KR102030245B1 - Oligonucleotide set for detection of chikungunya virus and uses thereof - Google Patents

Abstract

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 5 and a primer pair consisting of the base sequence of SEQ ID NO: 1 and 2; And a second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 6; and an oligonucleotide set for chikungunya virus detection is provided.

Description

Oligonucleotide set for detecting chikungunya virus and its use {OLIGONUCLEOTIDE SET FOR DETECTION OF CHIKUNGUNYA VIRUS AND USES THEREOF}

The present invention relates to a set of oligonucleotides for detecting chikungunya virus and uses thereof.

Chikkununta is a viral disease transmitted to humans from a mosquito that is infected with the Chikungunya virus. Chikungunya causes high fever and severe joint pain and may involve other symptoms such as muscle pain, headache, nausea, fatigue and rash. Joint pain caused by chikungunya sometimes weakens the body, and the duration of pain varies. Most patients recover completely from joint pain but sometimes last for months to years.

Chikungunya and dengue fever have the same clinical signs, so in areas where dengue is common, mischief can be misdiagnosed as dengue. Chikungunya occurs in Africa, Asia, and the Indian subcontinent (where India, Pakistan, and Bangladesh are located), and in recent decades, chikungunya mosquitoes have spread to Europe and the Americas. For the first time, a localized chikungunya outbreak was reported in northeastern Italy in 2007, and has since been confirmed in France and Croatia.

Chikungunya is destructive in nature, sometimes prohibiting free movement of the body for long periods of time, and has a great social impact. The name Chikkununya, originated from one of the African languages, Maconde, means `` pain and bend over '' and refers to a patient who bends forward because of joint pain caused by chikungunya.

As a method for determining whether Chikungunya virus is infected, a virus gene is detected from blood and a specific IgM antibody is detected from serum. Among them, ELISA is a common method for using antibodies.

ELISA is a method that can be diagnosed according to the color development by performing IgM antibody test on the patient's sample. Chikungunya virus and dengue virus infections have very similar symptoms, but each virus has a different treatment and can pose a fatal risk if other virus therapies are used in the patient. I need a way.

Existing virus culture method has been limited in efficiency because it takes more than two weeks. Recently, as a molecular diagnostic test, a method of diagnosing chikungunya virus using a polymerase chain reaction (PCR) has been actively conducted, but with high accuracy without cross-reaction with other viruses with similar symptoms. The diagnostic methods that can be detected have been insufficiently studied.

The present invention is to solve the above-mentioned problems of the prior art, an object of the present invention is to provide a set of oligonucleotides that can detect only Chikungunya virus accurately and quickly and without cross-reaction with heterologous viruses.

However, the problem to be solved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 5 and a primer pair consisting of the base sequence of SEQ ID NO: 1 and 2; And a second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 6; and an oligonucleotide set for chikungunya virus detection is provided.

According to one side, the first and second oligonucleotide set may specifically bind to the TF (transframe fusion protein) gene of the chikungunya virus.

According to one side, a fluorophore may be labeled at the 5 'end of each probe, and a quencher may be labeled at the 3' end of each probe.

According to one side, the fluorophore is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein), tetra Chloro-6-carboxyfluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7-phenyl-1 , 4-dichloro-6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein), 5 -((2-aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5, Cyanine- 5), lucifer yellow, texas red, tetramethylrhodamine, yakima yellow, and cal fluor red 610 (CFR) Line from the military There may be more than one chosen.

According to one side, the quencher is tetramethyl rhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethylaminophenylazophenyl- It may be one or more selected from the group consisting of 4-maleimide (4-dimethylaminophenylazophenyl-4-maleimide), carboxytetramethylrhodamine and BHQ dyes.

According to one embodiment of the invention, there is provided a chikungunya virus detection composition comprising the oligonucleotide set.

According to one embodiment of the invention, there is provided a kit for detecting chikunguna virus, comprising the composition.

