KR101473444B1 - METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS - Google Patents

METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS Download PDF

Info

Publication number
KR101473444B1
KR101473444B1 KR1020140021327A KR20140021327A KR101473444B1 KR 101473444 B1 KR101473444 B1 KR 101473444B1 KR 1020140021327 A KR1020140021327 A KR 1020140021327A KR 20140021327 A KR20140021327 A KR 20140021327A KR 101473444 B1 KR101473444 B1 KR 101473444B1
Authority
KR
South Korea
Prior art keywords
seq
probe
detection set
sequence
primer
Prior art date
Application number
KR1020140021327A
Other languages
Korean (ko)
Inventor
김정욱
Original Assignee
주식회사 현일바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 현일바이오 filed Critical 주식회사 현일바이오
Priority to KR1020140021327A priority Critical patent/KR101473444B1/en
Application granted granted Critical
Publication of KR101473444B1 publication Critical patent/KR101473444B1/en
Priority to PCT/KR2015/000802 priority patent/WO2015126069A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for specifically detecting a? -Lactam antibiotic-resistant strain by amplifying target genes using various primers and probes, and a kit using the same. The method of the present invention is a multiplex-real-time PCR (PCR) using a β-lactamase target gene (specifically, ESBL gene, AmpC β-lactamase gene or carbapenemase gene) -specific primer pair and probe multiplex lactam antibiotic-resistant strains can be detected with very high efficiency through multiplex real-time polymerase chain reaction. In addition, the kit of the present invention can easily and efficiently detect target genes in a sample through multiplex real-time PCR. Therefore, the method and kit of the present invention can selectively and easily detect the infection of? -Lactam antibiotic resistant strains in a sample, and can be applied to the treatment of diseases more accurately based on the method.

Description

[0002] Methods for Detecting Bacterial Having Resistance to [beta] -lactam Antibiotic Resistance [

The present invention relates to a method for detecting a? -Lactam antibiotic-resistant strain.

The resistance of β-lactam antibiotics to Gram-negative bacteria is frequently expressed as a metastasis of plasmids capable of obtaining various kinds of β-lactamase genes. In addition, a decrease in porin function and an increase in efflux, which absorb antibiotics into the bacteria, are combined, resulting in stronger multidrug resistance. At present, more than 1,000 kinds of? -Lactamase exist in Gram-negative bacteria. Extended-spectrum β-lactamase (ESBL), AmpC β-lactamase, carbapenemase are clinically important.

ESBL-producing strains began to increase in the 1990s. Most are found in intestinal bacteria but also in Pseudomonas spp. And Acinetobacter baumannii . In the 1990s, TEM-type and SHV-type ESBL-producing bacteria were widely used. In 2000, CTX-M-type ESBL-producing bacteria were spread widely. In addition, PER-type ESBL-producing strains and VEB-type ESBL-producing strains have been isolated.

The plasmid-mediated AmpC [beta] -lactamase gene became known since 1989. At present, there are 111 kinds of CMY gene, 5 kinds of ACC gene, 28 kinds of ACT gene, 12 kinds of DHA gene, 11 kinds of FOX gene, 8 kinds of MIR gene and MOX gene, 1 kind of LAT gene and CFE gene (Http://www.lahey.org/studies/other.asp).

Carbapenemase, which causes resistance to carbapenem, is classified into classes A, B, and D according to its molecular structure. Class A carbapenemase has five types of chromosomal NMC, IMI, SME and plasmid mediated KPC and GES. In Class A, KPC is the most common and has spread worldwide since it was first discovered in the eastern United States in 1996. Class B has isolated 10 plasmid mediated carbapenemases: IMP, VIM, SPM, GIM, SIM, AIM, KHM, NDM and DIM to date to date. Most are VIM and IMP, and in recent years NDM has been growing rapidly. The carbapenemases belonging to the class D belong to the OXA-23, OXA-24, OXA-58 and OXA-48 groups, most of which are isolated from Acinetobacter sp.

Recently, infection by multidrug-resistant Gram-negative bacteria resistant to? -lactam antibiotics has been increasing. These infections increase the mortality and morbidity rate, increase the cost of medical treatment due to the longer treatment period, and make it difficult to manage hospital infection. Therefore, in order to prevent, manage and properly treat infectious diseases, it is necessary to rapidly detect multidrug-resistant bacteria. Antibiotic susceptibility test is the basic test to detect multidrug resistant bacteria. This test takes a certain amount of time to cultivate the bacterium. The expression level of β-lactamase gene varies and there is no specific inhibitor, so it is difficult to accurately determine the resistance mechanism. On the other hand, a test for detecting a β-lactamase gene by a molecular biological method is useful for the management of hospital infection and the epidemiological study of resistant bacteria because it can quickly and accurately reveal the resistance mechanism.

Currently, multiplex PCR-based assays are widely used to simultaneously detect several clinically important beta-lactamase genes. This conventional PCR method is labor-intensive because the product must be confirmed by electrophoresis after the amplification reaction is completed. Thus, the present inventors have developed an assay using multiplex real-time PCR. The real-time PCR method is more suitable for the hospital laboratory because it can confirm the amplification product in real time and does not require electrophoresis after the reaction.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method for rapidly and accurately detecting a multidrug-resistant bacterium by easily and efficiently detecting a strain having resistance to a? -Lactam antibiotic. As a result, the present inventors produced an extended-spectrum beta-lactamase (ESBL) detection set consisting of a primer pair and a probe, an AmpC beta-lactamase detection set and a carbapenemase detection set, Lactam antibiotic-resistant strains having a? -Lactamase gene can be specifically and simply detected from a sample (for example, a DNA sample derived from a clinical sample) by carrying out PCR, thereby completing the present invention .

It is an object of the present invention to provide a method for detecting a? -Lactam antibiotic resistant strain.

Another object of the present invention is to provide a kit for detecting a? -Lactam antibiotic-resistant strain.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention and claims.

According to one aspect of the present invention, the present invention provides a method for detecting an? -Lactam antibiotic resistant strain comprising the steps of:

(a) preparing a sample;

(b) one species selected from the group consisting of (i) an extended-spectrum beta-lactamase (ESBL) detection set, (ii) an AmpC? -lactamase detection set, and (iii) a carbapenemase detection set Amplifying the target nucleotide sequence in the sample using the detection set as described above; And

(c) confirming the amplification result with fluorescence.

According to another aspect of the present invention, the present invention provides a kit comprising (i) an extended-spectrum beta-lactamase (ESBL) detection set, (ii) an AmpC? -Lactamase detection set, and (iii) a carbapenemase detection set A lactam antibiotic-resistant strain, and a kit for detecting a? -Lactam antibiotic-resistant strain, comprising at least one detection set selected from the group consisting of:

The present inventors have sought to develop a method for rapidly and accurately detecting a multidrug-resistant bacterium by easily and efficiently detecting a strain having resistance to a? -Lactam antibiotic. As a result, the present inventors produced an extended-spectrum beta-lactamase (ESBL) detection set consisting of a primer pair and a probe, an AmpC beta-lactamase detection set and a carbapenemase detection set, Lactam antibiotic-resistant strains having a? -Lactamase gene can be specifically and simply detected from a sample (for example, a DNA sample derived from a clinical sample) by carrying out PCR.

The method using the primers and probes of the present invention can detect β-lactam-resistant strains very efficiently and easily in a single tube in a sample.

