KR101614921B1 - Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same - Google Patents

Abstract

The present invention relates to a method for specifically detecting vancomycin-resistant enterococci using vancomycin-resistant enterococci-specific primers and probes, and a diagnostic kit using the method. The method of the present invention can be applied to a multiplexer using a target gene (specifically, vancomycin resistance gene ( vanA , vanB ), D-alanine-D-alanine ligase ( ddl ) gene, 16S rRNA) Time PCR (multiplex real-time polymerase chain reaction), vancomycin-resistant enterococci can be detected with very high efficiency. In addition, the kit of the present invention can easily and efficiently detect target genes in a sample through multiplex real-time PCR. Therefore, the method and kit of the present invention can easily detect the infection of a sample of vancomycin-resistant enterococci in a sample, and can be applied to the treatment of diseases more accurately based thereon.

Description

Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same}

The present invention relates to a method for detecting vancomycin-resistant enterococci, and a kit using the same.

Vancomycin-Resistant Enterococci (VRE) first appeared in England and France in 1987, and since then, its incidence has rapidly increased worldwide and has become an important pathogen of nosocomial infection. In Korea, in 1992, Park et al. reported 1 week of Enterococcus durans with high tolerance in a temporary specimen of a leukemia patient. After that, the frequency of isolation of endocytococci was very low, but from 1998 it increased rapidly with the increase in oral vancomycin use. Currently, 30-45% of Enterococcus faecium isolated from the intensive care unit shows resistance to vancomycin, so appropriate infection control is required.

The rapid and sensitive detection of vancomycin endocytococci makes it possible to treat patients with infections with appropriate antimicrobial agents, and to prevent the spread of endocytococci by implementing appropriate infection control in patients with colonization. Vancomycin-resistant enterococcus inoculation in a solid medium or inoculation in a solid medium after enrichment in a sorting liquid medium takes 4-5 days to report the test results, which is a problem in infection control. Therefore, a method of rapidly and accurately detection using polymerase chain reaction, etc., was used for the monitoring culture of endocytococci. Real-time polymerase chain reaction method is more suitable for hospital laboratory because it detects endocytococci more rapidly and sensitively and has less workload than polymerase chain reaction method. This is because the reaction time is short and the amplification product can be checked sensitively and accurately in real time, so electrophoresis is not required after the reaction.

Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

The present inventors have tried to develop a method that can detect vancomycin-resistant enterococci easily and quickly. As a result, the present inventors produced a vancomycin-resistant enterococci detection set consisting of a primer pair and a probe and subjected to multiplex real-time PCR to specifically identify vancomycin-resistant enterococci from a sample (e.g., a DNA sample derived from a clinical sample). By finding out that it can be detected simply as, the present invention has been completed.

An object of the present invention is to provide a method for detecting vancomycin-resistant enterococci.

Another object of the present invention is to provide a kit for detecting vancomycin-resistant enterococci.

Other objects and advantages of the present invention will become more apparent by the following detailed description and claims.

According to one aspect of the present invention, the present invention provides a method for simultaneous detection of non-tuberculosis mycobacteria comprising the following steps:

(a) preparing an isolated DNA sample;

(b) (i) a first detection set with a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe of SEQ ID NO: 3; And at least one detection set selected from the group consisting of a second detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9; And (ii) a third detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and probes of SEQ ID NO: 6; And the target nucleotide sequence in the sample using at least one detection set selected from the group consisting of a fourth detection set consisting of a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12. Amplifying; And

(c) analyzing the amplification result.

According to another aspect of the present invention, the present invention comprises: (i) a first detection set with a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and a probe of SEQ ID NO: 3; And at least one detection set selected from the group consisting of a second detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9; (Ii) a third detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and probes of SEQ ID NO: 6; And at least one detection set selected from the group consisting of a fourth detection set consisting of a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12; And (iii) an internal control detection set consisting of a primer pair of SEQ ID NO: 13 and SEQ ID NO: 14, and a probe selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 16; Kits are provided.

The present inventors have tried to develop a method that can detect vancomycin-resistant enterococci easily and quickly. As a result, the present inventors produced a vancomycin-resistant enterococci detection set consisting of a primer pair and a probe and subjected to multiplex real-time PCR to specifically identify vancomycin-resistant enterococci from a sample (e.g., a DNA sample derived from a clinical sample). It was found that it can be detected simply by using.

