KR102114469B1 - Kits for Detecting Pathogens of Sexually Transmitted Infections - Google Patents

Abstract

The present invention provides a kit and method for detecting a protozoan infectious agent. The kit and method of the present invention have excellent sensitivity to detect up to 1-10 copies of a sexually transmitted infectious agent, and are compatible with gene amplification equipment. The kit and method of the present invention can simultaneously detect various sexually transmitted infectious agents in one PCR reaction, and have high sensitivity and specificity.

Description

Kit for Detecting Pathogens of Sexually Transmitted Infections}

The present invention relates to a kit for the detection of a protozoan infectious agent.

Sexually Transmitted Infections (STI) or Sexually Transmitted Diseases (STD) is a disease that spreads through sexual contact. Sexually transmitted diseases are so common that more than 50% of all adults are infected more than once in their lifetime, and are mediated by pathogen infections such as bacteria, viruses, and fungi. The typical sexually transmitted diseases transmitted by bacteria include syphilis, gonorrhea, chancroid, chlamydial infection, and nonnonorrhea urethritis. Genital herpes and Condyloma acuminata (genital warts or cough).

Existing sexually transmitted disease diagnosis methods include smearing of secretions from affected areas such as the rectum, urethra, and oral cavity, and performing tests using Gram staining or bacterial culture. In the case of the Gram staining method, a quick result can be obtained, but the accuracy is poor, and in the case of the bacterial culture method, it is more accurate than the Gram staining method. Another test method is an antibody test by an infectious bacterium, but there is a disadvantage in that the difference in accuracy according to the characteristics of the antibody is large. In addition, all of the above test methods have a limitation in that they can be detected only for a single pathogen and cannot detect multiple pathogens simultaneously. Therefore, there is a need for a new test method that can test two or more pathogens simultaneously, more quickly and accurately.

Republic of Korea Registered Patent No. 10-0639783 Republic of Korea Patent Publication No. 10-2013-0107881

 Thomas Meyer. Diagnostic Procedures to Detect Chlamydia trachomatis Infections. Microorganisms 2016 Sep; 4 (3): 25  Bhalla P. Simultaneous detection of Neisseria gonorrhoeae and Chlamydia trachomatis by PCR in genitourinary specimens from men and women attending an STD clinic. J Commun Dis. 2007 Mar; 39 (1): 1-6.

The present inventors have made extensive research efforts to develop a detection kit capable of simultaneously or alone detecting a sexually transmitted infectious agent. As a result, the present invention was completed by developing a detection kit capable of simultaneously detecting various sexually transmitted infectious agents in a single PCR reaction using a rapid and highly sensitive polymerase chain reaction (PCR). .

Accordingly, it is an object of the present invention to provide a kit for detecting a sexually transmitted agent.

Another object of the present invention is to provide a method for detecting a sexually transmitted infectious agent.

According to an aspect of the present invention, the present invention is a set for detecting Chlamydia trachomatis comprising (i) a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2;

(ii) a set for detecting gonococci ( Neisseria gonorrhoeae ) comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 4 and 5;

(iii) a set for detecting gonococci comprising primer pairs consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8;

(iv) Mycoplasma hominis detection set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 10 and 11;

(v) Trichomonas vaginalis detection set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 16 and 17;

(vi) Ureaplasma urealyticum detection set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 19 and 20; And

(vii) Mycoplasma genitalium detection set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 22 and 23; or

(viii) A kit for simultaneous detection of a sexually transmitted infectious agent comprising a combination thereof is provided.

The present inventors made extensive efforts to develop a detection kit capable of qualitatively or simultaneously detecting a sexually transmitted infectious agent. As a result, we developed a detection kit that can simultaneously detect various sexually transmitted infectious agents in a single PCR reaction using a polymerase chain reaction (PCR) that is fast and highly sensitive.

The kit for detecting the agent for sexually transmitted infections of the present invention detects Chlamydia trachomatis, gonococcus, Mycoplasma hominis, Trichomonas vaginalis, Ureaplasma urearicum and Mycoplasma genitalium through gene amplification using primers and probes. .

The term “primer” as used herein refers to conditions under which synthesis of primer extension products complementary to the nucleic acid strand (template) is induced, ie in the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, and a suitable temperature. And an oligonucleotide that can act as a starting point for synthesis at pH.

According to one embodiment of the present invention, the set for detection of (i) to (vii) further includes the following probes:

The (i) Chlamydia trachomatis detection set includes a probe consisting of the nucleotide sequence of SEQ ID NO: 3;

The set of (ii) gonococcus detection comprises a probe consisting of the nucleotide sequence of SEQ ID NO: 6;

The (iii) gonococcus detection set includes a probe consisting of the nucleotide sequence of SEQ ID NO: 9;

The (iv) Mycoplasma hominis detection set includes a probe consisting of the nucleotide sequence of SEQ ID NO: 12;

The set for detecting (v) trichomonas vaginalis comprises: a probe consisting of the nucleotide sequence of SEQ ID NO: 18;

The set for detecting ureaplasma (vi) ureaplasma comprises: a probe consisting of the nucleotide sequence of SEQ ID NO: 21; or

The (vii) Mycoplasma genitalium detection set is a probe consisting of the nucleotide sequence of SEQ ID NO: 24.

The kit for detecting the infectious agent for sexually transmitted infections of the present invention has a strain having only one detection site among two detection sites of Por A gene or Cryptic plasmid DNA in the case of gonorrhea group among the desired strains, so that the coverage and stable sensitivity For this purpose, two genes were employed to construct a kit.

The term “probe” as used herein refers to a single-stranded nucleic acid molecule comprising a site or sites that are substantially complementary to a target nucleic acid sequence. The “target nucleic acid”, “target nucleic acid sequence” or “target” Sequence "means the nucleic acid sequence to be detected and is annealed or hybridized with a primer or probe under hybridization, annealing, or amplification conditions.

Preferably, the probe and primer are single-stranded deoxyribonucleotide molecules. Probes or primers used in the present invention may include naturally occurring dNMPs (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. Further, the probe or primer may include ribonucleotides.

The primer should be long enough to prime the synthesis of the extension product in the presence of a polymerization agent. The exact length of the primer will depend on a number of factors including, for example, temperature, application area and source of the primer. As used herein, the term “annealing” or “priming” refers to an oligodeoxynucleotide or nucleic acid apposition to a template nucleic acid, and the juxtaposition complements the template nucleic acid or a portion thereof by polymerizing a nucleotide. Nucleic acid molecules.

The primer used in the present invention is hybridized or annealed to one site of the template to form a double chain structure. Conditions for nucleic acid hybridization suitable for forming such a double chain structure include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization. , A Practical Approach, IRL Press, Washington, DC (1985).

As used herein, the term “hybridization” means that complementary single-stranded nucleic acids form double-stranded nucleic acids. Hybridization can occur between two nucleic acid strands that are either completely matched or substantially matched in some mismatch. Complementarity for hybridization can vary depending on hybridization conditions, particularly temperature. The terms "annealing" and "hybridization" as used herein are not different and are used interchangeably herein.

According to one embodiment of the invention, the kit of the invention is implemented by gene amplification.

According to another embodiment of the present invention, the gene amplification is carried out by a polymerase chain reaction (PCR) method.

The kit of the present invention simultaneously detects Chlamydia trachomatis, gonococcus, Mycoplasma hominis, Trichomoniasis, ureaplasma urearicum, and Mycoplasma genitalium through the polymerase chain reaction method using the primers and probes simultaneously (multiplex detection or multiplexing detection).

The "multiplex detection" or "multiplexing detection" means simultaneously detecting a plurality of target nucleic acid sequences in a reaction vessel (eg, reaction tube).

The polymerase chain reaction (PCR) is the most well-known nucleic acid amplification method, and many modifications and applications have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction Chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and multiplex PCR have been developed for specific applications. For more information on PCR, see McPherson, M.J., and Moller, S.G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

As used herein, the term "multiplex PCR (multiplex PCR)" means that a plurality of targets are simultaneously amplified by a polymerase chain reaction in a reaction vessel.

A variety of DNA polymerases may be used as the polymerase chain reaction, and include a 'Klenow' fragment of E. coli DNA polymerase I, a heat stable DNA polymerase, and a bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase obtained from various bacterial species, which includes Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu). Includes.

According to one embodiment of the invention, the kit of the invention comprises Taq DNA polymerase or Pfu DNA polymerase.