According to one embodiment of the invention, (a) extracting a nucleic acid in a biological sample obtained from a subject; (b) mixing the composition with the nucleic acid; And (c) amplifying the nucleic acid to determine whether the chikungunya virus infection; provides a method of providing information for diagnosing chikungunya virus infection.

The oligonucleotide set of the present invention can specifically bind to specific genes of chikungunya virus to detect chikungunya virus accurately and quickly without cross-reaction with other viruses.

It is to be understood that the effects of the present invention are not limited to the above effects, and include all effects deduced from the configuration of the invention described in the detailed description or claims of the present invention.

1 is an electrophoresis result showing a PCR amplification band for the Chikungunya virus gene of an oligonucleotide set according to an embodiment of the present invention.
Figure 2 shows the detection result for each target gene for the chikungunya virus of the oligonucleotide set according to an embodiment of the present invention.
Figure 3 is the result of measuring the detection sensitivity of the chikungunya virus type of the oligonucleotide set according to an embodiment of the present invention.
Figure 4 shows the results of electrophoresis by concentration for the chikungunya virus of the oligonucleotide set according to an embodiment of the present invention.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. Various modifications may be made to the embodiments described below. The examples described below are not intended to be limited to the embodiments and should be understood to include all modifications, equivalents, and substitutes for them.

The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting of examples. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, action, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be construed as having meanings consistent with the meanings in the context of the related art and shall not be construed in ideal or excessively formal meanings unless expressly defined in this application. Do not.

In addition, in describing the embodiment, when it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

According to one embodiment of the invention, the first oligonucleotide set comprising a primer consisting of a base pair of SEQ ID NO: 5 and a primer pair consisting of the base sequence of SEQ ID NO: 1 and 2; And a second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 6; and an oligonucleotide set for chikungunya virus detection is provided.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, which can hybridize with a complementary template to form base pairs and copy template strands. By a short nucleic acid sequence that serves as a starting point for. The primers can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) at appropriate buffers and temperatures.

In this case, the first and second oligonucleotide sets may specifically bind to the transframe fusion protein (TF) gene of chikungunya virus. The TF protein is a protein that functions to stabilize the viron structure, and the first and second oligonucleotides may exhibit excellent detection sensitivity to Chikungunya virus by targeting the TF protein coding gene.

Specifically, the primer pair constituting the first oligonucleotide set may correspond to the 7281 th to 7453 th nucleotide sequences (172 bp) of the entire Chikungunya virus gene, and the probe sequences 7392 th to 7417 th nucleotides. (26 bp).

In addition, the primer pair constituting the second oligonucleotide set may correspond to the 7975th to 8152th base sequence (177bp) of the entire Chikungunya virus gene, and the probe may be the 8093th to 8116th base sequence ( 24bp).

As used herein, the term “viral gene” may refer to a concept that includes not only the viral genome itself, but also any RNA or DNA (eg, cDNA) derived therefrom.

The primer is a primer specific for a specific protein gene of Chikungunya virus, and may be preferably composed of forward and reverse nucleic acids having 10 to 50 nucleotide sequences. The primers may incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.

In addition, the primer nucleic acid sequence may, if necessary, include a label that can be detected directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioisotopes (eg ³² P), fluorescent molecules, chemical groups (eg biotin), and the like. It is not limited.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several to several hundred bases capable of specific binding with mRNA. The probe is labeled so that the presence of a particular mRNA can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

A fluorophore may be labeled at the 5 'end of each probe, and a quencher may be displayed at the 3' end of each probe. Accordingly, in the state in which the probe is bound to the 5'-UTR present in the sample, color development is restricted by mutual interference between the fluorophore and the quencher, and the fluorophore labeled at the 5 'end is decomposed during the amplification process. On the other hand, the quencher labeled at the 3 'end undergoes color reaction. By such a color reaction, it is possible to determine whether Chikungunya virus is present from the sample.