The method using the primers and probes of the present invention can be very effective and conveniently separate and detect vancomycin-resistant enterococci in a sample.

According to an embodiment of the present invention, the amplification of the present invention is carried out according to a polymerase chain reaction (PCR). According to one embodiment of the present invention, the primers of the present invention are used for gene amplification reactions.

The term “amplification reaction” as used herein refers to a reaction to amplify a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR; U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR; Sambrook et al., Molecular Cloning.A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), multiplex PCR (McPherson and Moller, 2000), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) ; WO 88/10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence priming Consensus sequence primed polymerase chain reaction (CP-PCR; U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR; U.S. Patent Nos. 5,413,909 and 5,861,245) , Nucleic acid sequence based amplification (NASBA; U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,0 63,603), strand displacement amplification and loop-mediated isothermal amplification; LAMP), but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 09/854,317.

The term “primer” as used herein refers to an oligonucleotide, under conditions under which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerization agent such as nucleotide and DNA polymerase, and It can act as a starting point for synthesis under conditions of suitable temperature and pH. Specifically, the primer is deoxyribonucleotide and is single-chain. Primers used in the present invention may include naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primer may also include a ribonucleotide.

The primer should be long enough to prime the synthesis of the extension product in the presence of a polymerizing agent. The suitable length of a primer depends on a number of factors, such as temperature, application and source of the primer. The term “annealing” or “priming” refers to the apposition of oligodioxynucleotides or nucleic acids to a template nucleic acid, and the juxtaposition means that a polymerase polymerizes the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof. Let's do it.

PCR is the most well-known nucleic acid amplification method, and its many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction ( Inverse polymerase chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the method of the present invention is carried out using a primer, a gene amplification reaction can be performed to simultaneously detect target genes in an analysis target (e.g., a DNA sample isolated from sputum, blood, saliva or urine, which is a clinical specimen) . Therefore, the method of the present invention performs a gene amplification reaction using a primer that binds to DNA extracted from a sample.

According to one embodiment of the present invention, a sample that can be used in the method of the present invention is a clinical specimen-derived sample, and the clinical specimen includes sputum, saliva, blood, and urine, but is not limited thereto.

According to one embodiment of the present invention, the isolated DNA sample of the present invention includes a DNA sample extracted from a clinical specimen (eg, sputum, saliva, blood, or urine). Extraction of DNA from a sample can be carried out according to a conventional method known in the art (see: Sambrook, J. et al. , Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al. , Plant Mol. Biol. Rep. , 9:242 (1991); Ausubel, FM et al. , Current Protocols in Molecular Biology , John Willey & Sons (1987); And Chomczynski, P. et al. al. , Anal. Biochem. 162:156 (1987)).

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for nucleic acid hybridization suitable for forming such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization. , A Practical Approach , IRL Press, Washington, DC (1985).

Various DNA polymerases can be used for the amplification of the present invention, and include the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase that can be obtained from various bacterial species, which include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu). Includes.

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. It is desirable to provide cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to the reaction mixture to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary according to environmental variables.

The method of the present invention analyzes the amplified target gene (specifically, vancomycin resistance gene ( vanA , vanB ), enterococci ddl (D-alanine-D-alanine ligase) gene or 16S rRNA) amplified as described above to obtain vancomycin resistance. Enterococci can be detected.

For example, in the case where the method of the present invention is carried out based on an amplification reaction using DNA, (a) (i) a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and SEQ ID NO: 3 A first detection set with a probe; And at least one detection set selected from the group consisting of a second detection set consisting of a primer pair of SEQ ID NO: 7 and SEQ ID NO: 8, and a probe of SEQ ID NO: 9; And (ii) a third detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and probes of SEQ ID NO: 6; And the target nucleotide sequence in the sample using at least one detection set selected from the group consisting of a fourth detection set consisting of a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12. Amplifying; And (b) analyzing the amplification result, through which it is possible to effectively and conveniently detect or quantify vancomycin-resistant enterococci in DNA extracted from the sample.