According to another embodiment of the invention, the kit of the invention comprises Taq DNA polymerase.

The kit of the present invention may additionally include deoxyuridine triphosphate (dUTP) and Uracil DNA Glycosilase (UDG) to block carryover or crossover contamination by the polymerase chain reaction product. UDG recognizes and cuts the uracil contained in the DNA template strand of the previous amplification product, and the cut DNA template strand no longer acts as a template strand, so that no amplification reaction occurs. The present invention improves the accuracy of inspection by using dUTP and UDG to block the generation of amplification products by contamination of the previous amplification products, excluding false positive results due to laboratory contamination of the previous amplification products.

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel in excess of the components necessary for the reaction. The excess amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. It is desired to provide a reaction mixture such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to the reaction mixture to the extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers ensure that all enzymes are close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that enable specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary depending on ambient environmental variables.

The kit of the present invention is a real-time polymerase chain reaction method.

The real-time PCR is a technique for monitoring and analyzing the increase in PCR amplification products in real time (Levak KJ, et al. , PCR Methods Appl. , 4 (6): 357-62 (1995)). PCR reactions can be monitored by recording the amount of fluorescence emitted in each cycle during an exponential phase where the increase in PCR product is proportional to the initial amount of the target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the Ct value (cycle threshold). A marked increase in fluorescence above the reference value measured between 3-15 cycles means detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) Conventional PCR is measured in a plateau, while real-time PCR can obtain data during the exponential growth phase. have; (b) the increase in reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) the disassembled probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires 1,000 times less nucleic acids than conventional PCR methods; (f) detection of amplified DNA without separation through electrophoresis is possible; (g) increased amplification efficiency can be obtained using a small amplicon size; And (h) little risk of contamination.

When the amount of PCR amplification product reaches an amount detectable by fluorescence, an amplification curve starts to occur, and the signal rises exponentially and then reaches a plateau. The larger the initial DNA content, the faster the amplification curve appears because the number of cycles that reach the detectable amount of amplification product decreases. Therefore, if a real-time PCR reaction is performed using a standard sample diluted in stages, an amplification curve lined up at equal intervals in the order in which the initial DNA amount is large is obtained. Here, if a threshold is set at an appropriate point, a point Ct value at which the threshold and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection method is largely an interchelating method (SYBR Green I method), a method using a fluorescently labeled probe (TaqMan probe method), and the like. Since the interchelating method detects all double-stranded DNA, it is not necessary to prepare a probe for each gene, so that a reaction system can be constructed at low cost. While the method using a fluorescently labeled probe is expensive, the detection specificity is high, and even similar sequences can be distinguished and detected. According to certain embodiments of the present invention, the kit of the present invention utilizes the TaqMan probe method.

First, the interchelating method is a method using a double-stranded DNA binding die, and amplicon production including a non-specific amplification and primer-dimer complex using a non-sequence specific fluorescent intercalating reagent (SYBR Green I or ethidium bromide) Is to quantify. The reagent does not bind to ssDNA. SYBR Green I is a fluorescent die that binds to the minor groove of double-stranded DNA and is a reagent that shows little fluorescence in solution, but shows strong fluorescence when combined with double-stranded DNA (Morrison TB, Biotechniques ,. 24 (6): 954-8, 960, 962 (1998)). Therefore, since fluorescence is emitted through the binding between SYBR Green I and double-stranded DNA, the amount of amplification products can be measured. SYBR green real-time PCR is accompanied by an optimization process such as melting point or dissociation curve analysis for amplicon identification. Normally SYBR green is used for singleplex reactions, but can be used for multiplex reactions when accompanied by a melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8 ( 12): 3832-40 (2002); and Vrettou C., et al. , Hum Mutat. , Vol 23 (5): 513-521 (2004)).

The cycle threshold (Ct) value means the number of cycles in which the fluorescence generated in the reaction exceeds a threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The Ct value is the cycle in which the increase in ΔRn was first detected. Rn represents the magnitude of the fluorescence signal generated during PCR at each time point, and ΔRn represents the fluorescence emission intensity (standardized reporter signal) of the reporter die divided by the fluorescence emission intensity of the reference die. The Ct value is also referred to as a crossing point (Cp) in LightCycler. The Ct value represents the point in time at which the system begins to detect an increase in the fluorescence signal associated with the exponential growth of the PCR product in a log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (www.appliedbiosystems.co.kr/).

On the other hand, TaqMan probes typically include primers (e.g., 20-30 nucleotides) that include a 5'-end fluorophore and a 3'-end quencher (e.g., TAMRA or non-fluorescent quencher (NFQ)). ) Longer oligonucleotides. Excited phosphors transfer energy to nearby quenchers rather than fluorescence (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al. , Proc Natl Acad Sci USA , 94 (20): 10756-61 (1997)). Therefore, when the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to the inner part of the PCR product. For example, the TaqMan probe can be designed as an internal sequence of a cryptic plasmid DNA gene fragment amplified by SEQ ID NOs: 1 and 2.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but fluorescence is inhibited by quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5 'to 3' nuclease activity of the Taq DNA polymerase, and the fluorescent dye is released from the probe, and inhibition by the quencher is released, indicating fluorescence. At this time, the 5'-end of the TaqMan probe should be located downstream of the 3'-end of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5 'to 3' nuclease activity of this polymerase cuts the 5'-end of the TaqMan probe, thereby Fluorescence signal is generated.

The reporter molecule and the quencher molecule bound to the TaqMan probe include fluorescent and non-fluorescent materials.

The fluorescent reporter molecule and the quencher molecule that can be used in the present invention can use any of those known in the art, and examples thereof are as follows (the number in parentheses is the maximum emission wavelength in nanometers): Cy2 ^TM 506, YOPRO ^TM -1 (509), YOYO ^TM -1 (509), Calcein (517), FITC (518), FluorX ^TM (519), Alexa ^TM (520), rhodamine 110 (520), 5 -FAM (522), Oregon Green ^TM 500 (522), Oregon Green ^TM 488 (524), RiboGreen ^TM (525), RhodamineGreen ^TM (527), Rhodamine 123 (529), Magnesium Green ^TM (531), Calcium Green ^TM (533), TO-PRO ^TM -1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3 ^TM (570), Alexa ^TM 546 (570), TRITC (572), Magnesium Orange ^TM (575), Phycoerythrin R & B (575), Rhodamine Phalloidin (575), Calcium Orange ^TM (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ^TM (590), Cy3.5 ^TM (596), ROX (608), Calcium Crimson ^TM (615), Alexa ^TM 594 (615), Texas Red (615), Nile Red (628), YO-PRO ^TM -3 (631), YOYO ^TM -3 (631), R-phycocyanin (642), CPhycocyanin (648), TO-PRO ^TM -3 (660) ), TOTO3 (660), DiD DilC (5) (665), Cy5 ^TM (67 0), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546), BHQ-1 (534), BHQ-2 (579), BHQ-3 (672) , BiosearchBlue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL FluorRed 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum wavelength of light emitted in nanometers.

Suitable reporter-quencher pairs have been described in many documents: Pesce et al., Editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, R. P., HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; U.S. Pat. Nos. 3,996,345 and 4,351,760.

According to one embodiment of the invention, the 5'-end of the nucleotide sequence of SEQ ID NO: 3, 6, 9, 12, 18, 21, and 24 is FAM, TET, HEX, JOE, ROX, TMR, Cy5 and Cal It is labeled with one fluorophore selected from the group consisting of Red 610, and the 3'-terminus is modified with a quencher of BHQ-1, BHQ-2 or BHQ-3.

According to another embodiment of the present invention, SEQ ID NOs: 6, 9 and 18 of the present invention use FHQ as a 5'-terminal fluorescent material and BHQ1 as a 3'-terminal quencher, and SEQ ID NOs: 3 and 21 of the present invention Silver is a 5'-terminal fluorescent substance using JOE and 3'-terminal quencher using BHQ1, and SEQ ID NOs: 12 and 21 of the present invention are 5'-terminal fluorescent substance JOE, 3'-terminal quencher BHQ1 , SEQ ID NOs: 12 and 24 of the present invention are 5'-terminal fluorescent materials, and Cy5 and 3'-terminal quenchers are used, BHQ3, and SEQ ID NO: 15 of the present invention is 5'-terminal fluorescent materials. BHQ2 is used as the Cal Red 610 and 3'-end quencher.