According to one embodiment of the present invention, the amplification of the present invention is carried out according to a polymerase chain reaction (PCR). According to some embodiments of the present invention, the primers of the present invention are used for amplification reactions.

The term " amplification reaction " as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art and include polymerase chain reaction (PCR) (US Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR; The method of Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), the multiplex PCR (McPherson and Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press Moller, 2000), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification , WO 88/10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence priming Polymerase chain reaction (consensus sequence primed pol (US Pat. No. 5,413,909 and US Pat. No. 5,861, 245), nucleic acid sequence-based amplification (nucleic-acid-based amplification) acid sequence based amplification, NASBA, U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification and loop-mediated isothermal amplification. LAMP), but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617, and U.S. Patent No. 09 / 854,317.

As used herein, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Specifically, the primer is a deoxyribonucleotide and a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer. The term " annealing " or " priming ", as used herein, refers to oligodeoxynucleotides or nucleic acids apposition to a template nucleic acid, wherein the polymerase is capable of polymerizing a nucleotide to form a template nucleic acid, To form nucleic acid molecules.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction inverse polymerase chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the method of the present invention is carried out using a primer, target genes can be simultaneously detected in an analysis target (for example, a clinical specimen-derived sample) by performing a gene amplification reaction. Therefore, in the method of the present invention, a gene amplification reaction is performed using a primer that binds to DNA extracted from a sample.

According to one embodiment of the present invention, the sample that can be used in the method of the present invention is a clinical sample-derived sample, and the clinical sample includes, but is not limited to, sputum, saliva, blood and urine.

Extraction of DNA from the sample can be carried out according to conventional methods known in the art (see Sambrook, J. et al. , Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al, Plant Mol Biol Rep, 9:..... 242 (1991); Ausubel, FM et al, Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al. , Anal. Biochem. 162: 156 (1987)).

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions suitable nucleic acid hybridization to form such double-stranded structure is Joseph Sambrook, such as, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, etc., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used in the amplification of the present invention and include "Klenow" fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is desirable to provide the reaction mixture with such joins as Mg 2+ , dATP, dCTP, dGTP and dTTP to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The amplified target gene (for example, ESBL gene, AmpC? -Lactamase and carbapenemase gene) is analyzed by a suitable method to specifically detect various strains resistant to? -Lactam antibiotics will be.

For example, in the case where the method of the present invention is carried out based on an amplification reaction using DNA, (i) a primer capable of specifically detecting ESBL gene, AmpC? -Lactamase gene and carbapenemase gene Performing an amplification reaction using a pair and a probe; And (ii) analyzing the product of the amplification reaction through fluorescence. Thus, various β-lactam antibiotic-resistant strains can be efficiently and easily detected or quantitated simultaneously from DNA extracted from a sample.

The term " hybridization " as used herein means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur either in perfect match between single stranded nucleic acid sequences or in the presence of some mismatching nucleotides. The degree of complementarity required for hybridization can vary depending on hybridization reaction conditions, and can be controlled by temperature. The terms " annealing " and " hybridization " are no different and are used interchangeably herein.

According to some embodiments of the present invention, the methods and kits of the present invention can simultaneously detect a variety of beta -lactam antibiotic resistant strains through multiplex real-time PCR.

According to some embodiments of the present invention, the [beta] -lactam antibiotic resistant strain detection set that can be used in the methods and kits of the present invention comprises an ESBL detection set, an AmpC [beta] -lactamase detection set, and a carbapenemase detection set And at least one detection set selected from the group.

According to another embodiment of the present invention, the ESBL detection set in the method and kit of the present invention comprises (i) a primer pair of Sequence Listing first sequence and Sequence Listing second sequence, and a first pair of probes of Sequence Listing Detection set; (Ii) a second detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and a probe of SEQ ID NO: 6; (Iii) a third detection set consisting of a sequence of SEQ ID NO: 7 and a sequence of SEQ ID NO: 8, and a probe of SEQ ID NO: 9; (Iv) a fourth detection set consisting of a pair of primers of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12; (V) a fifth detection set consisting of a sequence of SEQ ID NO: 13 and a sequence of SEQ ID NO: 14, and a probe of SEQ ID NO: 15; (Vi) a sixth detection set consisting of a primer pair of SEQ ID NO: 16 and SEQ ID NO: 17, and a probe of SEQ ID NO: 18; (Viii) a seventh detection set consisting of a pair of primers of SEQ ID NO: 19 and SEQ ID NO: 20, and a probe of SEQ ID NO: 21; (Viii) an eighth detection set consisting of a pair of primers of SEQ ID NO: 22 and SEQ ID NO: 23, and a probe of SEQ ID NO: 24; (Viii) a ninth detection set consisting of a pair of primers of SEQ ID NO: 25 and SEQ ID NO: 26, and a probe of SEQ ID NO: 27; And (x) a tenth detection set consisting of a primer pair of SEQ ID NO: 28 and SEQ ID NO: 29, and a probe of SEQ ID NO: 30 sequence.

According to another embodiment of the invention, the AmpC? -Lactamase detection set in the method and kit of the present invention comprises (i) a primer pair of SEQ ID NO: 31 and SEQ ID NO: 32, An eleventh detection set of probes; (Ii) a primer pair comprising at least one reverse primer selected from the group consisting of forward primer of SEQ ID NO: 34 and SEQ ID NO: 35 and SEQ ID NO: 36, and a pair of primers comprising a probe of SEQ ID NO: 37 sequence 12 detection sets; (Iii) a 13 th detection set consisting of a primer pair of SEQ ID NO: 38 and SEQ ID NO: 39, and a probe of SEQ ID NO: 40; (Iv) a fourteenth detection set consisting of the sequence of SEQ ID NO: 41 and the sequence of SEQ ID NO: 42, and the sequence of SEQ ID NO: 43; And (v) a 15 th detection set consisting of a primer pair of SEQ ID NO: 44 and SEQ ID NO: 45 sequence and a probe of SEQ ID NO: 46 sequence.

According to another embodiment of the invention, the carbapenemase detection set in the methods and kits of the invention comprises (i) a primer pair of SEQ ID NO: 47 and SEQ ID NO: 48, and a probe of SEQ ID NO: 49 A sixteenth detection set; (Ii) a seventeenth detection set consisting of a sequence of SEQ ID NO: 50 and a sequence of SEQ ID NO: 51, and a probe of SEQ ID NO: 52; (Iii) a pair of primers of SEQ ID NO: 53 and SEQ ID NO: 54, and at least one probe selected from the group consisting of SEQ ID NO: 55 and SEQ ID NO: 56; (Iv) a 19 th detection set consisting of a sequence of SEQ ID NO: 57 and a pair of primers of SEQ ID NO: 58, and a probe of SEQ ID NO: 59; (V) a 20 th detection set consisting of a sequence of SEQ ID NO: 60 and a sequence of SEQ ID NO: 61, and a probe of SEQ ID NO: 62; (Vi) a 21st detection set consisting of a sequence of SEQ ID NO: 63 and a sequence of SEQ ID NO: 64, and a probe of SEQ ID NO: 65; (Viii) a 22nd detection set consisting of a primer pair of SEQ ID NO: 66 and a sequence of SEQ ID NO: 67, and a probe of SEQ ID NO: 68; (Iii) a 23rd detection set consisting of a sequence of SEQ ID NO: 69 and a sequence of SEQ ID NO: 70, and a probe of SEQ ID NO: 71; (Ix) a 24 th detection set consisting of a pair of primers of SEQ ID NO: 72 and SEQ ID NO: 73, and a probe of SEQ ID NO: 74; (X) a 25 th detection set consisting of a sequence of SEQ ID NO: 75 and a sequence of SEQ ID NO: 76, and a probe of SEQ ID NO: 77; (Xi) a 26 th detection set consisting of a primer pair of SEQ ID NO: 78 and SEQ ID NO: 79, and a probe of SEQ ID NO: 80; (Xii) a 27 th detection set consisting of a sequence of SEQ ID NO: 81 and a pair of primers of SEQ ID NO: 82, and a sequence of SEQ ID NO: 83; (Xiii) a 28 th detection set consisting of a primer pair of SEQ ID NO: 84 and SEQ ID NO: 85, and a probe of SEQ ID NO: 86; And (xiv) one or more detection sets selected from the group consisting of SEQ ID NO: 87 sequence and a 29 th detection set consisting of a primer pair of SEQ ID NO: 88 sequence and a probe of SEQ ID NO: 89 sequence.

