KR101378920B1 - Methods for selectively detecting a braf mutation and kits using the same - Google Patents

Abstract

The present invention relates to a method for specifically detecting BRAF inside samples by amplifying locations of various mutations using various primers and probes and analyzing the same, and to a diagnosing kit using the same. The method of the present invention can selectively detect various BRAF mutations (for example, BRAF^V600E, BRAF^K601E, BRAF^V600_K601>E or BRAF^A598_T599insV) through multiplex real-time polymerase chain reaction using target (specifically, BRAF exon 15 and exon 3) - specific primers and probes with greatly high efficiency. In addition, the kit of the present invention can simply and efficiently detect the target inside the samples through the multiplex real-time PCR. Thereofre, the method and kit of the present invention can selectively and easily detect existence of various BRAF mutations inside the samples with high sensitivity, and can be more accurately applied to treat diseases (for example, cancer) based on the same.

Description

Methods for Selectively Detecting a BRAF mutation and Kits Using the Same}

The present invention relates to a method for selectively detecting various BRAF mutations in a sample and a kit using the same.

Thyroid cancer is the most common endocrine malignancy and is increasing in Korea. Most thyroid cancers originate in follicular cells, with papillary cancers being the most common, followed by follicular cancers.

Various genetic variations have been reported in thyroid cancer. In 70% of papillary cancers, point mutations in the BRAF and RAS genes, and RET / PTC and TRK gene rearrangements were observed. In 70-75% of vesicular cancers, mutations in the RAS gene or PAX8 / PPAR gene rearrangements were observed. As described above, genetic mutations observed in various thyroid cancers have been applied to clinical trials such as diagnosis and prognosis of thyroid cancer.

Among the genetic variations observed in thyroid cancer, BRAF gene mutation is the most widely applied clinically. BRAF is a serine-threonine kinase belonging to the RAF protein family and is activated when RAS-related proteins attach to the cell membrane to activate the MAPK pathway.

Point mutations in the BRAF gene are the most commonly observed gene mutations in papillary cancer and occur at levels 40-45%. Most of the point mutations occur at base 1799 and the amino acid changes from valine to glutamate (V600E). Such point mutations are known to cause the activation of BRAF and cause cancer by the continuous activation of the MAPK pathway. In addition, K601E point mutations, insertion and deletion mutations at the 600th codon site were observed in 1-2% of papillary cancers.

BRAF V600E mutations have been reported mainly in papillary cancers, but have also been reported in rarely differentiated carcinoma and anaplastic carcinoma. Recent studies have shown that BRAF V600E mutation testing with fine needle aspiration biopsy (FNAB) improves the accuracy of thyroid cancer diagnosis, and is associated with the risk of cancer recurrence and lymph node metastasis as a prognostic factor for papillary cancer. .

The sequencing method is a standard test for the BRAF gene mutation test. However, Sanger's sequencing method is low in sensitivity and can be detected only when genetic mutation occurs in more than 30% of the population (population), so a method of increasing sensitivity using PNA, LNA, etc. has been developed. In laboratories without sequencing, real-time PCR is used. Real-time PCR is excellent in sensitivity, but there are limitations in detectable genetic variation. Currently, most of BRAF genetic mutation detection reagents for real-time PCR are commercially available, and only one V600E mutation is detected. Therefore, a more accurate and convenient detection method is urgently needed.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method that can selectively detect BRAF mutations found in various diseases with good sensitivity. As a result, the inventors have constructed a BRAF mutation detection set consisting of a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and at least one probe selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6 The present invention has been completed by confirming that BRAF mutations can be detected specifically and simply from samples (eg, sputum, blood, saliva or urine) by performing multiplex real-time PCR.

It is an object of the present invention to provide a method for detecting a BRAF mutation in a sample.

It is another object of the present invention to provide a kit for detecting BRAF mutations in a sample.

It is another object of the present invention to provide a nucleotide sequence for detecting a BRAF mutation in a sample.

It is another object of the present invention to provide a probe for detecting a BRAF mutation in a sample.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for detecting a BRAF mutation in a sample, comprising the steps of: (a) preparing a sample; (b) in the sample using a BRAF mutation detection set comprising a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2 and at least one probe selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6 Amplifying the BRAF mutation; And (c) identifying the amplification result as fluorescence.