The first detection set and the second detection set used in the method for detecting vancomycin-resistant enterococci of the present invention are used as a detection set capable of detecting the vancomycin-resistant gene, and the third detection set and the fourth detection set are isolated from clinical specimens. It is used as a detection set capable of detecting Enterococcus faecium (5-10%) and Enterococcus faecalis (90-95%) strains, which occupy most of the Enterococcus faecalis, respectively.

According to one embodiment of the present invention, the method for detecting vancomycin-resistant enterococci of the present invention includes a vancomycin-resistant gene detection set selected from the group consisting of a first detection set and a second detection set, and a third detection set and a fourth detection set. Enterococci having resistance to vancomycin can be detected by using a combination of the enterococci detection set selected from the group consisting of.

Fluorescent channels (e.g., green channels (510 ± 5 nm), yellow channels (555 ± 5 nm), orange channels (610 ± 5 nm)) and red channels suitable for the primer pairs and probes used in the combination of the detection sets (660 ± 10nm)) can also be used as a combination of detection sets.

As used herein, the term “hybridization” means that two single-stranded nucleic acids form a duplex structure by pairing complementary nucleotide sequences. Complementarity may occur in the case of a perfect match or even in the presence of some mismatch bases The degree of complementarity required for hybridization may vary depending on the conditions of the hybridization reaction, and in particular, may be controlled by temperature. There is no difference between the terms "annealing" and "hybridization" used in the present specification, and are used interchangeably in the present specification.

According to one embodiment of the present invention, the method and kit of the present invention can simultaneously detect vancomycin-resistant enterococci through multiplex real-time PCR.

Real-time PCR is a technique that monitors and analyzes the increase of PCR amplification products in real-time (Levak KJ, et al. , PCR Methods Appl. , 4(6): 357-62(1995)). The PCR reaction can be monitored by recording the amount of fluorescence emission in each cycle during the exponential phase where the increase in PCR product is proportional to the initial amount of the target template. The higher the starting copy number of the nucleic acid target, the faster the increase in fluorescence is observed and the lower the C _t value (cycle threshold) is. A distinct increase in fluorescence above the baseline measured between 3-15 cycles indicates the detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) Conventional PCR is measured in a plateau, whereas real-time PCR is performed during the exponential growth phase. Data can be obtained; (b) the increase in reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) the disassembled probe provides permanent record amplification of the amplicon; (d) an increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA is possible without separation through electrophoresis; (g) it is possible to obtain increased amplification efficiency by using a small amplicon size; And (h) the risk of contamination is low.

When the amount of PCR amplification product reaches the amount detectable by fluorescence, an amplification curve starts to occur, the signal rises exponentially, and then reaches a stagnation state. As the initial amount of DNA increases, the number of cycles to reach the detectable amount of amplification product decreases, so the amplification curve appears faster. Therefore, when a real-time PCR reaction is performed using a stepwise diluted standard sample, amplification curves arranged at equal intervals in the order of a large amount of initial DNA are obtained. Here, if a threshold is set at an appropriate point, the point C _t value at which the threshold and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. Detection methods include an interchelating method (SYBR Green I method), a method using a fluorescently labeled probe (TaqMan probe method), and the like. Since the interchelating method detects all double-stranded DNA, there is no need to prepare a probe for each gene, and a reaction system can be constructed at low cost. While the method using a fluorescently labeled probe is expensive, it has high detection specificity, so that even similar sequences can be distinguished and detected.

According to one embodiment of the present invention, the method and kit of the present invention uses the TaqMan probe method.

First, the interchelating method is a method using a double-stranded DNA binding die, and non-specific amplification and primer-dimer complexes are prepared using a non-sequence-specific fluorescent interchelating reagent (SYBR Green I or ethidium bromide). It is to quantify the production of amplicons containing. This reagent does not bind to ssDNA. SYBR Green I is a fluorescent die that binds to the minor groove of double-stranded DNA. It does not show almost fluorescence in solution, but is an interchelator that shows strong fluorescence when it binds to double-stranded DNA (Morrison TB, Biotechniques. , 24(6): 954-8, 960, 962(1998)). Therefore, since fluorescence is emitted through the binding between SYBR Green I and double-stranded DNA, the amount of amplification product produced can be measured. SYBR Green real-time PCR is accompanied by an optimization process such as melting point or dissociation curve analysis for amplicon identification. Normally, SYBR green is used for a singleplex reaction, but can be used for a multiplex reaction when accompanied by a melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8( 12): 3832-40 (2002); And Vrettou C., et al. , Hum Mutat. , Vol 23(5): 513-521 (2004)).