According to one embodiment of the invention, the methods and kits of the invention comprise a forward primer of SEQ ID NO: 90 sequence and one reverse primer selected from the group consisting of SEQ ID NO: 91 and SEQ ID NO: 92 sequence Primer pair, and an internal control detection set consisting of a probe of Sequence Listing 93 sequence.

Real-time PCR is a technique for real-time monitoring and analysis of the increase in PCR amplification products (Levak KJ, et al. , PCR Methods Appl. , 4 (6): 357-62 (1995)). The PCR reaction can be monitored by recording fluorescence emission in each cycle during the exponential phase, during which the increase in PCR product is proportional to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the C t value (cycle threshold). A pronounced increase in fluorescence above the baseline value measured between 3-15 cycles implies detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) Conventional PCR is measured in plateau, while real-time PCR is performed during the exponential growth phase Data can be obtained; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) The degraded probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA without separation by electrophoresis is possible; (g) using a small amplicon size can achieve increased amplification efficiency; And (h) the risk of contamination is low.

When the amount of PCR amplified acid reaches a detectable amount by fluorescence, the amplification curve begins to occur, and the signal rises exponentially to reach the stagnation state. The higher the amount of initial DNA, the faster the amplification curve because the amount of amplified acid is less than the detectable amount of cycles. Therefore, when real-time PCR is performed using a stepwise diluted standard sample, an amplification curve is obtained in which the initial DNA amount is lined up in the order of the same intervals. Here, when a threshold is set at a proper point, a point C t at which the threshold value and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection methods are largely an interchelating method (SYBR Green I method) and a method using a fluorescent label probe (TaqMan probe method). Since the interchelating method detects double stranded DNA, it is possible to construct a reaction system at low cost without preparing a gene-specific probe. The method using a fluorescent label probe is costly, while the detection specificity is high, so even the similar sequence can be detected. According to certain embodiments of the invention, the methods and kits of the present invention utilize the TaqMan probe method.

First, the interchelating method is a method using a double-stranded DNA-binding die, in which an amplicon production including non-specific amplification and primer-dimer complexes is performed using a non-sequence specific fluorescent intercalating reagent (SYBR Green I or ethidium bromide) . The reagent does not bind ssDNA. SYBR Green I is a fluorescent dye that binds to the minor groove of double-stranded DNA. It is an interchelator that shows little fluorescence in solution but strong fluorescence when combined with double-stranded DNA (Morrison TB, Biotechniques. 24 (6): 954-8, 960, 962 (1998)). Thus, the amount of amplification product can be measured since fluorescence is released through the linkage between SYBR Green I and double stranded DNA. SYBR green-silk-time PCR is accompanied by optimization procedures such as melting point or dissociation curve analysis for amplicon identification. Normally, SYBR green is used in a singleplex reaction, but can be used in a multiplex reaction if accompanied by a melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8 12: 3832-40 (2002); and Vrettou C., et al. , Hum. Mut. , Vol 23 (5): 513-521 (2004)).

The C t (cycle threshold) value is the number of cycles over which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the number of initial copies. Therefore, the C t value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The C t value is the cycle in which the increase of DELTA Rn is detected for the first time. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and? Rn denotes the fluorescence emission intensity (normalized reporter signal) of the reporter die divided by the fluorescence emission intensity of the reference die. The C t value is also referred to as Cp (crossing point) in the LightCycler. The C t value indicates when the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear phase represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

TaqMan probes, on the other hand, typically contain primers (e.g., 20-30 nucleotides) that include a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ) Lt; RTI ID = 0.0 > oligonucleotides. ≪ / RTI > The excited fluorescent material transfers energy to nearby quenchers rather than to fluorescence (Chen et al. , Proc Natl Acad Sci USA , 94 (20): 10756-61 1997). Therefore, when the probe is normal, no fluorescence is generated. The TaqMan probes are designed to anneal to internal parts of the PCR product. Specifically, the TaqMan probe can be designed as an internal sequence of the target gene fragment of the present invention.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but the fluorescence is inhibited by the quencher on the probe. During the extension reaction, the 5'to 3 'nuclease activity of the Taq DNA polymerase degrades the TaqMan probe hybridized to the template, releasing the fluorescent dye from the probe and releasing the inhibition by the quencher, indicating fluorescence. At this time, the 5'-end of the TaqMan probe should be located downstream of the 3'-terminal of the extension primer. That is, when the 3'-end of the extension primer is extended by the template-dependent nucleic acid polymerase, the 5'-to-3 'nuclease activity of the polymerase cleaves the 5'-end of the TaqMan probe, A fluorescence signal is generated.

The reporter molecule and the quencher molecule attached to the TaqMan probe include a fluorescent substance and a non-fluorescent substance. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any of those known in the art, examples of which are (the number of parentheses is the maximum emission wavelength in nanometers): Cy2 (506), YO-PRO ™ -1 509, YOYO ™ -1 509, Calcein 517, FITC 518, FluorX ™ 519, Alexa ™ 520, Rhodamine 110 520, , 5-FAM 522, Oregon Green 500 (522), Oregon Green 488 (524), RiboGreen 525, Rhodamine Green 527, Rhodamine 123 529, Magnesium Green 531, Calcium Green ™ 533, TO-PRO ™ -1 533, TOTO1 533, JOE 548, BODIPY 530/550 550, Dil 565, BODIPY TMR 568, BODIPY 558/568 ), BODIPY 564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC 572, Magnesium Orange 575, Phycoerythrin R & B 575, Rhodamine Phalloidin 575, 576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red (590), Cy3.5 (596), ROX (608), Calcium Crimson (631), R-phycocyanin (642), C-Phycocyanin (648), N-acetyl- , TOTO3 (660), DiD DilC (5) (665), Cy5 (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET 536, VIC 546, BHQ-1 534, BHQ-2 579, BHQ-3 672, Biosearch Blue 447, CAL Fluor Gold 540 544, CAL Fluor Orange 560 559, , CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM 520, Fluorescein 520, Fluorescein-C3 520, Pulsar 650 566, Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength in nanometers. According to some embodiments of the invention, the reporter molecule and the quencher molecule include Cy5, ROX, HEX, FAM, BHQ-1, BHQ-2 or Cy5.5-based labels.