According to another aspect of the invention, the invention is (i) a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2 sequence, and at least one probe selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6 A BRAF mutation detection set; And (ii) an internal control detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9.

According to another aspect of the present invention, the present invention provides a nucleotide sequence for detecting a BRAF mutation in a sample comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 sequence.

According to another aspect of the present invention, the present invention provides a probe for detecting a BRAF mutation in a sample comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6 sequence.

The present inventors have sought to develop a method that can selectively detect BRAF mutations found in various diseases with good sensitivity. As a result, the inventors have constructed a BRAF mutation detection set consisting of a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and at least one probe selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6 Multiplex real-time PCR was performed to confirm specific and simple detection of BRAF mutations from a sample (eg, sputum, blood, saliva or urine).

Various mutant genes are used for cancer diagnosis and include, for example, genetically modified RET / PTC rearrangements, including RAS mutations, BRAF mutations, PAX8 / PPAR rearrangements, p53 mutations, CTNNB1 mutations and RET mutations, etc. Peyssonnaux, et al. , Biol cell., 93: 53-62 (2001)). Among these genes, the BRAF mutant gene (for example, BRAF ^V600E ) is observed only in papillary cancers, especially papillary cancers, which are poorly differentiated among tumors occurring in the thyroid gland, and are not observed in benign nodules or vesicles. Useful genes are known (Jarry, et al. , Mol Cell Probes., 18: 349-352 (2004); Kim, et al. , Diagn Mol Pathol .. 17: 118-125 (2008)).

The BRAF gene, a B-type RAF kinase, encodes a serine-threonine protein kinase belonging to the raf / mil family. BRAF proteins play an important role in the regulation of the MAP kinase / ERK signaling pathway (RAS-RAF-MEK-ERK-MAP kinase signaling pathway), which has a profound effect on cell division, differentiation and excretion. BRAF mutations are associated with cardiofaciocutaneous syndrome (CFC syndrome) characterized by cardiac defects, mental retardation and peculiar facial appearance. In addition, BRAF mutations are closely associated with various cancers. For example, BRAF mutation-associated cancers include thyroid cancer, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin's Disease, myeloid leukemia, bladder cancer, brain cancer, and nervous system cancer. , Head and neck cancer, head and neck, mouth, throat, squamous cell carcinoma of head and neck, lung cancer such as kidney cancer, small cell and non-small cell cancer, neuroblastoma, glioblastoma , Ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, colorectal cancer, cervical cancer, breast cancer, epithelial cancer, genitourinary cancers such as testicular cancer, esophageal cancer and hematological cancer.

BRAF gene mutations have also been found in thyroid papillary cancer, thyroid undifferentiated cancer, melanoma, colon cancer, gliomas, lung cancer, etc. Detection of BRAF mutation can be used as a diagnostic marker for thyroid papillary cancer. Chung, et al., Clin Endocrinol., 65: 660-666 (2006)).

Detection of the BRAF mutation, which is very useful for the diagnosis of thyroid cancer, can be performed using conventional PCR methods such as PCR and sequencing methods, and polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) methods (Trovisco, et al. ., J Pathol, 202:. 247-251 (2004)), restriction enzyme digestion method ((Chung, et al, Clin Endocrinol, 65:.. 660-666 (2006)) Although the like, the following Disadvantages exist: (a) the need for additional steps such as sequencing or restriction enzyme digestion processes, (b) the need for a long time for detection; (c) high cost; (d) low detection due to very small amounts of BRAF mutations responsiveness.

In order to overcome low detection sensitivity, allele-specific PCR methods, cold-PCR methods, scorpion real-time allele-specific PCR methods, etc. have been used, but there are difficulties to undergo complex reactions. . In addition, primer-specified PCR methods using pyrosequencing are very effective, but have the disadvantage of requiring expensive analytical equipment and requiring high cost.

In contrast, the method using the primers and probes of the present invention can detect and isolate BRAF mutations in a sample very effectively and simply.

According to some embodiments of the present invention, the amplification of the present invention is performed according to a polymerase chain reaction (PCR). According to some embodiments of the present invention, the primers of the present invention are used for amplification reactions.