The kit for detecting the agent for sexually transmitted infections of the present invention may additionally include a PCR control set for confirming whether the polymerase chain reaction is normally performed.

According to one embodiment of the present invention, the kit may further include a PCR control set comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and 14 and a probe consisting of the nucleotide sequence of SEQ ID NO: 15.

According to another aspect of the present invention, the present invention provides a method of detecting a sexually transmitted infectious agent comprising the following steps:

(A) preparing the DNA of the biological sample isolated from the object;

(b) (i) a set for detecting Chlamydia trachomatis comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe consisting of the nucleotide sequence of SEQ ID NO: 3;

(ii) a set for detecting gonococci, comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 4 and 5 and a probe consisting of the nucleotide sequence of SEQ ID NO: 6;

(iii) a set for detecting gonococci comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequence of SEQ ID NO: 9;

(iv) a set for detecting Mycoplasma hominis comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 10 and 11 and a probe consisting of the nucleotide sequence of SEQ ID NO: 12;

(v) a kit for detection of trichomonas trichophyta comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 16 and 17 and a probe consisting of the nucleotide sequence of SEQ ID NO: 18;

(vi) a ureaplasma ureathicum detection set comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 19 and 20 and a probe consisting of the nucleotide sequence of SEQ ID NO: 21; And

(vii) a set for detection of Mycoplasma genitalium comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 22 and 23 and a probe consisting of the nucleotide sequence of SEQ ID NO: 24; or

(viii) amplifying a target nucleotide sequence in the biological sample using a combination thereof; And

(c) confirming the amplification result.

The term "biological sample" herein is a DNA sample isolated from urine, tissue, biopsy specimens, body fluids, blood or feces.

According to one embodiment of the invention, the biological sample is urine, blood, saliva, urinary secretions, blisters (vesicle) and body fluids in the blisters (e.g. lymph, serum, plasma, blood or pus), ulcers, warts ( wart), mucus (mucous membranes of the mucous membranes, such as the genital organs, pharynx, rectum), or DNA samples separated from tissues. For example, the tissue is vaginal, cervical, and urethral mucosal tissue.

The biological sample may be collected using a 'cotton based sample' or a 'urine based sample' method.

The 'cotton swab-based sample' is a genital smear sample, and in the case of a female, the sterilized swab is absorbed by using a plantain and rotating the wall surface at a depth of about 1.5 cm in the cervix for about 10 seconds. In men, it is collected using urinary discharge or a cotton swab from 2-3 cm deep.

The 'urine based sample' collects 10-30 ml of the first urine in a clean container.

The present invention performs a gene amplification reaction using primers and probes that bind to DNA extracted from biological samples.

Extraction of DNA from a sample can be performed according to conventional methods known in the art (Sambrook, J. et al. , Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al. , Plant Mol. Biol. Rep. , 9: 242 (1991); Ausubel, FM et al. , Current Protocols in Molecular Biology , John Willey & Sons (1987); and Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)).

Since the method of the present invention uses the kit for detection of the agent for sexually transmitted infections, descriptions common to the two are omitted to avoid excessive complexity of the present specification.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a kit and method for detecting the agent for sexually transmitted infections.

(b) The kit and method of the present invention have excellent sensitivity to detect up to 1-10 copies of a sexually transmitted infectious agent, and are compatible with gene amplification equipment.

(c) The kit and method of the present invention can simultaneously detect various sexually transmitted infectious agents in one PCR reaction, and have high sensitivity and specificity.

1 shows real-time PCR results of primer and probe Set I.
2 shows real-time PCR results of primer and probe Set II.

Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Throughout this specification, "%" used to indicate the concentration of a specific substance, unless otherwise specified, solids / solids (weight / weight)%, solids / liquids (weight / volume)%, and The liquid / liquid is (volume / volume)%.

Example

1) Preparation of the causative agent of sexually transmitted diseases

In order to prove the effectiveness of this development product, the kit for detecting the agent for sexually transmitted infections, six target causative agents to be used in the experiment were pre-saled and used from the American Type Culture Collection (ATCC). Target genes of each causative agent were selected for the detection of the target causative agents, Chlamydia trachomatis, gonococcus, Mycoplasma hominis, Trichomonas vaginalis, Ureaplasma ureariticum, and Mycoplasma genitalium.

Target causative Causative Subtype Cat # Target gene Chlamydia trachomatis
( Chlamydia trachomatis , CT) Trachoma type J strain UW-36 / Cx # VR-886 Cryptic plasmid DNA Gonorrhea
( Neisseria gonorrhoeae , NG) - # 49226 Por A Cryptic plasmid DNA Mycoplasma Hominis
( Mycoplasma hominis , MH) Strain PG21 # 23114D GAP Vaginal flagella
( Trichomonas vaginalis , TV) Strain C-1: NIH # 30001D BtuB Ureaplasma Ureatricum
( Ureaplasma urealyticum , UU) - # 27819 UreG-D Mycoplasma Genitalium
( Mycoplasma genitalium , MG) Strain G37 # 33530D gyrA

2) Primer design for detection of target causative agent

The primers and fluorescently labeled probes were designed by dividing six types of sexually transmitted infectious agents into two sets of three types (Set I & II) and designed to detect genes derived from plants (spinach, Spinacia) as PCR controls. Table 2 below is the primer and probe mixture of Set I, and Table 3 is the primer and probe mixture of Set II.

Causative Target gene Primer name Sequence (5 '-> 3') TM
(℃) GC
(%) Mer Sequence number CT Cryptic plasmid DNA CT-1 F GGACCAGCAAATAATCCTTGGG 66 50 32 One CT-1 R TAAGCTTTTTCCGCATCCAAACC 66 43 23 2 CT probe JOE-ATCAACACCTGTCGCAGCCAAAATGACA-BHQ1 82 46 28 3 NG Por A NG F CTGCTACTTTCACGCTGGAAAG 66 50 22 4 NG R TCTGCCGAGCAAGAACAAAAAG 64 45 22 5 NG probe FAM-ATCATGCCCCTCATTGGCGTGTTTCG-BHQ1 80 53 26 6 Cryptic plasmid DNA NG-Cry F CGCACAAAAACGTGTTGGCGTT 66 50 22 7 NG-Cry R GTTAGCGATTGATTTGGAGATAC 64 39 23 8 NG-Cry probe FAM-TTCTTTTTCCCACATCGGGACAGGGAAAT-BHQ1 84 44 29 9 MH GAP MH-2 F TTATCAGGCGCTTCATGTACTAC 66 43 23 10 MH-2 R CTTTGGTCTGCTGTATATGAGTG 66 43 23 11 MH-2 probe CY5-CAATACGTTGGCAATAGGAGCTAAACAG-BHQ3 80 42 28 12 PCR control Spinacia psbA S_301_PCRC F CGAATACACCAGCTACACCTAA 64 45 22 13 S_301_PCRC R TACAATGGTGGTCCTTATGAACT 64 39 23 14 S_301_PCRC probe Cal Flour Red 610-GTGAAATGGGTGCATAAGGATGTTGT-BHQ2 74 42 26 15

Causative Target gene Primer name Sequence (5 '-> 3') TM
(℃) GC
(%) Mer Sequence number TV BtuB TV F CCGATCTTCAGCTCGAGCGC 66 65 20 16 TV R GCGGAAAAGCTGACCGAACTG 66 57 21 17 TV probe FAM-AGCCACAGGCGGCAAGTACGTCCCA-BHQ1 82 64 25 18 UU UreG-D UU F AGTAATCGCTGCCATGCTATAC 64 45 22 19 UU / P R GACCATTAATTATTGGTGTAGGTG 66 37 24 20 UU probe JOE-CAATTAACATTGTCTTTCCAGCACCAACAG-BHQ1 84 40 30 21 MG gyrA MG F ATGGCAATATATGACACCATGTCA 66 37 24 22 MG R TATCTTTTAAAAGTTCTGCTGCAAG 66 32 25 23 MG probe CY5-GTTGTGCAGCAGGTCTATCACCATCTAT-BHQ3 82 46 28 24 PCR control Spinacia psbA S_301_PCRC F CGAATACACCAGCTACACCTAA 64 45 22 13 S_301_PCRC R TACAATGGTGGTCCTTATGAACT 64 39 23 14 S_301_PCRC probe Cal Flour Red 610-GTGAAATGGGTGCATAAGGATGTTGT-BHQ2 74 42 26 15

3) Preparation of real-time PCR mixture

The frozen reagent was used after centrifugation after melting at room temperature. Next, reagents were added in order to prepare a mixed solution.

ingredient Volume (μl) 2 × Multiplex Real-Time PCR Smart mix (with UDG) (STI 6)
(EQD95-M10h, Leewon Life Science Institute) Taq-polymerase, dNTP, 10X buffer and other mixtures 10 Primer & Probe Mixture I or II (STI 6) (EQD95-B500 (OM-Ⅰ and OM-Ⅱ), Wonwon Life Science Institute) Oligonucleotide, Modified oligonucleotide mixture 5 DNA template samples 5 Total reaction volume 20

4) Real-time PCR conditions

Real-time PCR was performed under the following conditions.

