E-F, G4E-R and G4E-P), a fourth primer set and a fourth probe (A4E-F, A4E- R and A4E-P), the fifth primer set and the fifth probe (BGT-F, BGT-R, and BGT-P), and the sixth primer set and the sixth probe (D2E-F, D2E-R, and D2E-P). The amplification product was not detected, so the strains used in the experiment were O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, It was confirmed to have one of the serotypes O91, O181, and O111. These results show that E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. This is consistent with the use of E. coli O111 and E. coli O174 as test strains.

1-4. Accuracy evaluation of PCR primer sets for serotype identification using experimental strains

Under the same conditions as grouping PCR, multiplex PCR was performed using primer sets and probes for a total of 21 serotypes in Table 2. As seen in Figure 2, O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111, respectively. PCR products corresponding to each serotype specifically for serotype strains (137 bp, 112 bp, 190 bp, 153 bp, 131 bp, 187 bp, 197 bp, 77 bp, 167 bp, 139 bp, 100 bp, respectively) 197 bp, 145 bp, 196 bp, 73 bp, 192 bp, 136 bp, 101 bp, 139 bp, 90 bp and 197 bp) were observed.

experimental strain E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. coli O111 and E. coli Performing multiplex real-time PCR for O174

2-1. Accuracy evaluation of PCR primer sets for grouping using experimental strains

Multiplex real-time PCR was performed on the experimental strain of Example 1-1 under the same conditions as Example 1-3. At this time, the fluorescence generated by the probe during the binding and extension steps during real-time PCR was measured using the CFX96 Touch Deep Well Real-Time PCR Detection system (Bio-rad, USA). The amplification curves by primer sets and probes for serotype grouping are shown in Figure 3 as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of each primer set and probe.

As shown in Figure 3, the experimental strains used were E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, E. coli coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. coli O111, and E. coli O174, respectively, amplification curves were confirmed by the second primer set and the second probe (CD-F, CD-R, and CD-P), but the amplification curves by the second primer set and second probe (CD-F, CD-R, and CD-P) were confirmed, respectively. Primer set and first probe (DR-F, DR-R and DR-P), third primer set and third probe (G4E-F, G4E-R and G4E-P), fourth primer set and fourth probe (A4E-F, A4E-R and A4E-P), fifth primer set and fifth probe (BGT-F, BGT-R and BGT-P) and sixth primer set and sixth probe (D2E-F, D2E -R and D2E-P) amplification curves were not identified. These results are consistent with the multiplex PCR results of Example 1-3, and the strains used in the experiment were O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, It means having one of the following serotypes: O80, O82, O88, O8, O91, O181, and O111.

2-2. Accuracy evaluation of PCR primer sets for serotype identification using experimental strains

Multiplex real-time PCR was performed on the experimental strain of Example 1-1 under the same conditions as Example 1-4. At this time, the fluorescence generated by the probe during the binding and extension steps during real-time PCR was measured using the CFX96 Touch Deep Well Real-Time PCR Detection system (Bio-rad, USA).

As shown in Figure 4, the experimental strains used were E. coli O103, E. coli O121, E. coli O136, E. coli O123, E. coli O6, E. coli O156, E. coli O168, and E. coli. coli O170, E. coli O3, E. coli O40, E. coli O64, E. coli O66, E. coli O78, E. coli O80, E. coli O82, E. coli O88, E. coli O8, E. coli O91, E. coli O181, E. coli O111, and E. coli O174, genes specifically targeting each serotype were amplified, and amplification curves corresponding to each serotype were confirmed. These results are consistent with the results of confirming the amplification product by electrophoresis after performing the multiplex PCR, meaning that it was identified as the same serotype as that of the test strain.