The term "amplification reaction" as used herein refers to a reaction to amplify a nucleic acid molecule. Various amplification reactions have been reported in the art, which include polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcriptase-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual , 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329, 822), Multiplex PCR (McPherson and Moller, 2000), Riga Agase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA; WO 88/10315) Self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Pat. No. 6,410,276), consensus sequence priming polymerase chain reaction (consensus) sequence primed polymerase chain reaction, CP-PCR; USA Patent 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (US Pat. Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA; USA) Patents 5,130,238, 5,409,818, 5,554,517 and 6,063,603, strand displacement amplification and loop-mediated isothermal amplification; LAMP), but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617, and U.S. Patent No. 09 / 854,317.

As used herein, the term "primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer. The term "annealing" or "priming" means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to form a complementary nucleic acid molecule to the template nucleic acid or a portion thereof .

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction inverse polymerase chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the method of the present invention is carried out using a primer, target genes can be simultaneously detected in an analysis target (for example, sputum, blood, saliva or urine) as an analyte (for example, a target-derived sample). Therefore, the present invention uses a primer that binds to DNA extracted from a sample to perform a gene amplification reaction.

Extraction of DNA from the sample can be carried out according to conventional methods known in the art (see Sambrook, J. et al. , Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al, Plant Mol Biol Rep, 9:..... 242 (1991); Ausubel, FM et al, Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al. , Anal. Biochem. 162: 156 (1987)).

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions suitable nucleic acid hybridization to form such double-stranded structure is Joseph Sambrook, such as, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, etc., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

Various DNA polymerases can be used for amplification of the present invention and include "Clenau" fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu) .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is desirable to provide the reaction mixture with such joins as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The amplified target gene (specifically, the BRAF gene) is analyzed by a suitable method to specifically detect the presence or absence of a BRAF mutation in a sample. For example, the target gene may be selectively detected by observing and analyzing a pattern of a band formed by scanning the amplification reaction product described above through fluorescence measurement.

Therefore, when the method of the present invention is carried out based on an amplification reaction using DNA, specifically, (i) performing an amplification reaction using a primer pair and probe annealed to a BRAF nucleotide sequence; And (ii) analyzing the product of the amplification reaction through fluorescence, thereby comprehensively detecting or quantifying the occurrence and presence of BRAF mutations in DNA extracted from a sample.

The term “hybridization” herein means that two single stranded nucleic acids form a duplex structure by pairing of complementary base sequences. Hybridization can occur either in perfect match between single stranded nucleic acid sequences or in the presence of some mismatching nucleotides. The degree of complementarity required for hybridization can vary depending on hybridization reaction conditions, and can be controlled by temperature. The terms "annealing" and "hybridization" are no different and are used interchangeably herein.

According to certain embodiments of the invention, the methods and kits of the invention are from the group consisting of (i) a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and SEQ ID NO: 3 to SEQ ID NO: 6 A BRAF mutation detection set consisting of one or more probes selected; And (ii) an internal control detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9.

According to some embodiments of the invention, the target used in the methods and kits of the invention is a group consisting of primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2, and SEQ ID NO: 3 to SEQ ID NO: 6 BRAF mutations of BRAF ^V600E , BRAF ^K601E , BRAF ^{V600_K601> E} and BRAF ^{A598_T599insV} detected from a BRAF mutation detection set consisting of one or more probes selected from; And a primer pair comprising SEQ ID NO: 7 and SEQ ID NO: 8, and exon 3 of the BRAF gene detected by the probe of SEQ ID NO: 9.

Real-time PCR is a technique for monitoring and analyzing real-time increases in PCR amplification products (Levak KJ, et al. , PCR Methods Appl. , 4 (6): 357-62 (1995)). The PCR reaction can be monitored by recording fluorescence emission in each cycle during the exponential phase, during which the increase in PCR product is proportional to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the C _t value (threshold cycle). A pronounced increase in fluorescence above the baseline value measured between 3-15 cycles implies detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) Conventional PCR is measured in plateau, while real-time PCR is performed during the exponential growth phase Data can be obtained; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) The degraded probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA without separation by electrophoresis is possible; (g) using a small amplicon size can achieve increased amplification efficiency; And (h) the risk of contamination is low.