Suitable reporter-quencher pairs are disclosed in many references: Pesce et al. editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al. , FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOR and CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

According to one embodiment of the present invention, the 5'-terminal of the probe of the present invention is labeled with one kind of fluorophore selected from the group consisting of Cy5, ROX, HEX, FAM and Cy5.5, -Terminal can be transformed into one kind of quencher selected from the group consisting of BHQ-1 and BHQ-2, but is not limited thereto.

The target nucleic acid used in the present invention is not particularly limited and includes all of DNA (gDNA or cDNA) or RNA molecules, more specifically cDNA. When the target nucleic acid is an RNA molecule, reverse transcription is used with the cDNA.

According to some embodiments of the present invention, the target nucleic acid of the present invention comprises a nucleic acid sample derived from a clinical sample. Methods for annealing or hybridizing a target nucleic acid to an extension primer and a probe can be carried out by a hybridization method known in the art. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and reaction time, buffer components and their pH and ionic strength depend on various factors such as the length and GC amount of the oligonucleotide and the target nucleotide sequence. Detailed conditions for hybridization can be found in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999).

The template-dependent nucleic acid polymerase used in the present invention is an enzyme having 5'to 3 'nuclease activity. The template-dependent nucleic acid polymerase used in the present invention is preferably a DNA polymerase. Typically, DNA polymerases have 5'to 3 'nuclease activity. The template-dependent nucleic acid polymerase used in the present invention includes E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Specifically, the template-dependent nucleic acid polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , Pyrococcus furiosus Pfu), Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus species, Thermus lactis, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05 , Thermotoga neapolitana and Thermosipho africanus .

A "template-dependent extension reaction" catalyzed by a template-dependent nucleic acid polymerase refers to a reaction that synthesizes a nucleotide sequence complementary to the sequence of a template.

According to some embodiments of the present invention, the real-time PCR of the present invention is performed by the TaqMan probe method.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a method for specifically detecting a? -lactam antibiotic-resistant strain by amplifying target genes using various primers and probes, and a kit using the same.

(b) The method of the present invention is characterized in that a multiplexer-and-translocation method using a β-lactamase target gene (specifically, an ESBL gene, an AmpC β-lactamase gene or a carbapenemase gene) -specific primer pair and a probe, Time PCR (multiplex real-time polymerase chain reaction), the β-lactam antibiotic-resistant strain can be detected with a very high efficiency.

(c) In addition, the kit of the present invention can easily and efficiently detect target genes in a sample through multiplex real-time PCR.

(d) Therefore, the method and kit of the present invention can selectively and easily detect the infection of? -lactam antibiotic resistant strains in a sample, and can be applied to the treatment of diseases more accurately based on the method.

Figures 1a-1e show the fluorescence results of ESBL and AmpC? -Lactamase detected using primer pairs and probes of the invention (Tube 1). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. 1A to 1E are diagrams illustrating a method of detecting a red channel (CTX-M9 group detection), an orange channel (detecting an intrinsic control group), a yellow channel (detecting a CTX-M2 group) / 25 group detection).
2A-2E are fluorescence results of ESBL and AmpC? -Lactamase detected using the primer pair and probe of the present invention (Tube 2). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. FIGS. 2A through 2E show the results of showing the Cyan (SHV detection) channel, the red channel (TEM detection), the orange channel (OXA ESBL detection), the yellow channel (VEB detection) and the green channel (PER detection).
Figures 3a-3e are fluorescence results of ESBL and AmpC? -Lactamase detected using the primer pair and probe of the present invention (Tube 3). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. 3A to 3E are results showing a Cyan channel (CMY-2 group detection), a red channel (MOX_CMY group detection), an orange channel (ACT_MIR detection), a yellow channel (ACC detection) and a green channel (DHA detection).
Figures 4a-4e are fluorescence results of carbapenemase detected using primer pairs and probes of the invention (Tube 1). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. Figures 4A through 4E are results showing the Cine channel (KPC detection), the red channel (VIM detection), the orange channel (intrinsic control detection), the yellow channel (IMP detection) and the green channel (NDM detection), respectively.
Figures 5A-5E are fluorescence results of carbapenemase detected using primer pairs and probes of the present invention (Tube 2). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. Figures 5A through 5E are the results showing the Cine channel (OXA-48 group detection), the red channel (GES detection), the orange channel (OXA-23 group detection), the yellow channel (SIM detection) and the green channel .
6A-6E are fluorescence results of carbapenemase detected using primer pairs and probes of the invention (Tube 3). The Y axis represents the fluorescence intensity (Norm. Fluoro.) Corrected according to the amplification cycle. 6A to 6E are results showing the Cine channel (OXA-24 group detection), red channel (IMI detection), orange channel (GIM detection), yellow channel (SME detection) and green channel (OXA-58 group detection) .

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Experimental Example: Characteristics of the test method

This test consists of a test for detecting ESBL (Extended-spectrum β-lactamase) and AmpC β-lactamase gene and a test for detecting carbapenemase gene. Both methods consist of three reaction tubes, each of which can be used to determine the efficiency of nucleic acid extraction and the presence or absence of PCR inhibitors by internal control of Gram-negative 16S rRNA.

ESBL and AmpC β-lactamase gene detection test tube contents Reaction tube 1: ESBL-1 CTX-M1 group, CTX-M2 group, CTX-M9 group, CTX-M8 / 25 group, Reaction tube 2: ESBL-2 EM, SHV, VEB, PER, OXA ESBL (OXA-10 group, OXA-2 group) Reaction tube 3: AmpC ACT_MIR, CMY-2 group (including LAT-1 and CFE-1), MOX_CMY group (including FOX), ACC, DHA

Carbapenemase gene detection test tube contents Reaction tube 1: Carb-1 KPC, VIM, IMP, NDM, internal control Reaction tube 2: Carb-2 XA-48, GES, SIM, SPM, OXA-23 Reaction tube 3: Carb-3 XA-24, IMI (including NMC-A), SME, OXA-58, GIM

Example 1: Primer and probe design

Mutation information of several β-lactamase genes was obtained from the National Center for Biotechnology Information (NCBI) database by referring to http://www.lahey.org/studies. Sequence data of β-lactamase gene obtained from NCBI database were analyzed by Sequencher 5.1. The number of mutations of various β-lactamase genes used in the analysis is as follows.

ESBL gene: TEM 217, SHV 184, CTX-M 150, PER 7, VEB 9, OXA-10 11, OXA-2 7

AmpC β-lactamase gene: 111 kinds of CMY, 5 kinds of ACC, 28 kinds of ACT, 12 kinds of DHA, 11 kinds of FOX, 8 kinds of MIR, 8 kinds of MOX, 1 kind of LAT, 1 kind of CFE

KPC 17, GES 24, NDM 10, VIM 40, IMP 47, IMI 4, SME 5, GIM 1, SPM 1, NMC-A 1, OXA- 23 groups 15 kinds, OXA-24 group 13 kinds, OXA-48 group 11 kinds, OXA-58 group 4 kinds

Primers and probes were designed using the region where all β-lactamase mutation genes could be detected in the alignment analysis data of each β-lactamase mutant gene sequence.