Performance of multiplex real-time PCR on unknown samples and comparative validation with existing serotype identification methods

In order to verify the effectiveness of the primer set and probe for serotype grouping in Table 1 and the primer set and probe for serotype identification in Table 2, 78 strains isolated from unknown samples obtained from nature were tested in Example 2 and Multiplex real-time PCR was performed under the same conditions, and the results were compared with the results of the existing serotype identification methods, the Antisera method and the In silico serotype method. Amplification curves by primer sets and probes for serotype grouping are shown in Figures 5a and 5b as DR, CD, G4E, A4E, BGT, and D2E, respectively, according to the names of each primer set and probe.

As a result of performing the serotype identification method according to the present invention, as confirmed in Figures 5a and 5b, Eco415, STEC-084-M, K-EC009, Eco545, C-EC-0005, Eco452, K-EC196, Eco453, Eco502, Eco435, Eco551, Eco481, STEC-089-M, Eco288, Eco464, Eco269, A79, A80, K-EC271, O78, Eco300, Eco548, E77, Eco368, Eco 363, K -EC324, K-EC124, Eco383, Eco419, K-EC100, STEC-017-S, and STEC-051-M strains each use a second primer set and a second probe (CD-F, CD-R, and CD-P) The amplification curve was confirmed, but the first primer set and first probe (DR-F, DR-R and DR-P), the third primer set and third probe (G4E-F, G4E-R and G4E-P) ), fourth primer set and fourth probe (A4E-F, A4E-R and A4E-P), fifth primer set and fifth probe (BGT-F, BGT-R and BGT-P) and sixth primer set. and the amplification curves by the sixth probe (D2E-F, D2E-R and D2E-P) were not confirmed, primarily O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64. , were grouped as having one of the following serotypes: O66, O6, O78, O80, O82, O88, O8, O91, O181, and O111. In addition, in the multiplex real-time PCR step for individual serotype identification, Eco415 and STEC-084-M had amplification curves specific to the O103 serotype, and K-EC009 had an amplification curve specific to the O136 serotype. Eco545 and C-EC-0005 had amplification curves specific to the O121 serotype, Eco452 and K-EC196 had amplification curves specific to the O123 serotype, and Eco453 and Eco502 had amplification curves specific to the O156 serotype. was confirmed, Eco435 and Eco551 had amplification curves specific to the O6 serotype, Eco481 and STEC-089-M had amplification curves specific to the O168 serotype, and Eco288 and Eco464 had O3-specific amplification curves. was confirmed, Eco269 had an amplification curve specific to the O170 serotype, A79 and A80 had an amplification curve specific to the O40 serotype, and K-EC271 had an amplification curve specific to the O78 serotype. Eco300 and Eco548 had amplification curves specific to the O82 serotype, E77 had amplification curves specific to the O80 serotype, Eco368 and Eco 363 had amplification curves specific to the O88 serotype, and K-EC324 and K-EC124 had amplification curves specific to the O91 serotype, Eco383 had amplification curves specific to the O181 serotype, Eco419 and K-EC100 had amplification curves specific to the O174 serotype, and STEC -017-S and STEC-051-M had specific amplification curves for the O111 serotype, Eco415 and STEC-084-M for the O103 serotype, K-EC009 for the O136 serotype, and Eco545 and C-EC-0005. is O121 serotype, Eco452 and K-EC196 are O123 serotype, Eco453 and Eco502 are O156 serotype, Eco435 and Eco551 are O6 serotype, Eco481 and STEC-089-M are O168 serotype, Eco288 and Eco464 are O3 and Eco269. is O170 serotype, A79 and A80 are O40 serotype, K-EC271 is O78 serotype, Eco300 and Eco548 are O82 serotype, E77 is O80 serotype, Eco368 and Eco 363 are O88 serotype, K-EC324 and K- EC124 was identified as O91 serotype, Eco383 as O181 serotype, Eco419 and K-EC100 as O174 serotype, and STEC-017-S and STEC-051-M as O111 serotype.