The fluorophore that can be labeled at the 5 'end is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein ), Tetrachloro-6-carboxyfluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7- phenyl-1,4-dichloro-6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein ), 5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5) , Cyanine-5), lucifer yellow, texas red, tetramethylrhodamine, yakima yellow (YG), and Cal Fluor Red 610 (CFR) Group consisting of And from one or more can be selected, and preferably may be a FAM, but is not limited to such.

In addition, the quencher that can be labeled at the 3 'end is tetramethylrhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethyl It may be one or more selected from the group consisting of 4-dimethylaminophenylazophenyl-4-maleimide, carboxytetramethylrhodamine, and BHQ dyes, but is not limited thereto. .

As described above, when the RT-PCR is performed using a fluorescently labeled probe and the amplified product is detected, the amplified product can be monitored in real time, thereby accurately quantifying DNA and RNA. In addition, this method eliminates the need for electrophoresis, which allows for quick and easy interpretation and reduces the risk of contamination.

Oligonucleotide sets comprising the primers and probes can improve detection sensitivity compared to existing primers and probes by targeting and amplifying different genes of chikungunya virus. In this case, the improvement in detection sensitivity means a decrease in nonspecific detection of viruses other than Chikungunya virus.

According to one embodiment of the invention, there is provided a chikungunya virus detection composition comprising the oligonucleotide set, and a kit comprising the same.

When the composition or kit is used in RT-PCR, it may optionally further comprise an amplification mixture for performing RT-PCR. Amplification mixtures for carrying out RT-PCR are reagents necessary for carrying out amplification reactions, such as buffers, reverse transcriptases having RNase H activity, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermal stability DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu), DNA polymerase cofactors such as Mg ²⁺ , dNTPs (dATP, dCTP, dGTP, and dGTP) and the like. have.

The compositions and kits may include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and inhibitors that inhibit the activity of DNA polymerases. In addition, the compositions and kits may include reagents, such as the reagents required to perform negative and positive control reactions or the buffers required for hybridization reactions. The optimal amount of reagent used in a particular reaction can be readily determined by one skilled in the art. Typically, the kits of the present invention may comprise the aforementioned components in a separate package or compartment.

The kind, base sequence, target gene, etc. of specific primers and probes included in the composition and kit are the same as described above.

According to one embodiment of the invention, (a) extracting a nucleic acid in a biological sample obtained from a subject; (b) mixing the composition with the nucleic acid; And (c) amplifying the nucleic acid to determine whether the chikungunya virus infection; provides a method of providing information for diagnosing chikungunya virus infection.

In the step (a), the biological sample means a sample taken from the subject to check whether the chikungunya virus is infected, and may include a sample such as blood, serum, saliva, or sputum, but is not limited thereto. .

In the step (b), the nucleic acid may mean RNA, and the composition is the same as described above. All enzymes used in the amplification reaction may be active under the same reaction conditions. The buffer ensures that all enzymes are close to the optimum reaction conditions, so that the amplification process can be performed in a single reactant without changing conditions such as addition of the reactants.

In step (c), multiple real-time RT-PCR may be performed using each oligonucleotide set and nucleic acid. In carrying out multiple real-time RT-PCR, conditions suitable for the primers and probes to hybridize to template RNA may be employed. Suitable hybridization conditions can be determined in a series of steps by an optimization procedure. This procedure may be carried out by a person skilled in the art in a series of procedures for protocol establishment. For example, conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength depend on various factors such as oligonucleotide length and GC content, target nucleotide sequence and the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are described for the purpose of illustrating the present invention, but the scope of the present invention is not limited thereto.

Example  1: Sample preparation

5 ml of the liquid medium (RPMI 1640, Gibco), which was incubating the Chikungunya virus, was extracted, placed in a 15 ml tube, and centrifuged at 3,000 rpm for 10 minutes. After completion of centrifugation, the pellet was discarded and only the supernatant was harvested and used as an RNA template for PCR.

Example  2: primer  And Probe  making

TF (transframe fusion protein) gene was selected as a target gene for chikungunya virus detection.

Primers and probes were designed by selecting regions with no genetic homology with other viruses through comparison of the entire sequence of each target gene, and the specific sequences are shown in Table 1 below.