When the amount of PCR amplified acid reaches a detectable amount by fluorescence, the amplification curve begins to occur, and the signal rises exponentially to reach the stagnation state. The higher the amount of initial DNA, the faster the amplification curve because the amount of amplified acid is less than the detectable amount of cycles. Therefore, when real-time PCR is performed using a stepwise diluted standard sample, an amplification curve is obtained in which the initial DNA amount is lined up in the order of the same intervals. Setting a threshold at an appropriate point here yields the point C _t at the intersection of the threshold and the amplification curve.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection methods are largely an interchelating method (SYBR Green I method) and a method using a fluorescent label probe (TaqMan probe method). The interchelating method detects both double-stranded DNA, eliminating the need to prepare gene-specific probes, enabling a cost-effective reaction system. The method using a fluorescent label probe is costly, while the detection specificity is high, so even the similar sequence can be detected. According to certain embodiments of the invention, the methods and kits of the present invention utilize the TaqMan probe method.

First, the interchelating method is a method using a double-stranded DNA-binding die, in which an amplicon production including non-specific amplification and primer-dimer complexes is performed using a non-sequence specific fluorescent intercalating reagent (SYBR Green I or ethidium bromide) . The reagent does not bind ssDNA. SYBR Green I is a fluorescent dye that binds to the minor groove of double-stranded DNA. It is an interchelator that shows little fluorescence in solution but strong fluorescence when combined with double-stranded DNA (Morrison TB, Biotechniques. 24 (6): 954-8, 960, 962 (1998)). Thus, the amount of amplification product can be measured since fluorescence is released through the linkage between SYBR Green I and double stranded DNA. SYBR green-silk-time PCR is accompanied by optimization procedures such as melting point or dissociation curve analysis for amplicon identification. Normally, SYBR green is used in a singleplex reaction, but can be used in a multiplex reaction if accompanied by a melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8 12: 3832-40 (2002); and Vrettou C., et al. , Hum. Mut. , Vol 23 (5): 513-521 (2004)).

The C _t (cycle threshold) value is the number of cycles over which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the number of initial copies. Therefore, the C _t value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The C _t value is the cycle in which the increase of DELTA Rn is detected for the first time. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and? Rn denotes the fluorescence emission intensity (normalized reporter signal) of the reporter die divided by the fluorescence emission intensity of the reference die. The C _t value is also referred to as Cp (crossing point) in the LightCycler. The C _t value indicates when the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear phase represents the amplification efficiency (Eff) ( http://www.appliedbiosystems.co.kr/ ).

TaqMan probes, on the other hand, typically contain primers (e.g., 20-30 nucleotides) that include a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ) Lt; RTI ID = 0.0 > oligonucleotides. ≪ / RTI > The excited fluorescent material transfers energy to a nearby quencher rather than to fluoresce (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al. , Proc Natl Acad Sci USA , 94 (20): 10756-61 (1997)). Therefore, when the probe is normal, no fluorescence is generated. The TaqMan probes are designed to anneal to internal parts of the PCR product. Preferably, the TaqMan probe may be designed as BRAF exon 15 amplified by SEQ ID NO: 1 or SEQ ID NO: 2 or internal sequences of exon 3 amplified by SEQ ID NO: 7 and SEQ ID NO: 8 have.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but the fluorescence is inhibited by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is degraded by the 5 'to 3' nuclease activity of the Taq DNA polymerase, and the fluorescent dye is released from the probe and the inhibition by the quencher is released, indicating fluorescence. At this time, the 5'-end of the TaqMan probe should be located downstream of the 3'-terminal of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-3 'nuclease activity of the polymerase cleaves the 5'-end of the TaqMan probe, A fluorescence signal is generated.

The reporter molecule and the quencher molecule attached to the TaqMan probe include a fluorescent substance and a non-fluorescent substance. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any of those known in the art, examples of which are (the number of parentheses is the maximum emission wavelength in nanometers): Cy2 ^{TM (506), YO-PRO} TM -1 (509), YOYO TM -1 (509), Calcein (517), FITC (518), FluorX TM (519), Alexa TM (520), Rhodamine 110 (520) , 5-FAM 522, Oregon Green ^TM 500 522, Oregon Green ^TM 488 524, RiboGreen ^TM 525, Rhodamine Green ^TM 527, Rhodamine 123 529, Magnesium Green ^TM 531, 565, BODIPY TMR 568, BODIPY 558/568 (568), BODIPY 558/550 (550), Calcium Green ^TM 533, TO-PRO ^TM -1 533, TOTO 1 533, JOE 548, ), BODIPY564 / 570 (570) , Cy3 TM (570), Alexa TM 546 (570), TRITC (572), Magnesium Orange TM (575), Phycoerythrin R & B (575), Rhodamine Phalloidin (575), Calcium Orange TM ( 576), Pyronin Y 580, Rhodamine B 580, TAMRA 582, Rhodamine Red ^TM 590, Cy3.5 ^TM 596, ROX 608, Calcium Crimson ^TM 615, A ^{lexa TM 594 (615), Texas} Red (615), Nile Red (628), YO-PRO TM -3 (631), YOYO TM -3 (631), R-phycocyanin (642), C-Phycocyanin (648) , TO-PRO ^TM -3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ^TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET ( 536), VIC (546), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559) , CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM 520, Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength in nanometers. According to some embodiments of the present invention, the reporter molecule and the quencher molecule comprise HEX, VIC, FAM, BHQ-1 and Cy5-based labels.