Next, Eco415, STEC-084-M, Eco545, C-EC-0005, Eco453, Eco502, Eco481, STEC-089-M, Eco288, Eco464, A79, A80, Eco435, Eco551, Eco368, Eco 363, STEC- As a result of performing an antiserum method using E. COLI O ANTISERA FOR USE WITH BOILED CULTURE:O116 (SSI DIAGNOSTICA) against 017-S and STEC-051-M strains, Eco415 and STEC-084, as shown in Figure 6 -M is O103 serotype, Eco545 and C-EC-0005 are O121 serotype, Eco453 and Eco502 are O156 serotype, Eco481 and STEC-089-M are O168 serotype, Eco288 and Eco464 are O3 serotype, A79 and A80. were identified as O40 serotype, Eco435 and Eco551 were identified as O6 serotype, Eco368 and Eco 363 were identified as O88 serotype, and STEC-017-S and STEC-051-M were identified as O111 serotype, showing the results of the serotype identification method according to the present invention. It matched.

Finally, Eco415, STEC-084-M, K-EC009, Eco545, C-EC-0005, Eco452, K-EC196, Eco453, Eco502, Eco435, Eco551, Eco481, STEC-089-M, Eco288, Eco464, Eco269 , A79, A80, K-EC271, O78, Eco300, Eco548, E77, Eco368, Eco 363, K-EC324, K-EC124, Eco383, Eco419, K-EC100, STEC-017-S, STEC-051-M strains As a result of performing the in silico serotype method, as confirmed in Table 5, Eco415 and STEC-084-M were O103 serotype, K-EC009 was O136 serotype, and Eco545 and C-EC-0005 were O121 serotype. , Eco452 and K-EC196 are O123 serotypes, Eco453 and Eco502 are O156 serotypes, Eco435 and Eco551 are O6 serotypes, Eco481 and STEC-089-M are O168 serotypes, Eco288 and Eco464 are O3, and Eco269 are O170 serotypes. , A79 and A80 are O40 serotypes, K-EC271 are O78 serotypes, Eco300 and Eco548 are O82 serotypes, E77 are O80 serotypes, Eco368 and Eco 363 are O88 serotypes, and K-EC324 and K-EC124 are O91 serotypes. Type, Eco383 was identified as O181 serotype, Eco419 and K-EC100 were identified as O174 serotype, and STEC-017-S and STEC-051-M were identified as O111 serotype, similarly consistent with the results of the serotype identification method according to the present invention. And it was found.

PCR serotype
result Antiserum serotyping results In silico serotyping results strain Expected serotype Expected serotype gene sameness Expected serotype Eco415 O103 O103 wzy 100 (1149 / 1149) O103 wzx 100 (1266 / 1266) STEC-084-M O103 O103 wzy 100 (1149 / 1149) O103 wzx 100 (1266 / 1266) K-EC009 O136 O136 O136 wzx 100 (1239/1239) Eco545 O121 O121 wzy 100 (1191/1191) O121 wzx 100 (1395/1395) C-EC-0005 O121 O121 wzy 100 (1191/1191) O121 wzx 100 (1395/1395) K-EC196 O123 O123 wzy 99.68 (1251/1251) O123 wzx 99.59 (1446/1446) Eco452 O123 O123 wzy 100 (1251/1251) O123 wzx 100 (1446/1446) Eco502 O156 O156 wzy 100 (1206/1206) O156 wzx 99.82 (1140/1140) Eco435 O6 O6 O6 wzx 100 (1257 / 1257) Eco551 O6 O6 O6 wzx 100 (1257 / 1257) Eco481 O168 O168 wzy 100 (1233/1233) O168 wzx 100 (1272/1272) STEC-089-M O168 O168 wzy 100 (1233/1233) O168 wzx 100 (1272/1272) Eco288 O3 O3 wzy 99.91 (1083/1083) O3 wzx 99.87 (1494/1494) Eco464 O3 O3 wzy 99.91 (1083/1083) O3 wzx 99.87 (1494/1494) Eco269 O170 O170 wzy 99.74 (1173/1173) O170 wzx 99.76 (1248/1248) A79 O40 O40 O40 wzx 99.45 (1283/1281) A80 O40 O40 wzy 99.83 (1207/1206) O40 wzx 99.45 (1283/1281) K-EC271 O78 O78 O78 wzx 100 (1101/1416) Eco300 O82 O82 wzy 99.82 (1083/1083) O82 wzx 99.84 (1231/1230) Eco548 O82 O82 wzy 99.72 (1083/1083) O82 wzx 99.92 (1230/1230) E77 O80 O80 wzy 100 (1227/1227) O80 wzx 100 (1221/1221) Eco368 O88 O88 wzy 100 (1275/1275) O88 wzx 100 (1458/1458) Eco 363 O88 O88 wzy 100 (1275/1275) O88 wzx 100 (1458/1458) K-EC324 O91 O91 wzy 99.92 (1212/1212) O91 wzx 99.92 (1266/1266) K-EC124 O91 O91 wzy 99.92 (1212/1212) O91 wzx 99.92 (1266/1266) Eco383 O181 O181 wzy 100 (992/1251) O181 wzx 100 (1272/1272) Eco419 O174 O174 wzy 98.25 (1140/1140) O174 K-EC100 O174 O174 wzy 98.25 (1140/1140) O174 STEC-017-S O111 O111 O111 wzx 100 (1266 / 1266) STEC-051-M O111 O111 O111 wzx 100 (1266 / 1266)