The C _t (cycle threshold) value refers to the number of cycles in which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the logarithm of the initial copy number. _{Therefore, the C t} value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The C _t value is the cycle in which an increase in ΔRn is first detected. Rn refers to the size of the fluorescence signal generated during PCR at each time point, and ΔRn refers to the fluorescence emission intensity (normalized reporter signal) of the reporter die divided by the fluorescence emission intensity of the reference die. The C _t value is also called Cp (crossing point) in LightCycler. The C _t value represents the point at which the system begins to detect an increase in the fluorescence signal associated with the exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

On the other hand, the TaqMan probe is typically a primer (e.g., 20-30 nucleotides) comprising a fluorophore at the 5'-end and a quencher at the 3'-end (e.g., TAMRA or non-fluorescent quencher (NFQ)). ) Is a longer oligonucleotide. Excited fluorescent material transfers energy to a nearby quencher rather than emitting fluorescence (FRET = For fluorescence resonance energy transfer; Chen, X., et al. , Proc Natl Acad Sci USA , 94(20): 10756-61( 1997)). Therefore, when the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to the internal sites of PCR products. Specifically, the TaqMan probe can be designed with an internal sequence of a 16S rRNA gene, vanA or vanB gene segment.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but fluorescence is inhibited by quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5'to 3'nuclease activity of the Taq DNA polymerase, and the fluorescent dye is released from the probe, and inhibition by the quencher is released, resulting in fluorescence. At this time, the 5'-end of the TaqMan probe should be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5'to 3'nuclease activity of this polymerase, A fluorescent signal is generated.

The reporter molecule and quencher molecule bound to the TaqMan probe include a fluorescent substance and a non-fluorescent substance. Fluorescent reporter molecules and quencher molecules that can be used in the present invention may be any known in the art, and examples thereof are as follows (the number in parentheses is the maximum emission wavelength expressed in nanometers): Cy2 ™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520) , 5-FAM (522), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568) ), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ ( 576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red 628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO ™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarboc yanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The numbers in parentheses indicate the maximum emission wavelength expressed in nanometers. According to certain embodiments of the invention, the reporter molecule and quencher molecule comprise VIC, HEX, FAM, Cy5, Cy5.5, ROX, BHQ-1, BHQ-2 and MGB-based labels.

Suitable reporter-quencher pairs are disclosed in many literatures: Pesce et al. , editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al. , FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

In addition, the non-fluorescent material used for the reporter molecule and the quencher molecule bound to the TaqMan probe may include a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" used herein refers to a TaqMan probe conjugated with an MGB at the 3'-end of the probe. MGB is a substance that binds to the minor grooves of DNA with high affinity, and it is a substance that binds to the minor grooves of DNA. (chromomycin) A3, olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenil, CC-1065, Hoechst 33258, DAPI (4'-6-diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, N-methylpyrrole-4-carbox-2-amide (MPC) and dimers, trimers, tetramers and pentamers thereof Including, but not limited to, this.

Conjugation of the probe and MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, the increased stability (ie, increased degree of hybridization) results in an increased melting temperature (Tm) of the hybrid duplex formed by the MGB-conjugate probe compared to the normal probe. Therefore, MGB stabilizes the Van der Waals force to increase the melting temperature (Tm) of the MGB-conjugate probe without increasing the probe length, thereby allowing shorter probes (e.g., 21 or less) in Taqman real-time PCR under more stringent conditions. Nucleotides).

In addition, the MGB-conjugate probe removes the background fluorescence more efficiently. According to certain embodiments of the present invention, the length of the TaqMan MGB-conjugate probe of the present invention includes, but is not limited to, 12-20 nucleotides.

According to an embodiment of the present invention, the 5'-end of the probe of the present invention is labeled with one kind of fluorescent material selected from the group consisting of VIC, HEX, FAM, Cy5, Cy5.5 and ROX, The 3'-end of the probe may be transformed into one type of quencher selected from the group consisting of BHQ-1, BHQ-2, and MGB.