Suitable reporter-quencher pairs are disclosed in many references: Pesce et al. editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al. , FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOR and CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

In addition, the reporter molecule coupled to the TaqMan probe and the non-transmembrane material used in the quencher molecule may comprise a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" as used herein means a TaqMan probe conjugated with MGB at the 3'-end of the probe. MGB is a substance with high affinity that binds to minor grooves of DNA, such as netropsin, distamycin, lexitropsin, mithramycin, chromomycin A3, and olibo Olivomycin, anthracyycin, sibiromycin, pentamidine, stilamidine, berenil, CC-1065, Hoechst 33258, DAPI (4-6-6- diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, N-methylpyrrole-4-carbox-2-amide (MPC) and dimers, trimers, tetramers and pentamers thereof, including but not limited to It doesn't happen.

The conjugation of the probe and the MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, increased stability (i.e., increased hybridization degree) results in increased melting temperature of the hybrid duplex formed by the MGB-conjugated probe as compared to the normal probe. Thus, MGB stabilizes Van der Waals forces to increase the melting temperature of MGB-conjugated probes without increasing the probe length, resulting in shorter probes in Taqman real-time PCR under more stringent conditions Nucleotides.

In addition, MGB-conjugated probes remove background fluorescence more efficiently. According to some embodiments of the invention, the length of the TaqMan MGB-conjugate probe of the invention includes, but is not limited to, 15-21 nucleotides.

According to some embodiments of the invention, the 5'-terminus of the probe of the invention is labeled with one fluorophore selected from the group consisting of VIC, FAM, Cy5 and ROX, and the 3'-terminus is BHQ And one quencher selected from the group consisting of -2 and MGB.

More specifically, the sequence listing 3rd sequence of the present invention uses the 5'-terminal fluorescent material and VIC and 3'-end MGB as the quencher, and the sequence listing 4th sequence of the present invention is 5'-end MAM is used as a quencher at the FAM and 3'-ends as the fluorescent material, and sequence 5th sequence of the present invention uses BHQ-2 as the quencher at the Cy5 and 3'-ends as the 5'-end fluorescent material, SEQ ID NO: 6 is the 5'-terminal fluorescent material ROX and 3'-terminal using BHQ-2 as a quencher, SEQ ID NO: 9 of the present invention is a 5'-end fluorescent material Cy5.5 And BHQ-2 as a quencher at the 3'-end.

According to some embodiments of the present invention, the concentration of the TaqMan MGB-conjugate probe of the invention is 50-900 nM, more specifically 100-600 nM, even more specifically 150-400 nM, More specifically, it is 200-300 nM.

The target nucleic acid used in the present invention is not particularly limited and includes all of DNA (gDNA or cDNA) or RNA molecules, more preferably gDNA. When the target nucleic acid is an RNA molecule, reverse transcription is used with the cDNA. Target nucleic acids include, for example, prokaryotic nucleic acids, eukaryotic cells (e. G., Protozoans and parasites, fungi, yeast, higher plants, lower animals and higher animals including mammals and humans) , Influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.) nucleic acid or a viroid nucleic acid, and more specifically a eukaryotic nucleic acid.

Methods for annealing or hybridizing a target nucleic acid to an extension primer and a probe can be carried out by a hybridization method known in the art. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and reaction time, buffer components and their pH and ionic strength depend on various factors such as the length and GC amount of the oligonucleotide and the target nucleotide sequence. Detailed conditions for hybridization can be found in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999).