Primer and probe sequence No. group The forward primer (5'-3 ') The reverse direction (5'-3 ') The probes 5'-3 ' One CTX-M9 Group CGTTGCAGTACAGCGACAAT CAGTGCGATCCAGACGAAA Cy5.5-AAATTGATTGCCCAGCTCG-BHQ2 2 CTX-M1 Group GACGTTAAACACCGCCATTC AATGCTTTACCCAGCGTCAG Cy5-ATCCGCGTGATACCACTTCA-BHQ2 3 CTX-M2 Group TGGGTAGTGGGCGATAAAAC TGCTCCGGTTGGGTAAARTA HEX-TTATGGCACCACCAACGATAT-BHQ1 4 CTX-M8 / 25 Group GGCGCTACAGTACAGCGAYA GAACGTGTCATCSCCAATC FAM-CCATGAAYAAGCTGATTGCCC-BHQ1 5 SHV GATGAACGCTTTCCCATGAT GCGAGTAGTCCACCAGATCC Cy5.5-AACAGCTGGAGCGAAAGATCC-BHQ2 6 TEM ACGAGTGGGTTACATCGARCTG TACCGCACCACATAGCAGAA Cy5-CTCAACAGCGGTAAGATCCTTG-BHQ2 7 VEB CGATGCAAAGCGTTATGAAA GCAAAAGGTCTTGAGGGGTA HEX-CGATTGCTTTAGCCGTTTTG-BHQ1 8 PER TCAAAACTGGACSTCGATGA CTSTGGTCCTGTGGTGGTTT FAM-TGTCTGAAACCTCGCAGGC-BHQ1 9 OXA-10 Group CGAAGCCGTCAATGGTGT TGCGYTGGGGATCTTAAATG ROX-CTTAGCTCGTGCATCAAAGGAA-BHQ2 10 OXA-2 Group CCCTTTCGGGTAGAACATCA GTCTTTGCACGCAGTATCCA ROX-CGCTTGGTCAAGGATCTCAT-BHQ2 11 CMY-2 group (including LAT-1 and CFE-1) GTTCAGGAGAAAACGCTCCA CGGCCAGTTCAGCATCTC Cy5.5-ACTGGCGTATTGGYGATATGTAC-BHQ2 12 MOX_CMY group (with FOX) ATGGCAAGGCCCACTAYTT GGTCTTGCTCACGGAWCCTA Cy5-TCAGCGAGCAGACCSTGTT-BHQ2 TTGCTGACCGAGCCAATCT 13 ACC CTGCCATATCCGGTWTCTCT GTAGCCACGCTTTTCGTCAT HEX-CTCACCGGTAACGATATGGC-BHQ1 14 DHA GTGAAATCCGCCTCAAAAGA ACATTGCCATTTCCAGATCC FAM-ATGAATATGGAGCCGTCACG-BHQ1 15 ACT_MIR CCTCTCTGCTGCGCTTYTA TGGCGTTGGCRTAAAGAC ROX-CARAACTGGCAGCCGCA-BHQ2 16 KPC CGGAACCATTCGCTAAACTC GTATCCATCGCGTACACACC Cy5.5-AACAGGACTTTGGCGGCT-BHQ2 17 VIM AGGTCCGRCTTTACCAGATT GAGACCATTGGACGGGTASA Cy5-TGGTGTTTGGTCGCATATCG-BHQ2 18 IMP GCGCGGCTATAAAATMAAAGG GCATACGTGGGGATAGATYGA HEX-ATTTCCATAGCGACAGCACG-BHQ1 HEX-CATTTtCATAGCGACAGCACG-BHQ1 19 NDM CCTGATCAAGGACAGCAAGG TAGTGCTCAGTGTCGGCATC FAM-CAAGTCGCTCGGCAATCT-BHQ1 20 OXA-48 Group GGAATGAGAATAAGCAGCAAGG GCGATCAAGCTATTGGGAAT Cy5.5-CAAGCATTTTTACCCGCATC-BHQ2 21 GES GAGAAGCTAGAGCGCGAAAA GATCTCTCCTTGGGGATCG Cy5-AGATCGGTGTTGCGATCGT-BHQ2 22 SIM CAACACATTTCCACGACGAC GCATATGTGGGGATGGACTT HEX-CTGCTGGGATAGAGTGGCTT-BHQ1 23 SPM TTTTGTTTGTTGCTCGTTGC CTTGGTCGCCGTTAGATTGT FAM-CTGCAAAAAGTTCGGATCATG-BHQ1 24 OXA-23 Group GATCGGTTGGAGAACCAGA TTTCCCAAGCGGTAAATGAC ROX-TAAATGGAAGGGCGAGAAAA-BHQ2 25 OXA-24 Group CAAGACGGACTGGCCTAGA GGGGCCAACTAACCAAAART Cy5.5-TGCAGAAAGAAGTAAAGCGGG-BHQ2 26 IMI (including NMC-A) AGCCTGAAAACCCTTGCTCT CACCGGTTGTGTTACCCTTT Cy5-TGAGCGTGAAAAGGAAACCT-BHQ2 27 SME GTTAGATCGCTGGGAACTGG AGCTTTTGGCGTTGAAGTGT HEX-ACACTGCAATCCCAGGAGAT-BHQ1 28 OXA-58 Group TGGGTTGGTATGTGGGTTTT TCACCAGCTTTCATTTGCAT FAM-CAAGTGGTGGCATTTGCTTT-BHQ1 29 GIM GCCGGTTCCTACCCACTACT ATCCTCTGTATGCCCAGCAC ROX-AATTCACACTGGGAAATGGG-BHQ2 30 Control group AGTCCGGATTGGRGTCTGC AAGGCCCGGGAACGTATT ROX- TGAAGTCGGAATCGCTAGTAATCG-BHQ2 ACAAGACCCGGGAACGTATT

Example 2: Multiple real-time PCR

2-1. Isolation of nucleic acid

222 strains of Gram-negative bacteria isolated from clinical specimens and 22 strains of standard strains with confirmed β-lactamase genotype in Table 4 were extracted and analyzed.

Strains and source Related genes CCARM 274 TEM 15-1 CCARM 275 TEM 15-2 CCARM 276 TEM 52-1 CCARM 277 TEM 52-2 CCARM 278 PSE 1-1 CCARM 279 PSE 1-2 CCARM 280 CMY 1 CCARM 281 SHV 12 CCARM 282 SHV 2a CCARM 283 CTX-M 14 CCARM 284 OXA-10 NCCP 14570 VIM-2 NCCP 14573 IMP-6 NCCP 15675 NDM-1 NCCP 15676 KPC-2 NCCP 14571 IMP-1 NCCP 14572 IMP-6 NCCP 15782 NDM-1 NCCP DNA 1 GES-5 NCCP DNA 2 OXA-232 NCCP DNA 3 KPC-4 NCCP DNA 4 KPC-4

CCARM: Culture Collection of Antimicrobial Resistant Microbes

NCCP: National Culture Collection for Pathogen

2-2. Primer-probe mix

Three types of primer-probe mix tubes were prepared for each test. Each tube contains the same amount of forward primer and reverse primer specific to the corresponding beta-lactamase gene.