No. step Temperature (℃) time cycle One UDG reaction 50 3 minutes One 2 Initial PCR activation 95 15 minutes One 3 denaturalization 95 20 seconds 45 4 Annealing 60 40 seconds

5) Real-time PCR results

1 and 2 show the real-time PCR results of Set I and II, respectively. Fluorescence tagged to the probe (FAM, NG and TV; JOE, CT and UU; Cy5, MH and MG; Cal Red 610, PCR control) is specified differently for each sexually transmitted infectious agent. Chlamydia trachomatis, gonococcus, mycoplasma hominis, trichomonas vaginalis, ureaplasma urearicum, and mycoplasma genitalium, respectively, were confirmed to exist.

In the real-time PCR result, when the Ct (threshold cycle) value of the amplification curve was 43 or more, it was determined that there was no significance, and the threshold was designated as 50,000.

6) Analytical sensitivity

ABI's Real-Time using genomic DNA, primers and probes from Chlamydia trachomatis, gonococcus, Mycoplasma hominis, Trichomonas vaginalis, Ureaplasma urearicum and Mycoplasma Genitalium purchased from ATCC, USA Analytical sensitivity (limit of detection, LOD) was confirmed by PCR thermo cycler (Applied Biosystems 7500 Real-Time PCR Instrument System). Plasmid DNA of CT, NG, MH, TV, UU, and MG was diluted from 10 ⁵ copies to 10 ⁰ copies of 1/10 each, and 3 lot and 4 repetition experiments were performed by substrate (urine and swab) 1008 reactions / 3 Lot).

Analytical sensitivity Remark Specimen matrix Urine or swab sample - Target causative Chlamydia trachomatis, gonococcus, mycoplasma hominis, trichomonas vaginalis, ureaplasma urearicum and mycoplasma genitalium - DNA template dilution step NTC (No Template Control), 10 ⁰ , 10 ¹ , 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ - Lots required 3 Lot - Repeat settings 3 Lot, 2 kinds of equipment, 4 repetitions, separate experiment for each substrate 24 repetitions × 2 Required number of reactions 336 reactions / Lot -

The analytical sensitivity results are shown in Table 7:

Target causative LOD (copies / rxn) Chlamydia trachomatis One Gonorrhea One Mycoplasma Hominis 10 Vaginal flagella 10 Ureaplasma Ureatricum 10 Mycoplasma Genitalium 10

As a result, Chlamydia trachomatis and gonococcus showed a limit of detection (LOD) of 1 copy, and Mycoplasma hominis, Trichomonas vaginalis, Ureaplasma ureariticum and Mycoplasma genitalium showed 10 copies of LOD.

7) Analytical specificity

Chromadia trachomatis, gonococcus, mycoplasma hominis, trichomoniasis, ureaplasma ureariccum and mycoplasma genitalium, six human sexually transmitted infectious agents, and human gDNA (KCTC HC18802), Escherichia coli ( Escherichia coli ) gDNA (KCTC-2593 and KCTC-1682), Herpes simplex virus 1 (ATCC-VR-260D), Herpes simplex virus 2 ( Herpes simplex virus 2 , ATCC-VR-734D), Gardnerella Bottoms day lease (Gardnerella vaginalis, ATCC-49145D- 5), syphilis (Treponema pallidum, ATCC-BAA- 2642SD), Candida albicans (Candida albicans, KCTC-17712 and KCTC-7678) and chancroid bacteria (Haemophilus ducreyi, ACTT-51620) was confirmed to produce specific and non-specific products in six different bacteria. '○' in Table 8 means 'a specific product is generated', and 'x' means 'a specific product is not generated'.

No. Specimen result Set Ⅰ Set Ⅱ One Chlamydia trachomatis ○ × 2 Gonorrhea ○ × 3 Mycoplasma Hominis ○ × 4 Vaginal flagella × ○ 5 Ureaplasma Ureatricum × ○ 6 Mycoplasma Genitalium × ○ 7 Human gDNA × × 8 E. coli gDNA × × 9 Herpes virus 1 × × 10 Herpes virus 2 × × 11 Gardnerella Trousers × × 12 Syphilis × × 13 Candida Albicans × × 14 Ductile fungus × ×

The analytical specificity selected a strain that is not the target strain among microorganisms that can cause sexually transmitted infections and can be derived from the target sample (swab, urine) and was not detected within the detection cut off.

In addition, the effects on 9 kinds of interfering substances, such as mucus and blood, which may be included in the clinical sample, were confirmed.

No. Interference Interference Concentration Set I
Interference effect Set II
Interference effect One Collagen Vaginal smear (tissue, gel) 44 ng × × 2 Urea Pee 0.04% × × 3 Hemoglobin Vaginal smear (blood) urine (blood) 2.5 μg × × 4 Lactoferrin Vaginal smear (mucus) 25 ng × × 5 Immunoglobulin G (IgG) Vaginal smear (blood-hormone)
Urine (blood-hormone) 0.41 μg × × 6 Mucin Vaginal smear (mucus) 1 μg × × 7 BSA Vaginal smear (organization) 5% × × 8 Glucose Pee 0.12% × × 9 Bilirubin Urine (hemoglobin) 20 μM × ×

The Ct value between the control and the target was influenced by the influence of the 9 kinds of interfering substances. As a result of the test, the PCR interference effect by the interfering substances was missing or not as shown in Table 10 below.