The template-dependent nucleic acid polymerase used in the present invention is an enzyme having 5 ' to 3 ' nuclease activity. The template-dependent nucleic acid polymerase used in the present invention is preferably a DNA polymerase. Typically, DNA polymerases have 5 'to 3' nuclease activity. The template-dependent nucleic acid polymerase used in the present invention includes E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Specifically, template-dependent nucleic acid polymerases are thermostable DNA polymerases that can be obtained from various bacterial species, which include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , Pyrococcus furiosus ( Pfu), Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species spr. , DNA polymerase of Thermotoga neapolitana and Thermosipho africanus .

A "template-dependent extension reaction" catalyzed by a template-dependent nucleic acid polymerase refers to a reaction that synthesizes a nucleotide sequence complementary to the sequence of a template.

According to some embodiments of the present invention, the real-time PCR of the present invention is performed by the TaqMan probe method.

According to certain embodiments of the invention, the minimum DNA amount of detection of BRAF mutations by real-time PCR of the invention is 1 ng or less, more specifically 100 fg or less, even more specifically 50 fg, most specifically 30-35 fg.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a method for specifically detecting a BRAF mutation in a sample by using a variety of primers and probes by amplifying and analyzing various mutation sites simultaneously and a diagnostic kit using the same.

(b) The method of the present invention utilizes a variety of BRAF mutations through multiplex real-time polymerase chain reaction (TPC) using target (specifically, BRAF exon 15 and exon 3) -specific primers and probes. ( ^Eg , BRAF ^V600E , BRAF ^K601E , BRAF ^{V600_K601> E,} and BRAF ^{A598_T599insV} ) can be selectively detected with very high efficiency.

(c) In addition, the kit of the present invention can easily and efficiently detect targets in a sample through multiplex real-time PCR.

(d) Thus, the methods and kits of the present invention can easily and easily detect, with high sensitivity, the presence or absence of various BRAF mutations in a sample and can be applied to the treatment of diseases (eg, cancers) more accurately based thereon. .

1-5 show multiplex real-time PCR results showing specific detection of BRAF mutation sites using primer pairs and probes of the present invention. 1 to 5 are fluorescence detection results of the internal controls BRAF exon 3 (FIG. 1), V600E (FIG. 2), K601E (FIG. 3), A598_T599insV (FIG. 4) and V600_K601> E (FIG. 5). The X and Y axes represent the detection signal pattern according to the cycle and the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle, respectively. Green channel, K601E (1799T>A); Yellow channel, V600E (1801A>G); Orange channel, A598_T599insV (1794_1795insGTT); Red channel, V600_K601> E (1799_1801delTGA); And Crimson channel, internal control (BRAF exon 3). In the case of Figure 1, using a BRAF cDNA clone (clone ID, KU004031; pTZ18RP1 vector; Korea Human Gene Bank), the amount (ng / uL) used in each experiment is as follows: 3.8 x 10 ^- from left ² , 3.8 x 10 ^-3 , 3.8 x 10 ^-4 , 3.8 x 10 ^-5 , 3.8 x 10 ^-6 , 3.8 x 10 ^-7 and 3.8 x 10 ^-8 . In the case of Figure 2, using the BRAF V600E (1801A> G) -containing plasmid (pGEM-B1 vector; Bioneer, Korea), the amount (ng / uL) used in each experiment is as follows: from left to 1.8 , 1.8 x 10 ^-2 , 1.8 x 10 ^-3 , 1.8 x 10 ^-4 , 1.8 x, 10 ^-5 1.8 x 10 ^-6 and 1,8 x 10 ^-7 . In the case of Figure 3, it was carried out using a K601E (1799T> A) -containing plasmid (pGEM-B1 vector; Bioneer, Korea), and the amount (ng / uL) used in each experiment was as follows: 2.0 x from left 10 ^-2 , 2.0 x 10 ^-3 , 2.0 x 10 ^-4 , 2.0 x, 10 ^-5 2.0 x 10 ^-6 , 2.0 x 10 ^-7 and 2.0 x 10 ^-8 . In the case of Figure 4, it was carried out using A598_T599insV (1794_1795insGTT) -containing plasmid (pGEM-B1 vector; Bioneer, Korea), and the amount (ng / uL) used in each experiment was as follows: 3.0 x 10 ⁻ from the left. ² , 3.0 x 10 ^-3 , 2.0 x 10 ^-4 , 3.0 x, 10 ^-5 3.0 x 10 ^-6 , 3.0 x 10 ^-7 and 3.0 x 10 ^-8 . In the case of Figure 5, was carried out using the V600_K601> E (1799_1801delTGA) -containing plasmid (pGEM-B1 vector; Bioneer, Korea), the amount (ng / uL) used in each experiment is as follows: 7.0 x from the left 10 ^-2 , 7.0 x 10 ^-3 , 7.0 x 10 ^-4 , 7.0 x, 10 ^-5 7.0 x 10 ^-6 and 7.0 x 10 ^-7 .
6-9 show multiplex real-time PCR results showing specific detection of BRAF mutation sites by primer pairs and probes of the present invention when mixed with wild type BRAF and mutated BRAF. 6 to 9 show that the internal control and V600E are mixed (FIG. 6), the internal control and K601E are mixed (FIG. 7), the internal control and A598_T599insV are mixed (FIG. 8) and internal product. The result of fluorescence detection is shown when the control group and V600_K601> E are mixed (FIG. 9). The X and Y axes represent the detection signal pattern according to the cycle and the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle, respectively. Green channel, K601E (1799T>A); Yellow channel, V600E (1801A>G); Orange channel, A598_T599insV (1794_1795insGTT); Red channel, V600_K601> E (1799_1801delTGA); And Crimson channel, internal control (BRAF exon 3). All experimental results showed the internal control (A panel) and the mutated BRAF (B panel) simultaneously, and the amount of mutated BRAF in the total samples was 32%, 20%, 14% and 7%, respectively, from the left of the graph.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Primers and Probes for Mutation Detection in BRAF