ESBL and AmpC β-lactamase gene detection test tube contents amount Tube 1: ESBL-1 CTX-M9 Group Primer 5 pmole / μl CTX-M9 Group Probe 2 pmole / μl CTX-M1 Group Primer 5 pmole / μl CTX-M1 Group Probe 2 pmole / μl CTX-M2 Group Primer 5 pmole / μl CTX-M2 Group Probe 2 pmole / μl CTX-M8 / 25 Group Primer 5 pmole / μl CTX-M8 / 25 Group Probe 2 pmole / μl Control primer 5 pmole / μl Control probe 2 pmole / μl Tube 2: ESBL-2 SHV primer 5 pmole / μl SHV probe 2 pmole / μl TEM primer 5 pmole / μl TEM probe 2 pmole / μl VEB Primer 5 pmole / μl VEB probe 2 pmole / μl PER primer 5 pmole / μl PER probe 2 pmole / μl OXA-10 Group Primer 5 pmole / μl OXA-10 Group probes 2 pmole / μl OXA-2 group primer 5 pmole / μl OXA-2 Group probes 2 pmole / μl Tube 3: AmpC CMY-2 Group Primer 5 pmole / μl CMY-2 group probe 2 pmole / μl MOX_CMY Group Primer 5 pmole / μl MOX_CMY group probe 2 pmole / μl ACC primer 5 pmole / μl ACC probe 2 pmole / μl DHA primer 5 pmole / μl DHA probe 2 pmole / μl ACT_MIR primer 5 pmole / μl ACT_MIR probe 2 pmole / μl

Carbapenemase gene detection test tube contents amount Tube 1: Carb-1 KPC primer 5 pmole / μl KPC probe 2 pmole / μl VIM primer 5 pmole / μl VIM probe 2 pmole / μl IMP primer 5 pmole / μl IMP probe 2 pmole / μl NDM primer 5 pmole / μl NDM probe 2 pmole / μl Control primer 5 pmole / μl Control probe 2 pmole / μl Tube 2: Carb-2 OXA-48 Group Primer 5 pmole / μl OXA-48 Group probes 2 pmole / μl GES Primer 5 pmole / μl GES probes 2 pmole / μl SIM primer 5 pmole / μl SIM probe 2 pmole / μl SPM primer 5 pmole / μl SPM probe 2 pmole / μl OXA-23 Group Primer 5 pmole / μl OXA-23 Group probes 2 pmole / μl Tube 3 OXA-24 group primer 5 pmole / μl OXA-24 Group Probe 2 pmole / μl IMI Primer 5 pmole / μl IMI probe 2 pmole / μl SME primer 5 pmole / μl SME probe 2 pmole / μl OXA-58 Group Primer 5 pmole / μl OXA-58 Group 2 pmole / μl GIM primer 5 pmole / μl GIM probes 2 pmole / μl

2-3. Multiple real-time polymerase chain reaction

Real-time PCR was performed using Rotor-Gene multiplex PCR Kit (QIAGEN Inc., Germantown, MD, USA). Multiple real-time PCR was performed using Rotor-Gene Q (QIAGEN Inc., USA). 40 cycles were performed with one cycle of denaturation at about 95 ° C for about 5 minutes, denaturation at about 95 ° C for about 15 seconds, annealing at about 60 ° C for about 15 seconds, and extension at one cycle. At this time, the composition of the reactants performing the multi-real-time PCR is shown in Table 7 below. Each primer-probe mix contained the same amount of forward primer (5 pmole / μl) and 2 pmole / μl of the forward primer and reverse primer to detect the corresponding β-lactamase gene, respectively. Thus, 2.5 μl of the primer-probe mix used in the reaction will contain 12.5 pmoles of forward and reverse primers and 5 pmoles of probe, respectively. Therefore, the total volume of the reactants to be subjected to the polymerase chain reaction is 25 μl, so that the concentration of the primer detecting the β-lactamase gene is 0.5 μM (12.5 pmoles / 25 μl) and the probe is 0.2 μM (5 pmole / ) Was used.

ingredient Volume ([mu] l) density 2X Rotor-Gene Multiplex PCR Master Mix 12.5 1X Primer-probe mix Primer (5 pmole / l) - probe (2 pmole / l) 2.5 0.5 μM - 0.2 μM Nuclease deficiency 5 - Sample DNA template 5 - all 25 -

Fluorescence generated by the probe in the binding and extension steps during the multi-real-time PCR is measured in a Rotor-Gene Q (QIAGEN Inc., USA). The multi-real-time PCR method is a method for detecting and quantifying fluorescence in real time every cycle of a real-time PCR using the principle of DNA polymerase and fluorescence resonance energy transfer (FRET) . If the FAM TM color development on the real-time monitor the green channel (510 ± 5 nm), when the color developing Hex TM yellow channel (555 ± 5 nm), orange channel if ROX TM color development (610 ± 5 nm), Cy5 TM (660 +/- 10 nm) in the case of color development, and 712 log pass in the case of Cy5.5 TM color development. Fluorescence was observed in the green channel, the yellow channel, the orange channel, the red channel, and the crimson channel.