At this time, FAM was labeled with a fluorophore at the 5 'end of the probe for two types of target genes, and BHQ-1 (Black Hole Quencher 1) was labeled with a quencher at the 3' end.

target
gene Kinds order
number order
(5 '→ 3') location
(Length) size
(bp) TF protein primer_F One GATAGAAGACGAGCGCTG 7281 (18) 174 primer_R 2 GAAGCTCAGAGGACCCG 7437 (17) probe 5 GTGGTAATGTCCATGGCCACC 7392 (26) TF protein primer_F 3 GACCATCGATAACGCGGACC 7975 (20) 177 primer_R 4 TACTCAGGAGGCCGGTTC 8135 (18) probe 6 AAACCGGAGGGGTACTACAACT 8093 (24)

Example  3: Chikungunya  Virus detection

RT- using a DiaStar ^TM OneStep Multiplex qRT-PCR kit (SRQ11-K100, Solgent) to confirm the operation of the primer and probe of Example 2 with respect to the RNA of Chikungunya virus prepared according to Example 1 above PCR was performed. Specific components and conditions for the PCR reaction are shown in Tables 2 and 3, respectively.

ingredient Volume (μl) 5X Reaction buffer 5 Enzyme buffer 2 primer_F (10pmol) One primer_R (10 pmol) One probe (10 pmol) One template RNA 5 Distilled water 10 all 25

step Temperature (℃) time Cycle reverse transcription 50 30min - pre-denaturation 95 15min - denaturation 95 30sec 35 annealing 60 40sec elongation 72 30sec

To confirm the results of Chikungunya virus detection, real-time RT-PCR was performed by adding Chikungunya virus template RNA with both oligonucleotide sets (primer and probe) mixed, and PCR amplification products were transferred to agarose gel. The resulting bands were confirmed by electrophoresis (FIG. 1). In addition, the results of amplification according to PT-PCR are shown in Table 4 and FIG. 2. In Table 4 and FIG. 1, CHIV1 denotes a TF protein gene amplified by the primers of SEQ ID NOs: 1 and 2 and the probe of SEQ ID NO: 5, and CHIV2 is represented by the primers of SEQ ID NOs: 3 and 4 and the probe of SEQ ID NO: 6 TF protein gene to be amplified. As a negative control, RNA extracted from human plasma was used.

Sample Ct RFU CHIV1 23.93 407 CHIV2 24.51 1159 Negative control N / A 206 Distilled water N / A 145

Referring to Table 4 and FIG. 2, the oligonucleotide set according to Example 2 specifically binds to TF protein of chikungunya virus, and it can be confirmed that all of them specifically detect only chikungunya virus.

Example  4: detection limit measurement

In order to confirm the detection sensitivity of the primer and probe of Example 2, RT-PCR for each serotype was performed by step dilution of the template RNA sample prepared according to Example 1 at a concentration of 10 ⁹ to 10 ⁰ copy number. . Except for the concentration of RNA samples, specific experimental conditions were performed in the same manner as in Example 3.

For comparison of detection sensitivity, an oligonucleotide set (primer and probe) described in Korean Patent Publication No. 10-2011-0118176 (hereinafter referred to as "Comparative Example") was used as a control. The experimental results are shown in Table 5 and FIG. 3.

Log10
Dilution Ct value Example 2 Comparative example 1.00E + 7 18.28 14.53 1.00E + 6 20.93 16.31 1.00E + 5 23.88 19.08 1.00E + 4 26.59 22.13 1.00E + 3 29.48 25.37 1.00E + 2 32.16 28.79 1.00E + 1 35.18 32.81 1.00E + 0 37.10 N / A

Referring to the results of Table 5 and FIG. 3, the oligonucleotide set of Example 2 may detect the chikungunya virus up to 1.00 × 10 ⁰ , while the oligonucleotide set of the comparative example may detect up to 1.00 × 10 ¹ . there was. Therefore, it can be seen that the oligonucleotide set of Example 2 exhibits 10 times higher detection sensitivity than that of the comparative example, thereby showing better detection efficiency.