The real-time PCR primers and probes designed and used in this study are shown in Table 1.

Real-time PCR primers and probes for detecting BRAF mutations. The sequence (5 '- > 3') Detection position BRAF mutation Forward primer CATGAAGACCTCACAGTAAAAATAGG BRAF Exxon 15 Reverse primer CCACAAAATGGATCCAGACAA Probe VIC-CTACAGAGAAATCTCG-MGB
FAM-CAGTGGAATCTCGA-MGB
Cy5-AGCTACAGAATCTCGATGGAGTGG-BHQ2
ROX-AGCTGTTACAGTGAAATCTCGATGGA-BHQ2 V600E
K601E
V600_K601> E
A598_T599insV Internal control group Forward primer AGCCTTTCAGTGCTACCTTCA Reverse primer TTTGTTGGGCAGGAAGACTC Probe Cy5.5-AGCAACCCCAAGTCACCACA-BHQ2 BRAF Exxon 3

Multiplex real-time PCR

Multiplex real-time polymerase chain reaction was performed using Rotor-Gene Q (QIAGEN Inc., Germantown, MD, USA) using Rotor-Gene multiplex PCR Kit (QIAGEN Inc., Germantown, MD, USA) The PCR conditions were as follows: (a) pre-denaturing step, 5 min at 95 ° C; And (b) one cycle consisting of 40 cycles, 15 seconds at 95 DEG C (denaturation step) and 15 seconds at 64 DEG C (annealing and extension step). At this time, the composition of the reactants performing the multiplex-time-polymerase chain reaction is shown in Table 2 below. The primer-probes mix below is 10 pmole / μl forward primer, 10 pmole / μl reverse primer for detecting BRAF-mutated genes and internal control genes (Internal control (IC; BRAF exon 3) And 4 pmole / μl probe. Thus, 1.25 μl of the primer-probe mixture used for the PCR reaction contains 12.5 pmole for the forward and reverse primers and 5 pmole for the probe, respectively. Since the total volume of the reactants carrying out a total of 25 μl of the polymerase chain was 25 μl, the concentrations of the primers and probes were 0.5 M (12.5 pmoles / 25 μl) and 0.2 M (5 pmole / 25 μl), respectively.