2-4. result

For each tube, set the threshold value for all channels to 0.02 and check the Ct value. If a peak is observed at a Ct value < 36, the reading is positive.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Hyunil-bio Co. <120> PN <130> PN140045 <160> 93 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M9 group Forward primer <400> 1 cgttgcagta cagcgacaat 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTX-M9 group Reverse primer <400> 2 cagtgcgatc cagacgaaa 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTX-M9 group Probe <400> 3 aaattgattg cccagctcg 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M1 group Forward primer <400> 4 gacgttaaac accgccattc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M1 group Reverse primer <400> 5 aatgctttac ccagcgtcag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M1 group Probe <400> 6 atccgcgtga taccacttca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M2 group Forward primer <400> 7 tgggtagtgg gcgataaaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M2 group Reverse primer <400> 8 tgctccggtt gggtaaarta 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CTX-M2 group Probe <400> 9 ttatggcacc accaacgata t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTX-M8 / 25 group Forward primer <400> 10 ggcgctacag tacagcgaya 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTX-M8 / 25 group Reverse primer <400> 11 gaacgtgtca tcsccaatc 19 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CTX-M8 / 25 group Probe <400> 12 ccatgaayaa gctgattgcc c 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SHV Forward primer <400> 13 gatgaacgct ttcccatgat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SHV Reverse primer <400> 14 gcgagtagtc caccagatcc 20 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SHV Probe <400> 15 aacagctgga gcgaaagatc c 21 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TEM Forward primer <400> 16 acgagtgggt tacatcgarc tg 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TEM Reverse primer <400> 17 taccgcacca catagcagaa 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TEM Probe <400> 18 ctcaacagcg gtaagatcct tg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VEB Forward primer <400> 19 cgatgcaaag cgttatgaaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VEB Reverse primer <400> 20 gcaaaaggtc ttgaggggta 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VEB Probe <400> 21 cgattgcttt agccgttttg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PER Forward primer <400> 22 tcaaaactgg acstcgatga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PER Reverse primer <400> 23 ctstggtcct gtggtggttt 20 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PER Probe <400> 24 tgtctgaaac ctcgcaggc 19 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> OXA-10 group Forward primer <400> 25 cgaagccgtc aatggtgt 18 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-10 group Reverse primer <400> 26 tgcgytgggg atcttaaatg 20 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OXA-10 group Primer <400> 27 cttagctcgt gcatcaaagg aa 22 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-2 group Forward primer <400> 28 ccctttcggg tagaacatca 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-2 group Reverse primer <400> 29 gtctttgcac gcagtatcca 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-2 group Probe <400> 30 cgcttggtca aggatctcat 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> CMY-2 group (included LAT-1, CFE-1) Forward primer <400> 31 gttcaggaga aaacgctcca 20 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> CMY-2 group (included LAT-1, CFE-1) Reverse primer <400> 32 cggccagttc agcatctc 18 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> CMY-2 group (included LAT-1, CFE-1) Probe <400> 33 actggcgtat tggygatatg tac 23 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MOX_CMY group (included FOX) Forward primer <400> 34 atggcaaggc ccactaytt 19 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MOX_CMY group (included FOX) Reverse primer1 <400> 35 ggtcttgctc acggawccta 20 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MOX_CMY group (included FOX) Reverse primer2 <400> 36 ttgctgaccg agccaatct 19 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MOX_CMY group (included FOX) Probe <400> 37 tcagcgagca gaccstgtt 19 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACC Forward primer <400> 38 ctgccatatc cggtwtctct 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACC Reverse primer <400> 39 ctgccatatc cggtwtctct 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACC Probe <400> 40 ctcaccggta acgatatggc 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHA Forward primer <400> 41 gtgaaatccg cctcaaaaga 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHA Reverse primer <400> 42 acattgccat ttccagatcc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHA Probe <400> 43 atgaatatgg agccgtcacg 20 <210> 44 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ACT-MIR Forward primer <400> 44 cctctctgct gcgcttyta 19 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ACT-MIR Reverse primer <400> 45 tggcgttggc rtaaagac 18 <210> 46 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ACT-MIR Probe <400> 46 caraactggc agccgca 17 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KPC Forward primer <400> 47 cggaaccatt cgctaaactc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KPC Reverse primer <400> 48 gtatccatcg cgtacacacc 20 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KPC Probe <400> 49 aacaggactt tggcggct 18 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VIM Forward primer <400> 50 aggtccgrct ttaccagatt 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VIM Reverse primer <400> 51 gagaccattg gacgggtasa 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VIM Probe <400> 52 tggtgtttgg tcgcatatcg 20 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IMP Forward primer <400> 53 gcgcggctat aaaatmaaag g 21 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IMP Reverse primer <400> 54 gcatacgtgg ggatagatyg a 21 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IMP Probe1 <400> 55 atttccatag cgacagacacg 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IMP Probe2 <400> 56 cattttcata gcgacagcac g 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDM Forward primer <400> 57 cctgatcaag gacagcaagg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDM Reverse primer <400> 58 tagtgctcag tgtcggcatc 20 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NDM Probe <400> 59 caagtcgctc ggcaatct 18 <210> 60 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OXA-48 group Forward primer <400> 60 ggaatgagaa taagcagcaa gg 22 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-48 group Reverse primer <400> 61 gcgatcaagc tattgggaat 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-48 group Probe <400> 62 caagcatttt tacccgcatc 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GES Forward primer <400> 63 gagaagctag agcgcgaaaa 20 <210> 64 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GES Reverse primer <400> 64 gatctctcct tggggatcg 19 <210> 65 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GES Probe <400> 65 agatcggtgt tgcgatcgt 19 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIM Forward primer <400> 66 caacacattt ccacgacgac 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIM Reverse primer <400> 67 gcatatgtgg ggatggactt 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIM Probe <400> 68 ctgctgggat agagtggctt 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPM Forward primer <400> 69 ttttgtttgt tgctcgttgc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPM Reverse primer <400> 70 cttggtcgcc gttagattgt 20 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPM Probe <400> 71 ctgcaaaaag ttcggatcat g 21 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-23 group Forward primer <400> 72 gatcggattg gagaaccaga 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-23 group Reverse primer <400> 73 tttcccaagc ggtaaatgac 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-23 group Probe <400> 74 taaatggaag ggcgagaaaa 20 <210> 75 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> OXA-24 group Forward primer <400> 75 caagacggac tggcctaga 19 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-24 group Reverse primer <400> 76 ggggccaact aaccaaaart 20 <210> 77 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OXA-24 group Probe <400> 77 tgcagaaaga agtaaagcgg g 21 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IMI (included NMC-A) Forward primer <400> 78 agcctgaaaa cccttgctct 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > IMI (included NMC-A) Reverse primer <400> 79 caccggttgt gttacccttt 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IMI (included NMC-A) Probe <400> 80 tgagcgtgaa aaggaaacct 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SME Forward primer <400> 81 gttagatcgc tgggaactgg 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SME Reverse primer <400> 82 agcttttggc gttgaagtgt 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SME Probe <400> 83 acactgcaat cccaggagat 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-58 group Forward primer <400> 84 tgggttggta tgtgggtttt 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-58 group Reverse primer <400> 85 tcaccagctt tcatttgcat 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OXA-58 group Probe <400> 86 caagtggtgg catttgcttt 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GIM Forward primer <400> 87 gccggttcct acccactact 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GIM Reverse primer <400> 88 atcctctgta tgcccagcac 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GIM Probe <400> 89 aattcacact gggaaatggg 20 <210> 90 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Internal control forward primer <400> 90 agtccggatt ggrgtctgc 19 <210> 91 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Internal control reverse primer1 <400> 91 aaggcccggg aacgtatt 18 <210> 92 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Internal control reverse primer2 <400> 92 acaagacccg ggaacgtatt 20 <210> 93 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Internal control probe <400> 93 tgaagtcgga atcgctagta atcg 24

Claims (17)