According to one embodiment of the present invention, the concentration of the TaqMan MGB-conjugate probe of the present invention is 50-900 nM, more specifically 100-600 nM, even more specifically 150-400 nM, and even more More specifically, it is 200-300 nM.

The target nucleic acid used in the present invention is not particularly limited, and includes both DNA (gDNA or cDNA) or RNA molecules, and more specifically gDNA. When the target nucleic acid is an RNA molecule, it is used by reverse transcription with cDNA.

According to certain embodiments of the present invention, the target nucleic acid of the present invention comprises a nucleic acid sample derived from a clinical specimen, and more specifically, a viral nucleic acid or a viroid nucleic acid derived from a clinical specimen. A method of annealing or hybridizing a target nucleic acid to an extension primer and a probe may be performed by a hybridization method known in the art. In the present invention, suitable hybridization conditions can be determined in a series of processes by an optimization procedure. This procedure is performed as a series of procedures by a person skilled in the art to establish a protocol for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and reaction time, buffer components, and their pH and ionic strength depend on various factors such as the length of the oligonucleotide and the amount of GC and the target nucleotide sequence. Detailed conditions for hybridization are described in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. It can be found in NY (1999).

The template-dependent nucleic acid polymerase used in the present invention is an enzyme having 5'to 3'nuclease activity. The template-dependent nucleic acid polymerase used in the present invention is preferably a DNA polymerase. Typically, DNA polymerases have 5'to 3'nuclease activity. The template-dependent nucleic acid polymerase used in the present invention includes E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the template-dependent nucleic acid polymerase is a thermostable DNA polymerase obtainable from various bacterial species, which is Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , Pyrococcus furiosus ( Pfu), Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus rubens, Thermus scotoductus, Thermus thermophilus 17, Thermus species Z05, Thermus species Z05, Thermus thermophilus , Thermotoga neapolitana and Thermosipho africanus , DNA polymerase.

The "template-dependent extension reaction" catalyzed by a template-dependent nucleic acid polymerase refers to a reaction for synthesizing a nucleotide sequence complementary to the sequence of a template.

According to an embodiment of the present invention, the real-time PCR of the present invention is performed by the TaqMan probe method.

The features and advantages of the present invention are summarized as follows:

(I) The present invention relates to a method for specifically detecting vancomycin-resistant enterococci using vancomycin-resistant enterococci-specific primers and probes, and a diagnostic kit using the same.

(Ii) The method of the present invention uses target genes (specifically, vancomycin resistance genes ( vanA , vanB ), enterococci ddl (D-alanine-D-alanine ligase) genes, 16S rRNA)-specific primers and probes. Vancomycin-resistant enterococci can be selectively detected with very high efficiency through multiplex real-time polymerase chain reaction (PCR).

(Iii) In addition, the kit of the present invention can conveniently and efficiently detect target genes in a sample through multiplex real-time PCR.

(Iv) Therefore, the method and kit of the present invention can selectively and easily detect whether vancomycin-resistant enterococci are infected in a sample, and based on this, can be more accurately applied to the treatment of diseases.

1A-1E are fluorescence detection results of vancomycin-resistant enterococci detected using a primer pair and a probe of the present invention. The Y-axis represents the corrected fluorescence intensity (Norm. Fluoro.) according to the amplification cycle.
1A shows an orange channel (internal control, 16S rRNA), and when a peak is observed at Threshold: 0.04 and Ct <37, it means that DNA extraction is good and there is no PCR inhibition.
FIG. 1B shows the red channel ( vanA resistance gene), and when a peak is observed at Threshold: 0.04 and Ct<37, it is determined as positive.
Fig. 1c shows the crimson channel (Enterococcus faecium), and when a peak is observed at Threshold: 0.04 and Ct<37, it is determined as positive.
1D shows a yellow channel ( Enterococcus faecalis) , and is determined as positive when a peak is observed at Threshold: 0.04 and Ct<37.
Fig. 1e shows a green channel ( vanB resistance gene), and is determined as positive when a peak is observed at Threshold: 0.04 and Ct<37.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Experimental materials and test methods