Composition and concentration of reactants used for PCR. ingredient volume
( μ l) density 2X Rotor-Gene Multiplex PCR Master Mix 12.5 1X Primer-probe mixture Primer (10 pmole / μl) 1.25 0.5 μM Probe (4 pmole / μl) 0.2 [mu] M Nuclease-deficient water 6.25 - Sample DNA template 5 - all 25 -

Gene Q (QIAGEN Inc., Germantown, MD, USA) is used to measure the fluorescence produced by the probe in the binding and extension steps during the multiplex-time-polymerase chain reaction. The multiplex-time-polymerase chain reaction method is a method of real-time polymerase chain reaction (PCR), which is performed in a real-time manner at every cycle of a real-time PCR using the principle of DNA polymerase and fluorescence resonance energy transfer Is detected and quantified. Room-if the FAM ^TM color over time monitor the green channel (510 ± 5 nm), if VIC which ^{the TM} color yellow channel (555 ± 5 nm), when Cy5 ^TM color development the red channel (660 ± 10 nm), It was designated to display on the orange channel (610 ± 5 nm) when the ROX ^TM was developed and the crimson channel (712 log pass) when the Cy5.5 ^TM was developed. Fluorescence was observed in the green, yellow, orange, red and crimson channels.

Experiment result

In the case of the internal control in the crimson channel, when the peak value was observed at the threshold value of 0.05 and the C _t value (cycle threshold) of less than 36, it means that the DNA extraction was good and the PCR inhibition was not shown (Fig. One).

For the V600E mutation in the yellow channel, if the threshold is observed at a maximum of 0.03 and the C _t value is less than 38 cycles, it is considered as a positive result indicating the presence of the mutation (FIG. 2).

In the case of K601E mutations in the green channel, when the threshold is observed at a maximum value of 0.03 and the C _t value is less than 38 cycles, it is considered as a positive result indicating the presence of the mutation (FIG. 3).

In the case of A598_T599insV mutation in the orange channel, if the threshold value is 0.05 and the C _t value is observed at the maximum value under 38 cycles, it is considered as a positive result indicating the presence of the mutation (FIG. 4).

In the case of V600_K601> E mutation in the red channel, when the threshold value is 0.05 and the C _t value is observed at the maximum value under 38 cycles, it is considered as a positive result indicating the presence of the mutation (FIG. 5).

In addition, even when the wild-type BRAF and the mutated BRAF coexisted, the presence of the mutated BRAF could be detected concentration-dependently using the primer pair of the present invention (FIGS. 6 to 9). In addition, all mutated BRAFs could be specifically detected when at least 7% were present in the sample (i.e., less than 93% wild type BRAF was present in the sample), particularly the K601E mutation, the A598_T599insV mutation and the V600_K601> E mutation position. They were very sensitive enough to be selectively detected even in amounts below 5% (no results).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Attach an electronic file to a sequence list

Claims (15)

Methods for detecting BRAF mutations in a sample comprising the following steps:
(a) preparing an isolated DNA sample;
(b) BRAF mutation in the sample using a BRAF mutation detection set consisting of (i) a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of SEQ ID NO: 3 to SEQ ID NO: 6 (Ii) amplifying the internal control in the sample using an internal control detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9; And
(c) confirming the amplification result with fluorescence.
delete The method of claim 1, wherein the amplification is performed according to a polymerase chain reaction (PCR).
The method of claim 1, wherein said amplification is performed according to real-time PCR.
5. The method of claim 4, wherein said real-time PCR is performed by TaqMan probe method.
delete (i) a BRAF mutation detection set consisting of a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe consisting of SEQ ID NO: 3 to SEQ ID NO: 6; And (ii) an internal control detection set comprising a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9.
The kit for detecting a BRAF mutation in a sample according to claim 7, wherein the kit is performed by gene amplification.
The kit for detecting a BRAF mutation in a sample according to claim 7, wherein the kit is performed by real-time PCR.
The kit for detecting a BRAF mutation in a sample according to claim 9, wherein the real-time PCR is performed by a TaqMan probe method.
The kit for detecting a BRAF mutation in a sample according to claim 7, wherein the kit is used for predicting or diagnosing cancer.
A nucleotide sequence for detecting a BRAF mutation in a sample comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
A probe for detecting a BRAF mutation in a sample comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 6.
The method of claim 13, wherein the 5'-terminal end of the SEQ ID NO: 3 to SEQ ID NO: 6 is labeled with one fluorophore selected from the group consisting of VIC, FAM, CY5 and ROX, 3 Probe for detecting a BRAF mutation in a sample, characterized in that the '-terminal can be modified with one quencher selected from the group consisting of BHQ-2 and MGB.
The probe for detecting a BRAF mutation in a sample according to claim 13, wherein the probe is used for predicting or diagnosing cancer.

Images