Through the results of this example, it was possible to verify the effectiveness of the primer set and probe for serotype grouping and the primer set and probe for individual serotype identification of the present invention.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (20)

O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88 of E. coli, comprising the following primer sets of i) to vi), Primer sets for grouping into groups containing O8, O91, O181 and O111 serotypes:
i) a first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2;
ii) a second primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5;
iii) a third primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8;
iv) a fourth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11;
v) a fifth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14; and
vi) A sixth primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82 of E. coli, including the following primer sets and probes i) to vi), Compositions for grouping into groups comprising O88, O8, O91, O181 and O111 serotypes:
i) a first primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, and a first probe consisting of the nucleotide sequence of SEQ ID NO: 3;
ii) a second primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 5, and a second probe consisting of the nucleotide sequence of SEQ ID NO: 6;
iii) a third primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8, and a third probe consisting of the nucleotide sequence of SEQ ID NO: 9;
iv) a fourth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11, and a fourth probe consisting of the nucleotide sequence of SEQ ID NO: 12;
v) a fifth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14, and a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15; and
vi) a sixth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17, and a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and Kit for grouping into groups containing O111 serotypes. The kit according to claim 3, further comprising a reaction buffer, dNTPs, and DNA polymerase. The primer set of claim 1; Or, using the composition of claim 2, O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and How to group O111 serotypes into groups containing them. 6. The method of claim 5, wherein the method comprises the following steps a) and b):
a) a first set comprising the first primer set and the first probe, the second primer set and the second probe, and the third primer set and the third probe, and the fourth primer set and the fourth probe, Performing a polymerase chain reaction (PCR) by treating a sample with a fifth primer set, a fifth probe, and a second set including the sixth primer set and the sixth probe, respectively; and
b) Confirming the amplification products by each primer set and probe in the sample. The method of claim 6, wherein c) an amplification product by the second primer set and the second probe is detected in the sample, an amplification product by the first primer set and the first probe, and an amplification product by the third primer set and the third probe. If the amplification product, the amplification product by the fourth primer set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the sample Serotypes of E. coli present include O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181, and O111 serotypes. A method further comprising grouping into a group comprising. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80 of E. coli, comprising any one or more of the following primer sets vii) to xxvii), Primer sets for identification of O82, O88, O8, O91, O181 or O111 serotypes:
vii) a seventh primer set for identifying the O103 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;
viii) an eighth primer set for identifying the O121 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23;
ix) a ninth primer set for identifying the O136 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26;
x) a tenth primer set for identifying the O123 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29;
xi) an 11th primer set for identifying the O6 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32;
xii) a twelfth primer set for identifying the O156 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35;
xiii) a 13th primer set for identifying the O168 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38;
xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41;
xv) a 15th primer set for identifying the O3 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44;
xvi) a 16th primer set for identifying the O40 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47;
xvii) a 17th primer set for identifying the O64 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50;
xviii) an 18th primer set for identifying the O66 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53;
xix) a 19th primer set for identifying the O78 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56;
xx) a 20th primer set for identifying the O80 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59;
xxi) A 21st primer set for identifying the O82 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62;
xxii) a 22nd primer set for identifying the O88 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65;
xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68;
xxiv) a 24th primer set for identifying the O91 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71;
xxv) a 25th primer set for identifying the O181 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74;