Example  5: electrophoresis analysis

The PCR product amplified in Example 4 was electrophoresed on a 3% agarose gel, and the band appeared. Figure 4 shows the electrophoresis results for the PCR product of Example 4.

Referring to FIG. 4, the oligonucleotide set of Example 2 showed a clearer band than that of the comparative example to detect the chikungunya virus to a lower concentration, and the nonspecific response to other viruses other than the chikungunya virus was also significantly reduced. It can be confirmed that the detection sensitivity is excellent.

Although the embodiments have been described by the limited embodiments and the drawings as described above, various modifications and variations are possible to those skilled in the art from the above description. For example, the techniques described may be performed in a different order than the described method, and / or the components described may be combined or combined in a different form than the described method, or replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the following claims.

<110> KOREA UNIVERSITY <120> OLIGONUCLEOTIDE SET FOR DETECTION OF CHIKUNGUNYA VIRUS AND USES          THEREOF <130> APC-2017-0308 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific forward primer <400> 1 gatagaagac gagcgctg 18 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific reverse primer <400> 2 gaagctcaga ggacccg 17 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific forward primer <400> 3 gaccatcgat aacgcggacc 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific reverse primer <400> 4 tactcaggag gccggttc 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific probe <400> 5 gtggtaatgt ccatggccac c 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Chikungunya TF protein specific probe <400> 6 aaaccggagg ggtactacaa ct 22

Claims (8)

A first oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and a probe consisting of the nucleotide sequences of SEQ ID NO: 5; And
And a second oligonucleotide set comprising a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 and a probe consisting of the nucleotide sequences of SEQ ID NO: 6; and an oligonucleotide set for detecting chikungunya virus.
The method of claim 1,
The first and second oligonucleotide set specifically binds to the transframe fusion protein (TF) gene of the chikungunya virus, chikungunya virus detection oligonucleotide set.
The method of claim 1,
Fluorophore is labeled at the 5 'end of each probe,
An oligonucleotide set for detecting chikungunya virus having a quencher labeled at the 3 'end of each probe.
The method of claim 3, wherein
The fluorophore is fluorescein (fluorescein), 6-carboxyfluorescein (FAM, 6-carboxyfluorescein), hexachloro-6-carboxyfluorescein (HEX, hexachloro-6-carboxyfluorescein), tetrachloro-6-carboxy Fluorescein (TET, tetrachloro-6-carboxyfluorescein), 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC, 2-chloro-7-phenyl-1,4-dichloro- 6-carboxyfluorescein), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (JOE, 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein), 5-((2- Aminoethyl) amino) naphthalene-1-sulfonic acid (5-((2-aminoethyl) amino) naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cy5, Cyanine-5), lucifer yellow one selected from the group consisting of lucifer yellow, texas red, tetramethylrhodamine, Yakima Yellow (YG), and Cal Fluor Red 610 (CFR) this A, chikun gunya oligonucleotide sets for virus detection.
The method of claim 3, wherein
The quencher is tetramethylrhodamine (TAMRA, tetramethylrhodamine), 4- (4-dimethylaminophenylazo) benzoic acid (4- (4-dimethylaminophenylazo) benzoic acid), 4-dimethylaminophenylazophenyl-4-maleimide ( At least one selected from the group consisting of 4-dimethylaminophenylazophenyl-4-maleimide, carboxytetramethylrhodamine and BHQ dyes, BHQ dyes oligonucleotide set for virus detection.
A composition for detecting chikungunya virus, comprising the oligonucleotide set of any one of claims 1 to 5.
Chikungunya virus detection kit comprising the composition of claim 6.
(a) extracting the nucleic acid in the biological sample obtained from the subject;
(b) mixing the nucleic acid composition with the composition of claim 6; And
(C) amplifying the nucleic acid to determine whether the chikungunya virus infection; comprising, information providing method for diagnosing chikungunya virus infection.

Images