No. Interference Conc. Matrix Set I
Set II Target - 1 repetition 2 repetitions 3 repetitions
Target - 1 repetition 2 repetitions 3 repetitions One Control 0 Swab CT C _T 33.6 33.6 33.1
TV C _T 37.6 37.4 36.7 NG C _T 34.8 34.3 34.8
UU C _T 36.8 35.4 37.0 MH C _T 39.0 36.5 37.1
MG C _T 36.9 36.5 37.0 Urine CT C _T 33.5 32.7 33.4
TV C _T 37.1 39.4 39.4 NG C _T 34.9 34.8 35.6
UU C _T 36.5 36.3 35.7 MH C _T 35.9 36.0 35.7
MG C _T 37.4 36.2 36.4 2 Collagen 40ng Swab CT C _T 34.2 33.1 34.3
TV C _T 37.8 36.2 39.0 NG C _T 35.8 32.9 36.3
UU C _T 37.0 36.7 37.7 MH C _T 36.6 36.4 38.0
MG C _T 36.3 36.6 36.8 Urine CT C _T 33.6 33.3 33.3
TV C _T 36.5 36.4 36.0 NG C _T 34.2 33.7 33.7
UU C _T 36.9 37.2 35.8 MH C _T 35.9 36.7 35.5
MG C _T 36.1 35.8 36.5 3 Urea 0.04% Swab CT C _T 33.9 33.1 34.2
TV C _T 37.9 35.3 36.6 NG C _T 35.3 35.2 34.9
UU C _T 36.3 35.3 37.0 MH C _T 38.5 37.0 38.4
MG C _T 37.3 34.8 37.9 Urine CT C _T 33.4 33.1 33.5
TV C _T 39.7 36.4 38.0 NG C _T 34.8 35.0 35.7
UU C _T 35.9 36.2 37.4 MH C _T 35.7 37.7 35.9
MG C _T 37.3 36.6 37.1 4 Hemoglobin 2.5μg Swab CT C _T 34.0 33.0 35.0
TV C _T 37.4 36.9 37.9 NG C _T 35.9 34.4 35.5
UU C _T 38.0 36.2 37.1 MH C _T 37.9 36.5 38.5
MG C _T 36.4 35.9 37.8 Urine CT C _T 33.9 33.7 34.1
TV C _T 39.8 38.0 38.4 NG C _T 35.3 35.6 35.4
UU C _T 36.8 36.9 35.5 MH C _T 35.3 36.1 35.0
MG C _T 37.4 36.5 37.0 5 Lactoferrin 25ng Swab CT C _T 33.7 33.2 34.2
TV C _T 36.6 36.1 38.1 NG C _T 34.6 33.0 35.1
UU C _T 36.6 36.8 36.8 MH C _T 37.7 37.7 37.8
MG C _T 36.8 36.7 37.1 Urine CT C _T 33.6 33.6 33.7
TV C _T 39.0 38.2 38.8 NG C _T 34.6 34.5 35.3
UU C _T 36.9 38.0 36.6 MH C _T 35.7 36.4 35.5
MG C _T 37.2 37.7 37.1 6 Immuno-globulin G (IgG) 0.41μg Swab CT C _T 35.2 35.4 36.4
TV C _T 37.2 40.2 37.4 NG C _T 37.1 35.8 37.4
UU C _T 37.2 37.3 39.4 MH C _T 37.2 36.5 36.7
MG C _T 38.5 37.9 37.6 Urine CT C _T 34.3 34.6 35.1
TV C _T 37.9 39.6 41.6 NG C _T 36.5 36.4 37.2
UU C _T 37.0 37.6 37.1 MH C _T 36.8 37.3 36.5
MG C _T 38.1 38.8 40.9 7 Mucin 1 μg Swab CT C _T 33.4 33.5 33.8
TV C _T 37.0 36.8 40.0 NG C _T 35.1 34.3 35.7
UU C _T 35.7 36.2 37.0 MH C _T 36.0 38.6 37.3
MG C _T 37.5 36.6 36.9 Urine CT C _T 33.4 34.1 33.6
TV C _T 39.7 39.2 39.2 NG C _T 35.1 35.3 35.7
UU C _T 36.0 36.4 36.1 MH C _T 35.5 33.5 36.3
MG C _T 37.1 37.1 36.4 8 BSA 5% Swab CT C _T 33.9 34.0 33.5
TV C _T 38.0 37.0 37.3 NG C _T 36.8 35.5 35.5
UU C _T 35.1 36.8 37.0 MH C _T 36.9 37.0 38.7
MG C _T 35.1 36.8 36.4 Urine CT C _T 33.7 33.7 33.6
TV C _T 37.7 38.6 39.1 NG C _T 34.9 34.5 37.0
UU C _T 37.2 36.8 37.1 MH C _T 35.4 35.3 35.1
MG C _T 36.8 38.5 37.6 9 Glucose 0.12% Swab CT C _T 33.9 32.5 34.3
TV C _T 37.0 35.8 38.2 NG C _T 35.0 31.4 35.4
UU C _T 36.6 35.5 36.0 MH C _T 38.6 33.7 39.5
MG C _T 36.9 35.9 38.4 Urine CT C _T 33.3 33.7 33.3
TV C _T 37.2 37.8 37.5 NG C _T 33.5 32.8 33.5
UU C _T 38.0 35.8 37.0 MH C _T 35.6 35.1 36.4
MG C _T 37.1 36.4 36.4 10 Bilirubin 20μM Swab CT C _T 34.2 33.4 34.5
TV C _T 38.1 36.5 37.7 NG C _T 36.4 34.5 35.9
UU C _T 37.0 35.6 37.9 MH C _T 36.9 36.1 38.1
MG C _T 36.0 36.5 36.6 Urine CT C _T 33.7 33.6 33.6
TV C _T 38.7 36.9 36.6 NG C _T 36.3 35.3 35.8
UU C _T 35.2 36.1 36.9 MH C _T 35.5 36.8 35.9
MG C _T 36.7 35.4 35.9

A strain that is not a target strain among microorganisms that can cause sexually transmitted infections and can be derived from a target sample (swab, urine) was selected and confirmed not to be detected within the detection cut off.

8) Analytical precision

The precision between the lot and the test day was evaluated using the genomic DNA of the infectious agent. The DNA template was performed in three stages of 10 ⁴ , 10 ³ -10 ² , and 10 copies, including the detection limit concentration of 10 copies, depending on the sensitivity results. Tables 11 and 12 are the results of evaluating the precision between lots, and Tables 13 and 14 are the results of evaluating the precision between inspection days. Tables 11 and 13 are the results of real-time PCR using swab matrix samples (an experimental environment in which nucleic acids are extracted from female vaginal smears or genital smear samples), and Tables 12 and 14 are urine matrix samples This is the result of using (experimental environment in which nucleic acid is extracted from urine samples).

Swab matrix Lot-to-lot precision test results Target Copies no. Lot1 average Ct value Lot2 average Ct value Lot3 average Ct value Standard deviation between lots Lot liver
% CV NG 10 ⁴ 25.8 24.5 24.2 0.697 2.803 10 ^3-2 32.0 31.3 30.9 0.458 1.458 10 37.2 36.6 36.1 0.445 1.215 CT 10 ⁴ 24.5 23.7 23.7 0.368 1.534 10 ^3-2 30.7 30.1 30.0 0.315 1.040 10 35.8 35.2 35.1 0.286 0.810 MH 10 ⁴ 28.1 27.6 27.5 0.289 1.042 10 ^3-2 34.3 34.0 33.7 0.248 0.730 10 38.9 38.8 38.9 0.012 0.030 TV 10 ⁴ 28.0 27.4 27.3 0.324 1.176 10 ^3-2 34.2 33.8 33.6 0.224 0.661 10 39.0 38.9 38.9 0.051 0.130 UU 10 ⁴ 28.2 27.6 27.4 0.355 1.278 10 ^3-2 34.1 33.6 33.3 0.335 0.994 10 39.2 38.5 38.8 0.225 0.657 MG 10 ⁴ 29.3 28.8 28.5 0.348 1.206 10 ^3-2 36.1 36.1 35.7 0.187 0.521 10 39.5 39.0 38.3 0.493 1.267

"% CV" in Tables 9 to 12 means coefficient of variation.

Urine matrix Lot-to-lot precision test results Target Copies no. Lot1 average Ct value Lot2 average Ct value Lot3 average Ct value Standard deviation of Ct between lots Lot liver
% CV NG 10 ⁴ 26.3 25.5 25.4 0.416 1.616 10 ^3-2 32.3 31.8 31.2 0.416 1.308 10 38.2 36.9 36.7 0.662 1.777 CT 10 ⁴ 24.4 24.0 24.0 0.182 0.753 10 ^3-2 30.5 30.2 30.1 0.155 0.512 10 36.0 35.3 35.1 0.355 1.001 MH 10 ⁴ 27.3 27.3 27.1 0.133 0.488 10 ^3-2 33.6 33.5 33.4 0.103 0.309 10 38.2 38.1 38.6 0.201 0.525 TV 10 ⁴ 28.5 28.3 28.2 0.124 0.436 10 ^3-2 34.7 34.2 34.4 0.237 0.689 10 39.0 38.5 38.6 0.249 0.644 UU 10 ⁴ 28.5 28.0 28.0 0.214 0.758 10 ^3-2 34.6 34.0 33.7 0.391 1.146 10 39.5 39.0 39.2 0.212 0.539 MG 10 ⁴ 29.5 29.3 29.1 0.132 0.449 10 ^3-2 36.0 36.0 35.9 0.018 0.049 10 39.4 39.4 39.3 0.038 0.097

Swab matrix Lot-to-lot precision test results Target Copies no. Ct average value during the inspection day Standard deviation of Ct between inspection days % CV between inspection days NG 10 ⁴ 24.9 0.401 1.614 10 ^3-2 31.4 0.788 2.509 10 36.6 0.826 2.256 CT 10 ⁴ 24.0 0.201 0.838 10 ^3-2 30.3 0.484 1.598 10 35.4 0.838 2.371 MH 10 ⁴ 27.7 0.279 1.006 10 ^3-2 34.0 0.397 1.167 10 38.9 0.597 1.536 TV 10 ⁴ 27.5 0.284 1.033 10 ^3-2 33.9 0.469 1.385 10 38.9 0.465 1.195 UU 10 ⁴ 27.8 0.306 1.103 10 ^3-2 33.7 0.468 1.389 10 38.8 0.716 1.844 MG 10 ⁴ 28.9 0.756 2.617 10 ^3-2 36.0 1.198 3.331 10 38.9 0.761 1.956

Urine matrix Lot-to-lot precision test results Target Copies no. Ct average value during the inspection day Standard deviation of Ct between inspection days % CV between inspection days NG 10 ⁴ 25.7 0.411 1.599 10 ^3-2 31.8 0.778 2.448 10 37.3 0.989 2.655 CT 10 ⁴ 24.1 0.262 1.084 10 ^3-2 30.3 0.630 2.084 10 35.5 0.789 2.225 MH 10 ⁴ 27.2 0.658 2.413 10 ^3-2 33.5 0.804 2.399 10 38.3 0.850 2.217 TV 10 ⁴ 28.3 0.463 1.636 10 ^3-2 34.4 0.632 1.836 10 38.7 0.478 1.234 UU 10 ⁴ 28.2 0.640 2.272 10 ^3-2 34.1 0.731 2.143 10 39.3 0.458 1.166 MG 10 ⁴ 29.3 0.792 2.703 10 ^3-2 36.0 1.000 2.781 10 39.4 0.704 1.790

As a result, it was confirmed that there was no difference between the lot and the inspection day, and no contamination occurred in the negative control group.