xxvi) a 26th primer set for identifying the O111 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77; and
xxvii) The 27th primer set for identifying the O174 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78 of E. coli, comprising any one or more of the following primer sets and probes vii) to xxvii) Composition for O80, O82, O88, O8, O91, O181 or O111 serotype identification:
vii) a seventh primer set for identifying the O103 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;
viii) an eighth primer set for identifying the O121 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24;
ix) a ninth primer set for identifying the O136 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27;
x) a tenth primer set for identifying the O123 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29, and a tenth probe consisting of the nucleotide sequence of SEQ ID NO: 30;
xi) an 11th primer set for identifying the O6 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32, and an 11th probe consisting of the nucleotide sequence of SEQ ID NO: 33;
xii) a twelfth primer set for identifying the O156 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35, and a twelfth probe consisting of the nucleotide sequence of SEQ ID NO: 36;
xiii) a 13th primer set for identifying the O168 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38, and a 13th probe consisting of the nucleotide sequence of SEQ ID NO: 39;
xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41, and a fourteenth probe consisting of the nucleotide sequence of SEQ ID NO: 42;
xv) a 15th primer set for identifying the O3 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44, and a 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45;
xvi) a 16th primer set for identifying the O40 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47, and a 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48;
xvii) a 17th primer set for identifying the O64 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50, and a 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51;
xviii) an 18th primer set for identifying the O66 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53, and an 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54;
xix) a 19th primer set for identifying the O78 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56, and a 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57;
xx) a 20th primer set for identifying the O80 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59, and a 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60;
xxi) a 21st primer set for identifying the O82 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62, and a 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63;
xxii) a 22nd primer set for identifying the O88 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65, and a 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66;
xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68, and a 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 69;
xxiv) a 24th primer set for identifying the O91 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71, and a 24th probe consisting of the nucleotide sequence of SEQ ID NO: 72;
xxv) a 25th primer set for identifying the O181 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74, and a 25th probe consisting of the nucleotide sequence of SEQ ID NO: 75;
xxvi) a 26th primer set for identifying the O111 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77, and a 26th probe consisting of the nucleotide sequence of SEQ ID NO: 78; and
xxvii) A 27th primer set for identifying the O174 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80, and a 27th probe consisting of the nucleotide sequence of SEQ ID NO: 81. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or Kit for O111 serotype identification. The kit according to claim 10, further comprising a reaction buffer, dNTPs, and DNA polymerase. The primer set of claim 8; Or O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 of E. coli using the composition of claim 9. O111 serotype identification method. i) A first primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 4, and a nucleotide sequence of SEQ ID NO: 5 A second primer set containing a reverse primer, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 7 and a third primer set containing a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 8, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 10, and A fourth primer set comprising a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 11, a fifth primer set containing a forward primer consisting of the nucleotide sequence of SEQ ID NO: 13 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 14, and SEQ ID NO: O103, O121, O123, O136, O156, O168, O170, O174, O3 of E. coli, comprising a sixth primer set including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 16 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 17, Primer sets for grouping into groups containing serotypes O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111; and
ii) For identification of the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype of E. coli A primer set containing; O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 of E. coli. Kit for serotype identification. The method of claim 13, wherein the first probe consists of the nucleotide sequence of SEQ ID NO: 3, the second probe consists of the nucleotide sequence of SEQ ID NO: 6, the third probe consists of the nucleotide sequence of SEQ ID NO: 9, and the nucleotide sequence of SEQ ID NO: 12 A kit further comprising a fourth probe, a fifth probe consisting of the nucleotide sequence of SEQ ID NO: 15, and a sixth probe consisting of the nucleotide sequence of SEQ ID NO: 18. The method of claim 13, wherein the E. coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 The primer set for serotype identification is a kit comprising any one or more of the following primer sets vii) to xxvii):