Experimental strain

Strains 6 weeks (E.faecium ATCC 700221, E.faecalis ATCC 51299 , E. gallinarum ATCC 49573, E. casseliflavus ATCC 25788, E. faecalis ATCC 29212, E. faecium ATCC 19434) and the note 100 enterococci isolated from clinical specimens It was targeted. The target strains were selected from EA (Enterococcosel agar) containing 6 μg/mL vancomycin and EA without addition of vancomycin. An appropriate amount of black colonies grown in EA was moistened with a cotton swab and dissolved in a 1.5 mL centrifuge tube containing 0.5 mL of distilled water, and then bathed in boiling water for 10 minutes. After centrifugation at 13,000 rpm for 3 minutes, the supernatant was used.

Primer and probe fabrication

Based on sequence alignment, the present inventors searched for regions of interest and constructed primers and probes by Primer 3 program (http://frodo.wi.mit.edu/primer3/) or manually. In more detail, primers and probes were designed by analyzing the base sequence of the vancomycin resistance gene and enterococci (E.faecalis , E. faecium ) that can be obtained from the NCBI database. Real-time PCR primers and probes designed and used in this study are shown in Table 1. Each tube contains the same amount (5 pmole/μl and 2 pmole/μl) of the forward and reverse primers and probes specific to the virus.

Real-time PCR primers and probes for detection of various non-tuberculosis mycobacteria Target gene Sequence (5'→3') Target strain vanA gene Forward primer ttttgccgtttcctgtatcc - Reverse primer gttataaccgttcccgcaga Taqman probe tcctcgctcctctgctgaaa D-alanine-D-alanine ligase( ddl ) gene Forward primer tgtcaaacctgcgaatatgg Enterococcus faecium Reverse primer ttgcagctcttctcggtttt Taqman probe agtgtcggcattacaaaggcag vanB gene Forward primer tcgcattytctgagcctttt - Reverse primer gatttgattgtcggcgaagt Taqman probe ttcctgatggatgcggaaga D-alanine-D-alanine ligase( ddl ) gene Forward primer gcgaattttcaggaaaacga Enterococcus faecalis Reverse primer ccatttggcccatgtaaaac Taqman probe tgaagaagaagcgattgttttccc Bacterial 16S rRNA gene Forward primer gctacacacgtgctacaatgg Internal control Reverse primer aaggcccgggaacgtatt Taqman probe tgaagtcggaatcgctagtaatcg or tgaagctggaatcgctagtaatcg

Multiplex real-time PCR

Multiple real-time polymerase chain reaction was performed using a Rotor-Gene multiplex PCR Kit (QIAGEN Inc., Germantown, MD, USA). For multiple real-time polymerase chain reactions, Rotor-Gene Q (QIAGEN Inc., USA) was used. 40 cycles were performed with 1 cycle of the denaturation process at about 95°C for about 5 minutes, denaturation at about 95°C for about 15 seconds, annealing and extension processes at about 63°C for about 15 seconds as 1 cycle. At this time, the composition of the reactants for performing the multiple real-time polymerase chain reaction are shown in Table 2 below. In the following primer-probe mix, the forward and reverse primers for detecting the target gene and the internal control target gene were each contained in the same amount (10 pmole/µl), and the probe contained 4 pmole/µl, respectively. Therefore, 1.25 μl of the primer-probe mix used in the reaction contained 12.5 pmoles of the forward and reverse primers and 5 pmoles of the probe. Since the total volume of the reaction product performing the polymerization chain reaction of 25 µl was 25 µl, the concentration of the primer was 0.5 µM (12.5 pmoles/25 µl) and 0.2 µM (5 pmoles/25 µl) for the probe was used.

Composition and concentration of polymerization chain reactants ingredient Volume (µl) density 2X Rotor-Gene Multiplex PCR Master Mix 12.5 1X Primer-probe mixture Primer (10 pmole/µl) 1.25 0.5 μM Probe (4 pmole/µl) 0.2 μM Nuclease-deficient water 6.25 - Sample DNA template 5 - all 25 -

Fluorescence generated by the probe in the binding and extension steps during the multiple real-time polymerase chain reaction was measured by Rotor-Gene Q (QIAGEN Inc., USA). The multiple real-time polymerase chain reaction method is a method of detecting and quantifying fluorescence performed in real time every cycle of the real-time polymerase chain reaction by the principle of DNA polymerase and fluorescence resonance energy transfer (FRET). . ^{When FAM TM} is colored on a real-time monitor, the green channel (510±5nm), when HEX ^TM is colored, the yellow channel (555±5nm), when Cy5 ^TM is colored, the red channel (660±10nm), and ROX ^TM are colored. In the case of orange channel (610±5nm), when Cy5.5 ^TM was colored, it was designated to be displayed in the crimson channel (712 log pass). Fluorescence was observed in the green channel, yellow channel, orange channel, red channel, and crimson channel.