Tables 11 to 18 show% CV values for each lot, inspection days, and users. The distribution of the% CV value is the minimum value of 0.030 to 3.331, and when converted to a percentage, it shows the precision of 99.970% to 96.669%. Considering the significance level in statistical analysis, 95%, it satisfies the significant value of the precision.

9) Reproducibility

The reproducibility between laboratories and testers was evaluated using genomic DNA of a sexually transmitted infectious agent. The DNA template was performed in three stages of 10 ⁴ , 10 ³ -10 ² , and 10 copies, including the detection limit concentration of 10 copies, depending on the sensitivity results. Tables 13 and 14 are the results of evaluating the reproducibility between laboratories, and Tables 15 and 16 are the results of evaluating the reproducibility between testers. Tables 15 and 17 are the results of real-time PCR using a woman's vaginal smear composition-based sample (swab matrix), and Tables 16 and 18 are results obtained using a urine composition-based sample.

Swab matrix Interlaboratory reproducibility test results Target Copies no. Lab 1 average Ct value Lab 2 average Ct value Lab 3 Average Ct value Standard deviation between labs Laboratory liver
% CV NG 10 ⁴ 25.6 24.3 24.3 0.634 2.563 10 ^3-2 31.2 30.2 30.3 0.470 1.538 10 36.3 35.0 35.2 0.553 1.559 CT 10 ⁴ 24.2 23.3 23.6 0.400 1.687 10 ^3-2 30.1 29.2 29.5 0.365 1.234 10 34.9 34.1 34.4 0.357 1.036 MH 10 ⁴ 27.8 27.0 27.3 0.336 1.227 10 ^3-2 34.2 33.3 33.4 0.382 1.136 10 39.1 38.4 38.2 0.377 0.979 TV 10 ⁴ 27.8 26.9 27.0 0.417 1.532 10 ^3-2 34.0 33.2 32.9 0.474 1.418 10 38.8 38.4 38.6 0.161 0.417 UU 10 ⁴ 27.2 26.2 26.4 0.423 1.592 10 ^3-2 33.1 32.4 32.3 0.360 1.105 10 38.0 37.1 37.7 0.379 1.007 MG 10 ⁴ 27.1 26.3 26.2 0.411 1.551 10 ^3-2 33.3 32.8 32.7 0.246 0.747 10 38.9 38.5 37.1 0.765 2.004

"% CV" in Tables 15 to 18 means coefficient of variation.

Urine matrix Interlaboratory reproducibility test results Target Copies no. Lab 1 average Ct value Lab 2 average Ct value Lab 3 Average Ct value Standard deviation between labs Laboratory liver
% CV NG 10 ⁴ 26.0 25.3 25.0 0.416 1.635 10 ^3-2 32.2 31.6 31.2 0.386 1.220 10 37.4 36.0 36.1 0.616 1.689 CT 10 ⁴ 24.2 23.7 23.9 0.230 0.962 10 ^3-2 30.1 29.5 29.9 0.245 0.821 10 34.7 34.1 34.6 0.271 0.785 MH 10 ⁴ 26.6 26.1 26.3 0.183 0.695 10 ^3-2 32.5 31.9 32.1 0.264 0.820 10 37.7 37.2 37.6 0.188 0.502 TV 10 ⁴ 27.9 27.8 28.0 0.055 0.197 10 ^3-2 34.5 33.7 34.0 0.325 0.953 10 39.7 37.9 37.7 0.875 2.277 UU 10 ⁴ 27.1 26.5 26.7 0.261 0.974 10 ^3-2 33.6 32.7 32.6 0.460 1.396 10 38.1 37.5 37.5 0.273 0.725 MG 10 ⁴ 26.8 26.4 26.4 0.203 0.764 10 ^3-2 33.1 32.9 32.8 0.151 0.460 10 38.0 38.2 38.8 0.360 0.938

Swab matrix Reproducibility test results between testers Target Copies no. Tester 1 average Ct value Tester 2 average Ct value Tester 3 Average Ct value Standard deviation between testers Between testers
% CV NG 10 ⁴ 25.7 24.4 24.2 0.673 2.716 10 ^3-2 31.3 30.7 30.6 0.317 1.027 10 36.4 35.9 36.2 0.193 0.533 CT 10 ⁴ 24.4 23.8 23.6 0.322 1.347 10 ^3-2 30.3 30.0 29.9 0.206 0.687 10 35.5 34.7 34.8 0.327 0.935 MH 10 ⁴ 27.8 27.4 27.3 0.217 0.789 10 ^3-2 34.0 33.7 33.5 0.229 0.678 10 38.8 38.8 38.8 0.017 0.043 TV 10 ⁴ 27.8 27.2 27.0 0.364 1.332 10 ^3-2 33.9 33.4 33.3 0.290 0.864 10 38.9 39.1 38.6 0.218 0.560 UU 10 ⁴ 27.1 26.7 26.4 0.306 1.144 10 ^3-2 33.3 32.7 32.5 0.334 1.018 10 38.3 38.5 37.8 0.250 0.655 MG 10 ⁴ 26.9 26.8 26.3 0.296 1.110 10 ^3-2 33.5 33.4 32.9 0.254 0.762 10 38.6 38.9 38.3 0.245 0.635

Urine matrix Reproducibility test results between testers Target Copies no. Tester 1 average Ct value Tester 2 average Ct value Tester 3 Average Ct value Standard deviation between testers Between testers
% CV NG 10 ⁴ 26.0 25.5 25.3 0.284 1.110 10 ^3-2 32.0 31.2 31.3 0.342 1.085 10 38.3 36.8 36.8 0.725 1.945 CT 10 ⁴ 24.4 24.0 24.0 0.165 0.685 10 ^3-2 30.3 29.9 30.0 0.147 0.491 10 35.7 35.1 35.0 0.342 0.969 MH 10 ⁴ 26.5 26.5 26.5 0.016 0.060 10 ^3-2 32.4 32.4 32.2 0.109 0.337 10 37.8 38.2 37.9 0.193 0.509 TV 10 ⁴ 28.2 27.9 27.9 0.134 0.479 10 ^3-2 34.4 34.1 34.1 0.140 0.409 10 39.4 38.7 39.0 0.289 0.742 UU 10 ⁴ 27.3 27.0 26.7 0.237 0.878 10 ^3-2 33.9 32.8 32.9 0.489 1.475 10 38.8 38.1 38.1 0.345 0.900 MG 10 ⁴ 26.9 26.8 26.5 0.157 0.586 10 ^3-2 33.2 33.0 32.9 0.123 0.372 10 38.0 38.2 38.8 0.360 0.938

9) Compatibility by amplification equipment

The compatibility of each amplification device was evaluated using 10 ⁴ copies (high concentration), 10 ^3-2 copies (medium concentration), and 10 copies (low concentration) of genomic DNA of the causative agent. Two amplification equipments were used: Applied Biosystems 7500 Real-Time PCR Instrument System (ABI7500) from ABI and Real-Time PCR Equipment (CFX96) from Bio-Rad.