vii) a seventh primer set for identifying the O103 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20;
viii) an eighth primer set for identifying the O121 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23;
ix) a ninth primer set for identifying the O136 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26;
x) a tenth primer set for identifying the O123 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29;
xi) an 11th primer set for identifying the O6 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32;
xii) a twelfth primer set for identifying the O156 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35;
xiii) a 13th primer set for identifying the O168 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38;
xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41;
xv) a 15th primer set for identifying the O3 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44;
xvi) a 16th primer set for identifying the O40 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47;
xvii) a 17th primer set for identifying the O64 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50;
xviii) an 18th primer set for identifying the O66 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53;
xix) a 19th primer set for identifying the O78 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56;
xx) a 20th primer set for identifying the O80 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59;
xxi) a 21st primer set for identifying the O82 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62;
xxii) a 22nd primer set for identifying the O88 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65;
xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68;
xxiv) a 24th primer set for identifying the O91 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71;
xxv) a 25th primer set for identifying the O181 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74;
xxvi) a 26th primer set for identifying the O111 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77; and
xxvii) The 27th primer set for identifying the O174 serotype of E. coli, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80. The method of claim 13, wherein the seventh probe consists of the nucleotide sequence of SEQ ID NO: 21, the eighth probe consists of the nucleotide sequence of SEQ ID NO: 24, the ninth probe consists of the nucleotide sequence of SEQ ID NO: 27, and the nucleotide sequence of SEQ ID NO: 30 Probe 10, probe 11 consisting of the nucleotide sequence of SEQ ID NO: 33, probe 12 consisting of the nucleotide sequence of SEQ ID NO: 36, probe 13 consisting of the nucleotide sequence of SEQ ID NO: 39, probe 14 consisting of the nucleotide sequence of SEQ ID NO: 42 Probe, the 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45, the 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48, the 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51, the 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54, Probe 19 consisting of the nucleotide sequence of SEQ ID NO: 57, Probe 20 consisting of the nucleotide sequence of SEQ ID NO: 60, Probe 21 consisting of the nucleotide sequence of SEQ ID NO: 63, Probe 22 consisting of the nucleotide sequence of SEQ ID NO: 66, SEQ ID NO: The 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 69, the 24th probe consisting of the nucleotide sequence of SEQ ID NO: 72, the 25th probe consisting of the nucleotide sequence of SEQ ID NO: 75, the 26th probe consisting of the nucleotide sequence of SEQ ID NO: 78, and the 24th probe consisting of the nucleotide sequence of SEQ ID NO: 81 A kit further comprising at least one probe selected from the group consisting of a 27th probe consisting of a nucleotide sequence. The kit according to claim 13, further comprising a reaction buffer, dNTPs, and DNA polymerase. O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88 of E. coli using the kit of any one of claims 13 to 17. , O8, O91, O181 or O111 serotype identification method. 19. The method of claim 18, wherein the method comprises the following steps a) to d):
a) a first set comprising a first primer set and a first probe, a second primer set and a second probe and a third primer set and a third probe, and a fourth primer set and a fourth probe, a fifth primer set and Performing a polymerase chain reaction (PCR) by treating the sample with a fifth probe, a sixth primer set, and a second set including the sixth probe, respectively;
b) confirming amplification products by each primer set and probe in the sample;
c) The amplification product by the second primer set and the second probe is detected in the sample, the amplification product by the first primer set and the first probe, the amplification product by the third primer set and the third probe, and the fourth primer. If the amplification product by the set and the fourth probe, the amplification product by the fifth primer set and the fifth probe, and the amplification product by the sixth primer set and the sixth probe are not detected, the serotype of E. coli present in the sample grouped into groups containing serotypes O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111. steps; and