Experiment result

In each tube, the threshold value of the crimson channel is set to 0.04, and the threshold value of the remaining channels is set to 0.03, and then the C _t value is checked. If a _{peak is observed at Ct} value <36, it is read as positive.

Real-time PCR using a primer pair and a probe for the vancomycin resistance gene and Enterococcus faecium, Enterococcus faecalis specifically identified the target in the corresponding fluorescence channel (reference: FIGS. 1a to 1e).

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Hyunil-bio Co. <120> Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same <130> PN140117 <160> 16 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanA gene forward primer <400> 1 ttttgccgtt tcctgtatcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanA gene reverse primer <400> 2 gttataaccg ttcccgcaga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanA gene probe <400> 3 tcctcgctcc tctgctgaaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium ddl gene forward primer <400> 4 tgtcaaacct gcgaatatgg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium ddl gene reverse primer <400> 5 ttgcagctct tctcggtttt 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecium ddl gene probe <400> 6 agtgtcggca ttacaaaggc ag 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanB gene forward primer <400> 7 tcgcattytc tgagcctttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanB gene reverse primer <400> 8 gatttgattg tcggcgaagt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vanB gene probe <400> 9 ttcctgatgg atgcggaaga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecalis ddl gene forward primer <400> 10 gcgaattttc aggaaaacga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecalis ddl gene reverse primer <400> 11 ccatttggcc catgtaaaac 20 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Enterococcus faecalis ddl gene probe <400> 12 tgaagaagaa gcgattgttt tccc 24 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Internal control forward primer <400> 13 gctacacacg tgctacaatg g 21 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Internal control reverse primer <400> 14 aaggcccggg aacgtatt 18 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Internal control probe 1 <400> 15 tgaagtcgga atcgctagta atcg 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Internal control probe2 <400> 16 tgaagctgga atcgctagta atcg 24

Claims (9)

A method for detecting vancomycin-resistant enterococci comprising the steps of:
(a) preparing an isolated DNA sample;
(b) a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, and a fourth detection set consisting of a probe of SEQ ID NO: 12 and a primer pair of SEQ ID NO: 13 and SEQ ID NO: 14, Amplifying a target nucleotide sequence in the sample using a target nucleotide sequence and an internal control nucleotide sequence in the sample using an internal control detection set consisting of a probe selected from the group consisting of a list 15 sequence and a sequence selected from the group consisting of SEQ ID No. 16; And
(c) analyzing the amplification result.
The method according to claim 1, wherein the DNA sample of step (a) is a DNA sample derived from sputum, blood, saliva or urine.
delete The method according to claim 1, wherein the amplification in step (b) is performed according to a polymerase chain reaction (PCR).
The method according to claim 1, wherein the probe is bound to a label, and the analysis of the amplification result in step (c) is performed by detecting a signal generated from the probe.
2. The method of claim 1, wherein the amplification in step (b) is performed according to a real-time PCR.
7. The method of claim 6, wherein the real-time PCR is performed by a TaqMan probe method.
The method according to claim 1, wherein in the detection set of step (b), the 5'-end of the probe is labeled with one kind of fluorophore selected from the group consisting of HEX, FAM, Cy5, Cy5.5 and ROX And the 3'-end of the probe can be transformed into one kind of quencher selected from the group consisting of BHQ-1 and BHQ-2.
(I) a fourth detection set consisting of a pair of primers of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12; And (iii) an inner control detection set consisting of a primer pair of SEQ ID NO: 13 and SEQ ID NO: 14, and a probe selected from the group consisting of a sequence of SEQ ID NO: 15 and SEQ ID NO: Enterococcus detection kit.

Images