Matrix Target density CFX96 ABI7500 1 repetition 2 repetitions 3 repetitions 1 repetition 2 repetitions 3 repetitions Swab NG High concentration 23.4 23.7 22.9 24.7 24.4 24.4 Medium concentration 29.3 29.5 28.6 30.7 30.5 30.6 Low concentration 33.6 33.2 33.1 35.7 34.2 35.1 CT High concentration 22.2 22.5 22.4 23.9 24.0 23.5 Medium concentration 28.0 27.4 28.4 29.9 29.6 29.9 Low concentration 32.1 32.2 32.1 34.6 34.3 33.6 MH High concentration 26.8 26.8 26.5 28.2 28.2 28.6 Medium concentration 33.1 33.2 33.5 35.0 35.0 35.2 Low concentration 36.6 38.7 37.6 39.6 38.9 40.2 TV High concentration 26.3 26.3 26.5 27.4 27.0 27.2 Medium concentration 32.2 32.1 31.9 33.1 33.1 33.1 Low concentration 39.0 37.0 37.1 37.3 38.8 37.4 UU High concentration 25.2 25.3 25.2 27.0 26.8 26.9 Medium concentration 31.3 31.1 31.0 33.3 32.7 33.0 Low concentration 34.8 35.1 35.5 37.3 38.1 38.8 MG High concentration 25.2 25.3 25.6 27.1 26.9 27.0 Medium concentration 31.4 31.2 31.3 33.3 32.7 33.0 Low concentration 35.8 39.0 36.0 37.4 37.7 37.8 Urine NG High concentration 23.4 24.3 24.0 25.5 25.1 25.6 Medium concentration 29.2 29.4 30.1 31.7 31.1 31.3 Low concentration 34.8 33.9 34.0 35.8 36.9 35.3 CT High concentration 21.5 22.3 22.2 24.2 24.3 24.4 Medium concentration 27.2 28.3 28.3 30.2 30.0 30.4 Low concentration 32.2 32.4 32.7 34.3 34.5 34.0 MH High concentration 25.1 25.8 26.0 27.4 27.4 27.5 Medium concentration 31.7 32.2 32.3 33.7 34.1 34.0 Low concentration 34.9 37.6 36.1 37.8 38.1 38.5 TV High concentration 27.5 27.6 27.2 28.5 28.4 28.5 Medium concentration 32.8 33.6 33.4 35.0 34.1 34.8 Low concentration 38.2 37.3 38.6 37.0 37.4 37.1 UU High concentration 25.4 25.6 25.9 26.4 26.5 26.5 Medium concentration 31.2 31.3 31.2 31.6 32.6 32.4 Low concentration 36.1 36.7 35.1 36.3 36.3 36.6 MG High concentration 25.3 25.5 25.3 26.9 26.9 27.0 Medium concentration 31.2 30.9 30.9 32.5 33.0 33.1 Low concentration 36.5 35.9 35.6 37.8 36.9 38.2

10) Clinical effectiveness

In order to evaluate the clinical effectiveness of the kit for detecting the source of sexually transmitted infections, the sample collection institution, Ewon Medical Foundation, used for the purpose of diagnosing the source of sexually transmitted infections and used 1,111 urine and vaginal smear samples at Samsung Seoul Hospital. Clinical trials were conducted. The sensitivity and specificity of the detection kit for each target causative agent were confirmed.

A) Chlamydia trachomatis (CT)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 230 0 230 voice 0 213 213 all 230 213 443

As a result of diagnosing Chlamydia trachomatis for the entire sample, 230 true positives, 213 true negatives, 0 false positives and 0 false negatives, clinical sensitivity 100% (95% CI, 98.0-100%) and clinical specificity 100% (95% CI, 97.8-100%).

Sensitivity 100% (95% CI, 98.0-100%): Statistical test with 95% significance level indicates that the sensitivity is 100%. At this time, the confidence interval is 98% ~ 100%. CI indicates that a sample conducted in a clinical trial is a population, indicating that there is a 95% chance that there is an average value (true value) of all data. At this time, the confidence interval is 98% to 100%, and the sensitivity of 100% satisfies a significant value. That is, if the test statistic value is located within the confidence interval value, it can be considered that it represents 'true' with a probability of a targeted significance level (95%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 117 0 117 voice 0 104 104 all 117 104 221

As a result of diagnosing Chlamydia trachomatis among vaginal smears among all samples, clinical sensitivity was 100% (95% CI, 96.0-100%) with 117 true positives, 104 true negatives, 0 false positives and 0 false negatives, and The clinical specificity was 100% (95% CI, 95.6-100%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 113 0 113 voice 0 109 109 all 113 109 222

As a result of diagnosing Chlamydia trachomatis in urine specimens among all specimens, the clinical sensitivity was 100% (95% CI, 95.9-100%) and clinical with 113 true positives, 109 true negatives, and 0 false positives and false negatives. The specificity was 100% (95% CI, 95.8-100%).

B) Gonorrhea (NG)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 164 One 165 voice 0 212 212 all 164 213 377

As a result of diagnosing gonorrhea against all specimens, clinical sensitivity was 100% (95% CI, 97.1-100%) and clinical specificity with 164 true positives, 212 true negatives, 1 false positive and 0 false negatives. 99.5% (95% CI, 97.0-99.9%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 77 One 78 voice 0 103 103 all 77 104 181

As a result of diagnosing gonococcal specimens among vaginal smears among all samples, clinical sensitivity was 100% (95% CI, 94.1-100%) with 77 true positives, 103 true negatives, 1 false positive and 0 false negatives. And clinical specificity of 99.0% (95% CI, 94.0-99.9%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 87 0 87 voice 0 109 109 all 87 109 196

As a result of diagnosing gonorrhea of urine specimens among all samples, 87 true positives, 109 true negatives, 0 false positives and 0 false negatives, clinical sensitivity 100% (95% CI, 94.7-100%) and clinical specificity 100% (95% CI, 95.8-100%) was shown.

C) Vaginal flagella (TV)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 153 0 153 voice 3 213 216 all 156 213 369

As a result of diagnosing Trichomoniasis in all samples, clinical sensitivity was 98.1% (95% CI, 94.0-99.5%) and clinical specificity with 153 true positives, 213 true negatives, 0 false positives and 3 false negatives. 100% (95% CI, 97.8-100%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 78 0 78 voice One 104 105 all 79 104 183

As a result of diagnosing vaginal trichinosis among vaginal smear samples, clinical sensitivity was 98.7% (95% CI, 92.2-99.9%) with 78 true positives, 104 true negatives, 0 false positives, and 1 false negative. And clinical specificity of 100% (95% CI, 95.6-100%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 75 0 75 voice 2 109 111 all 77 109 186

As a result of diagnosing Trichomoniasis in urine specimens among all specimens, clinical sensitivity was 97.4% (95% CI, 90.0-99.5%) and clinical: 75 true positive, 109 true negative, 0 false positive and 2 false negative The enemy specificity was 100% (95% CI, 95.8-100%).

D) Mycoplasma Genitalium (MG)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 159 One 160 voice 4 212 216 all 163 213 376

As a result of diagnosing Mycoplasma genitalium in all specimens, clinical sensitivity was 97.5% (95% CI, 93.4-99.2%) and clinical results were 159 true positive, 212 true negative, 1 false positive and 4 false negative. It showed an enemy specificity of 99.5% (95% CI, 97.0-99.9%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 79 One 80 voice 3 103 106 all 82 104 186

As a result of diagnosing Mycoplasma Genitalium among vaginal smears among all samples, clinical sensitivity was 96.3% (95% CI, 88.9-) with 79 true positives, 103 true negatives, 1 false positive and 3 false negatives. 99.1%) and clinical specificity 99.0% (95% CI, 94.0-99.9%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 80 0 80 voice One 109 110 all 81 109 190

As a result of diagnosing Mycoplasma genitalium in urine specimens among all specimens, clinical sensitivity was 98.8% (95% CI, 92.4-99.9%) with 80 true positives, 109 true negatives, 0 false positives, and 1 false negative ) And clinical specificity of 100% (95% CI, 95.8-100%).

E) Mycoplasma Hominis (MH)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 226 One 227 voice 8 212 220 all 34 213 447

As a result of diagnosing Mycoplasma hominis in all specimens, clinical sensitivity was 96.6% (95% CI, 93.1-98.4%) and clinical results were 26 true positive, 212 true negative, 1 false positive and 8 false negative. The specificity was 99.5% (95% CI, 97.0-99.9%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 125 One 126 voice 0 103 103 all 125 104 229

As a result of diagnosing mycoplasma hominis among vaginal smears among all samples, clinical sensitivity was 100% (95% CI, 96.3-100) with 125 true positives, 103 true negatives, 1 false positive and 0 false negatives. %) And clinical specificity of 99.0% (95% CI, 94.0-99.9%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 101 0 101 voice 8 109 117 all 109 109 218

As a result of diagnosing Mycoplasma hominis in urine specimens among all specimens, clinical sensitivity was 92.7% (95% CI, 85.6-96.5%) with 101 true positives, 109 true negatives, 0 false positives, and 8 false negatives. And clinical specificity 100% (95% CI, 95.8-100%).