d) Identifying the O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 and O111 serotypes of E. coli. Processing the sample with a set of primers and probes. The method of claim 19, wherein in step d), O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, and , the primer set and probe for identifying the O181 or O111 serotype comprises any one or more of the primer set and probe selected from the following vii) to xxvii):
vii) a seventh primer set for identifying the O103 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 19 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 20, and a seventh probe consisting of the nucleotide sequence of SEQ ID NO: 21;
viii) an eighth primer set for identifying the O121 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 22 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 23, and an eighth probe consisting of the nucleotide sequence of SEQ ID NO: 24;
ix) a ninth primer set for identifying the O136 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 25 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 26, and a ninth probe consisting of the nucleotide sequence of SEQ ID NO: 27;
x) a tenth primer set for identifying the O123 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 28 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 29, and a tenth probe consisting of the nucleotide sequence of SEQ ID NO: 30;
xi) an 11th primer set for identifying the O6 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 31 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 32, and an 11th probe consisting of the nucleotide sequence of SEQ ID NO: 33;
xii) a twelfth primer set for identifying the O156 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 34 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 35, and a twelfth probe consisting of the nucleotide sequence of SEQ ID NO: 36;
xiii) a 13th primer set for identifying the O168 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 37 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 38, and a 13th probe consisting of the nucleotide sequence of SEQ ID NO: 39;
xiv) a fourteenth primer set for identifying the O170 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 40 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 41, and a fourteenth probe consisting of the nucleotide sequence of SEQ ID NO: 42;
xv) a 15th primer set for identifying the O3 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 43 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 44, and a 15th probe consisting of the nucleotide sequence of SEQ ID NO: 45;
xvi) a 16th primer set for identifying the O40 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 46 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 47, and a 16th probe consisting of the nucleotide sequence of SEQ ID NO: 48;
xvii) a 17th primer set for identifying the O64 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 49 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 50, and a 17th probe consisting of the nucleotide sequence of SEQ ID NO: 51;
xviii) an 18th primer set for identifying the O66 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 52 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 53, and an 18th probe consisting of the nucleotide sequence of SEQ ID NO: 54;
xix) a 19th primer set for identifying the O78 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 55 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 56, and a 19th probe consisting of the nucleotide sequence of SEQ ID NO: 57;
xx) a 20th primer set for identifying the O80 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 58 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 59, and a 20th probe consisting of the nucleotide sequence of SEQ ID NO: 60;
xxi) a 21st primer set for identifying the O82 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 61 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 62, and a 21st probe consisting of the nucleotide sequence of SEQ ID NO: 63;
xxii) a 22nd primer set for identifying the O88 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 64 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 65, and a 22nd probe consisting of the nucleotide sequence of SEQ ID NO: 66;
xxiii) a 23rd primer set for identifying the O8 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 67 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 68, and a 23rd probe consisting of the nucleotide sequence of SEQ ID NO: 69;
xxiv) a 24th primer set for identifying the O91 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 70 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 71, and a 24th probe consisting of the nucleotide sequence of SEQ ID NO: 72;
xxv) a 25th primer set for identifying the O181 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 73 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 74, and a 25th probe consisting of the nucleotide sequence of SEQ ID NO: 75;
xxvi) a 26th primer set for identifying the O111 serotype of E. coli, including a forward primer consisting of the nucleotide sequence of SEQ ID NO: 76 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 77, and a 26th probe consisting of the nucleotide sequence of SEQ ID NO: 78; and
xxvii) The 27th primer set for identifying the O174 serotype of E. coli, including the forward primer consisting of the nucleotide sequence of SEQ ID NO: 79 and the reverse primer consisting of the nucleotide sequence of SEQ ID NO: 80, and the 27th probe consisting of the nucleotide sequence of SEQ ID NO: 81.