A method for detecting an? -Lactam antibiotic-resistant strain comprising the steps of:
(a) preparing a sample;
(b) amplifying the target nucleotide sequence in the sample using an extended-spectrum? -lactamase (ESBL) detection set; And
(c) confirming the amplification result with fluorescence,
Said ESBL detection set comprising (i) a first detection set consisting of a primer pair of Sequence Listing first sequence and Sequence Listing second sequence, and a probe of Sequence Listing third sequence; (Ii) a second detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and a probe of SEQ ID NO: 6; (Iii) a third detection set consisting of a sequence of SEQ ID NO: 7 and a sequence of SEQ ID NO: 8, and a probe of SEQ ID NO: 9; (Iv) a fourth detection set consisting of a pair of primers of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12; (V) a fifth detection set consisting of a sequence of SEQ ID NO: 13 and a sequence of SEQ ID NO: 14, and a probe of SEQ ID NO: 15; (Vi) a sixth detection set consisting of a primer pair of SEQ ID NO: 16 and SEQ ID NO: 17, and a probe of SEQ ID NO: 18; (Viii) a seventh detection set consisting of a pair of primers of SEQ ID NO: 19 and SEQ ID NO: 20, and a probe of SEQ ID NO: 21; (Viii) an eighth detection set consisting of a pair of primers of SEQ ID NO: 22 and SEQ ID NO: 23, and a probe of SEQ ID NO: 24; (Viii) a ninth detection set consisting of a pair of primers of SEQ ID NO: 25 and SEQ ID NO: 26, and a probe of SEQ ID NO: 27; And (x) a tenth detection set consisting of a primer pair of SEQ ID NO: 28 and SEQ ID NO: 29, and a probe of SEQ ID NO: 30.
delete delete delete The method according to claim 1, wherein the amplification in step (b) is performed according to a polymerase chain reaction (PCR).
6. The method according to claim 5, wherein the amplification is performed according to real-time PCR.
7. The method according to claim 6, wherein the real-time PCR is performed by a TaqMan probe method.
7. The method of claim 1, wherein the detection set comprises a forward primer of SEQ ID NO: 90 and a pair of primers comprising one reverse primer selected from the group consisting of SEQ ID NO: 91 and SEQ ID NO: 92, Lt; RTI ID = 0.0 &gt; of-93 &lt; / RTI &gt; sequence.
(i) a first detection set consisting of a primer pair of Sequence Listing first sequence and Sequence Listing second sequence, and a probe of Sequence Listing third sequence; (Ii) a second detection set consisting of a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5, and a probe of SEQ ID NO: 6; (Iii) a third detection set consisting of a sequence of SEQ ID NO: 7 and a sequence of SEQ ID NO: 8, and a probe of SEQ ID NO: 9; (Iv) a fourth detection set consisting of a pair of primers of SEQ ID NO: 10 and SEQ ID NO: 11, and a probe of SEQ ID NO: 12; (V) a fifth detection set consisting of a sequence of SEQ ID NO: 13 and a sequence of SEQ ID NO: 14, and a probe of SEQ ID NO: 15; (Vi) a sixth detection set consisting of a primer pair of SEQ ID NO: 16 and SEQ ID NO: 17, and a probe of SEQ ID NO: 18; (Viii) a seventh detection set consisting of a pair of primers of SEQ ID NO: 19 and SEQ ID NO: 20, and a probe of SEQ ID NO: 21; (Viii) an eighth detection set consisting of a pair of primers of SEQ ID NO: 22 and SEQ ID NO: 23, and a probe of SEQ ID NO: 24; (Viii) a ninth detection set consisting of a pair of primers of SEQ ID NO: 25 and SEQ ID NO: 26, and a probe of SEQ ID NO: 27; And (x) one or more extended-spectrum beta-lactamase (ESBL) sequences selected from the group consisting of a primer pair of SEQ ID NO: 28 and SEQ ID NO: 29, and a tenth detection set consisting of a probe of SEQ ID NO: A kit for detecting a? -Lactam antibiotic-resistant strain comprising a detection set.
delete delete delete 10. The kit for detecting an antibiotic-resistant strain according to claim 9, wherein the kit is performed according to real-time PCR.
14. The kit for detecting an antibiotic-resistant strain according to claim 13, wherein the real-time PCR is performed by a TaqMan probe method.
10. The kit of claim 9, wherein the kit comprises a forward primer of SEQ ID NO: 90 and a pair of primers comprising one reverse primer selected from the group consisting of SEQ ID NO: 91 and SEQ ID NO: 92, Lt; RTI ID = 0.0 &gt; (3-lactam &lt; / RTI &gt; antibiotic-resistant strain). 10. The kit for detecting a? -Lactam-resistant antibiotic-resistant strain according to claim 9, wherein the kit is carried out by additionally using an AmpC? -Lactamase detection set and a carbapenemase detection set.
10. The kit of claim 9, wherein the kit further comprises an AmpC? -Lactamase detection set and a carbapenemase detection set.
KR1020140021327A 2014-02-24 2014-02-24 METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS KR101473444B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020140021327A KR101473444B1 (en) 2014-02-24 2014-02-24 METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS
PCT/KR2015/000802 WO2015126069A1 (en) 2014-02-24 2015-01-26 Method for detecting β-lactam antibiotic-resistant strain

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140021327A KR101473444B1 (en) 2014-02-24 2014-02-24 METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS

Related Child Applications (2)

Application Number Title Priority Date Filing Date
KR1020140071353A Division KR101606528B1 (en) 2014-06-12 2014-06-12 Methods for Detecting Bacteria Having Resistance to β-lactam Antibiotics
KR1020140071352A Division KR101606523B1 (en) 2014-06-12 2014-06-12 Methods for Detecting Bacteria Having Resistance to β-lactam Antibiotics

Publications (1)

Publication Number Publication Date
KR101473444B1 true KR101473444B1 (en) 2014-12-18

Family

ID=52679079

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140021327A KR101473444B1 (en) 2014-02-24 2014-02-24 METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS

Country Status (2)

Country Link
KR (1) KR101473444B1 (en)
WO (1) WO2015126069A1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J. Antimicrob. Chemother., Vol. 68, Suppl. 1, i57-i65 (2013.05.)*

Also Published As

Publication number Publication date
WO2015126069A1 (en) 2015-08-27

Similar Documents

Publication Publication Date Title
KR101403507B1 (en) Methods for Selectively Detecting Mycobacterium tuberculosis complex and Nontuberculous mycobacteria and Kits Using the Same
KR101380414B1 (en) Methods for simultaneously detecting multiple respiratory viruses and uses thereof
KR101865899B1 (en) Diagnostic Kit for Simultaneously Detecting Mycobacterium complex, Non-tuberculosis Mycobacteria and Multidrug-resistant Tuberculosis
KR101865898B1 (en) Diagnostic Kit for Simultaneously Detecting Mycobacterium Complex and Non-tuberculosis Mycobacteria
KR20220098113A (en) Kits for Detecting Carbapenem Resistant Enterobacteriaceae
KR101443716B1 (en) Methods for Simultaneously Detecting Nontuberculous mycobacteria and Kits Using the Same
KR20190124059A (en) Kits for Detecting Pathogens of Sexually Transmitted Infections
KR101289310B1 (en) Methods and kits for detecting methicillin-resistant staphylococcus aureus
KR101378920B1 (en) Methods for selectively detecting a braf mutation and kits using the same
KR101473444B1 (en) METHODS FOR DETECTING BACTERIA HAVING RESISTANCE TO β-LACTAM ANTIBIOTICS
KR101443715B1 (en) Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same
KR101614916B1 (en) Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same
KR101606530B1 (en) Methods for Simultaneously Detecting HLA-B*27 and HLA-B*51 and Uses Thereof
KR101606528B1 (en) Methods for Detecting Bacteria Having Resistance to β-lactam Antibiotics
KR101606523B1 (en) Methods for Detecting Bacteria Having Resistance to β-lactam Antibiotics
KR102250629B1 (en) A composition for detecting antibiotics-resistant bacteria and a method for detecting antibiotics-resistant bacteria using the same
KR102260992B1 (en) A composition for detecting antibiotics-resistant bacteria and a method for detecting antibiotics-resistant bacteria using the same
KR102238514B1 (en) A composition for detecting antibiotics-resistant bacteria and a method for detecting antibiotics-resistant bacteria using the same
KR101614918B1 (en) Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same
KR101614921B1 (en) Methods for Simultaneously Detecting Vancomycin-Resistant Enterococci and Kits Using the Same
KR20240058025A (en) Primer sets for rapid detection of Escherichia coli O110, O113, O167 or O116 serotype and a method of detecting a serotype of Escherichia coli using the same
KR20240058019A (en) Primer sets for rapid detection of Escherichia coli O127, O128ac or O86 serotype and a method of detecting a serotype of Escherichia coli using the same
KR20240058023A (en) Primer sets for rapid detection of Escherichia coli O104, O124, O55, O157, O128ab, O76, O185, O130, O81, O11 or O153 serotype and a method of detecting a serotype of Escherichia coli using the same
KR20240058020A (en) Primer sets for rapid detection of Escherichia coli O146 or O51 serotype and a method of detecting a serotype of Escherichia coli using the same
KR20240058021A (en) Primer sets for rapid detection of Escherichia coli O103, O121, O123, O136, O156, O168, O170, O174, O3, O40, O64, O66, O6, O78, O80, O82, O88, O8, O91, O181 or O111 serotype and a method of detecting a serotype of Escherichia coli using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170928

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20181002

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20191002

Year of fee payment: 6