F) Urea Plasma Ureaticum (UU)

① All samples

- Confirmation result positivity voice all Detection kit results of the present invention positivity 227 One 228 voice 3 212 215 all 230 213 443

As a result of diagnosing ureaplasma urearicum in all samples, clinical sensitivity was 98.7% (95% CI, 95.9-99.7%) and clinical: 227 true positive, 212 true negative, 1 false positive and 3 false negative It showed an enemy specificity of 99.5% (95% CI, 97.0-99.9%).

② Sample of vaginal smear

- Confirmation result positivity voice all Detection kit results of the present invention positivity 111 One 112 voice 2 103 105 all 113 104 217

As a result of diagnosing ureaplasma urearicum in vaginal smear samples, clinical sensitivity was 98.2% (95% CI, 93.1-) with 111 true positives, 103 true negatives, 1 false positive and 2 false negatives. 99.7%) and clinical specificity 99.0% (95% CI, 94.0-99.9%).

③ Urine sample

- Confirmation result positivity voice all Detection kit results of the present invention positivity 116 0 116 voice One 109 110 all 117 109 226

As a result of diagnosing ureaplasma urearicum in urine samples among all samples, clinical sensitivity was 99.1% (95% CI, 94.6-99.9%), with 116 true positives, 109 true negatives, 0 false positives and 1 false negative. ) And clinical specificity of 100% (95% CI, 95.8-100%).

<110> eone lifescience institute <120> Kits for Detecting Pathogens of Sexually Transmitted Infections <130> PN180066 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CT-1 F <400> 1 ggaccagcaa ataatccttg gg 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CT-1 R <400> 2 taagcttttt ccgcatccaa acc 23 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CT probe <400> 3 atcaacacct gtcgcagcca aaatgaca 28 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NG F <400> 4 ctgctacttt cacgctggaa ag 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NG R <400> 5 tctgccgagc aagaacaaaa ag 22 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NG probe <400> 6 atcatgcccc tcattggcgt gtttcg 26 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NG-Cry F <400> 7 cgcacaaaaa cgtgttggcg tt 22 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NG-Cry R <400> 8 gttagcgatt gatttggaga tac 23 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> NG-Cry probe <400> 9 ttctttttcc cacatcggga cagggaaat 29 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MH-2 F <400> 10 ttatcaggcg cttcatgtac tac 23 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MH-2 R <400> 11 ctttggtctg ctgtatatga gtg 23 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MH-2 probe <400> 12 caatacgttg gcaataggag ctaaacag 28 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> S_301_PCRC F <400> 13 cgaatacacc agctacacct aa 22 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> S_301_PCRC R <400> 14 tacaatggtg gtccttatga act 23 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S_301_PCRC probe <400> 15 gtgaaatggg tgcataagga tgttgt 26 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TV F <400> 16 ccgatcttca gctcgagcgc 20 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TV R <400> 17 gcggaaaagc tgaccgaact g 21 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TV probe <400> 18 agccacaggc ggcaagtacg tccca 25 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> UU F <400> 19 agtaatcgct gccatgctat ac 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> UU / P R <400> 20 gaccattaat tattggtgta ggtg 24 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> UU probe <400> 21 caattaacat tgtctttcca gcaccaacag 30 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MG F <400> 22 atggcaatat atgacaccat gtca 24 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MG R <400> 23 tatcttttaa aagttctgct gcaag 25 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MG probe <400> 24 gttgtgcagc aggtctatca ccatctat 28

Claims (16)

(i) Chlamydia trachomatis detection set comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe consisting of the nucleotide sequence of SEQ ID NO: 3;
(ii) a set for detecting gonococci (Neisseria gonorrhoeae) comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 4 and 5 and a probe consisting of the nucleotide sequence of SEQ ID NO: 6;
(iii) a set for detecting gonococci comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequence of SEQ ID NO: 9; And
(iv) A kit for simultaneous detection of infectious agents including a set for detecting Mycoplasma hominis comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 10 and 11 and a probe consisting of the nucleotide sequence of SEQ ID NO: 12 .
The kit of claim 1, wherein the kit for simultaneous detection of the infectious agent for sexually transmitted infection further comprises one or more sets selected from the following sets:
(i) a set for detecting Trichomonas vaginalis comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 16 and 17;
(ii) a set for detecting ureaplasma urealyticum comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 19 and 20; And
(iii) Mycoplasma genitalium detection set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 22 and 23.
delete According to claim 2, wherein the set for detection of (i) to (iii) is a kit for simultaneous detection of a sexually transmitted infectious agent, characterized in that it further comprises at least one probe selected from the following probes:
The set for detecting (i) Trichomonas vaginalis comprises: a probe consisting of the nucleotide sequence of SEQ ID NO: 18;
The set of (ii) ureaplasma urearicum detection comprises a probe consisting of the nucleotide sequence of SEQ ID NO: 21; And
The (iii) Mycoplasma genitalium detection set is a probe consisting of the nucleotide sequence of SEQ ID NO: 24.
The method of claim 1, wherein the 5'-end of the nucleotide sequence of SEQ ID NO: 3, 6, 9, and 12 is selected from the group consisting of FAM, TET, HEX, JOE, ROX, TMR, Cy5 and Cal Red 610. A kit for simultaneous detection of a causative agent of a sexually transmitted infection characterized by being labeled with a fluorophore of a species and modified at the 3'-end by a quencher of BHQ-1, BHQ-2 or BHQ-3.
5. The 5'-terminal of the nucleotide sequence of SEQ ID NOs: 18, 21, and 24 is one selected from the group consisting of FAM, TET, HEX, JOE, ROX, TMR, Cy5 and Cal Red 610. A kit for simultaneous detection of a causative agent of a sexually transmitted infection characterized by being labeled with a fluorophore and modified at the 3'-end by a quencher of BHQ-1, BHQ-2 or BHQ-3.
The kit according to claim 1 or 2, wherein the kit is carried out by gene amplification.
8. The kit for simultaneous detection of a sexually transmitted infectious agent according to claim 7, wherein the gene amplification is performed by polymerase chain reaction (PCR).
8. The kit of claim 7, wherein the gene amplification is performed by real-time PCR.
A method of detecting a sexually transmitted infectious agent comprising the following steps:
(A) preparing the DNA of the biological sample isolated from the object;
(b) (i) a set for detecting Chlamydia trachomatis comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe consisting of the nucleotide sequence of SEQ ID NO: 3;
(ii) a set for detecting gonococci, comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 4 and 5 and a probe consisting of the nucleotide sequence of SEQ ID NO: 6;
(iii) a set for detecting gonococci comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 7 and 8 and a probe consisting of the nucleotide sequence of SEQ ID NO: 9; And
(iv) amplifying the target nucleotide sequence in the biological sample using a set for detecting Mycoplasma hominis comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 10 and 11 and a probe consisting of the nucleotide sequence of SEQ ID NO: 12; And
(c) confirming the amplification result.
[12] The method of claim 10, wherein the step (b) further comprises at least one set selected from among the following sets to amplify the sequence:
(i) a set for detecting Trichomonas trichomoniae comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 16 and 17 and a probe consisting of the nucleotide sequence of SEQ ID NO: 18;
(ii) a set for detecting ureaplasma urearicum comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 19 and 20 and a probe consisting of the nucleotide sequence of SEQ ID NO: 21; And
(iii) A set for detecting Mycoplasma genitalium comprising a primer pair consisting of the nucleotide sequence of SEQ ID NOs: 22 and 23 and a probe consisting of the nucleotide sequence of SEQ ID NO: 24.
11. The method of claim 10, wherein the sample is urine, blood, saliva, urinary secretions, blisters (vesicle) and body fluids in the blisters, ulcers (ulcer), warts (wart), mucus, or tissues, characterized in that the detection of infectious agents Way.
12. The method according to claim 10 or 11, wherein the amplification is carried out by polymerase chain reaction (PCR).
14. The method of claim 13, wherein the amplification is performed by real-time PCR.
15. The method of claim 14, wherein the real-time PCR is performed using the TaqMan probe method.
12. The method of claim 10 or 11, wherein the probe is labeled, and the confirmation of step (c) is performed by detecting a signal generated from the probe.

Images