CN112430686B

CN112430686B - Kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3

Info

Publication number: CN112430686B
Application number: CN202011330477.8A
Authority: CN
Inventors: 周伟光; 彭雪松; 徐晓静; 关平原; 希尼尼根; 张志丹; 温永俊; 张七斤
Original assignee: Inner Mongolia Agricultural University
Current assignee: Inner Mongolia Agricultural University
Priority date: 2020-11-24
Filing date: 2020-11-24
Publication date: 2022-07-05
Anticipated expiration: 2040-11-24
Also published as: CN112430686A

Abstract

The invention relates to the field of virus detection, in particular to a kit, a primer and a probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3. The nucleotide sequences of the primers and the probes in the kit are shown as SED ID NO 1-SEQ ID NO 6. The invention provides a triple fluorescence quantitative RT-PCR detection method based on TaqMan technology, which is used for rapidly identifying BVDV genotype, has the characteristics of rapidness, high sensitivity and high specificity, and can be used for virus typing in research or diagnosis application of BVDV.

Description

Kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3

Technical Field

The invention relates to the field of virus detection, in particular to a kit, a primer and a probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3.

Background

Bovine Viral Diarrhea Virus (BVDV) is a member of the genus Pestivirus (Pestivirus) of the family Flaviviridae, four members of the genus BVDV-1, BVDV-2, Classical Swine Fever Virus (CSFV) and ovine Border Disease Virus (BDV). The viral genome consists of a single-stranded RNA of about 12.3kb in length. It consists of a large Open Reading Frame (ORF) and two untranslated regions (5 'UTR and 3' UTR). A single ORF can encode 12 smaller proteins: npro, C, Erns, E1, E2, p7, NS2/NS3, NS4A, NS4B, NS5A, NS 5B. In all genomic regions, 5' UTR, Npro and E2 were used extensively for homology alignment and phylogenetic analysis.

At present, BVDV has been reported to have three genotypes, BVDV-1, BVDV-2 and BVDV-3. BVDV-1 causes symptoms such as fever, diarrhea and acute and chronic mucosal diseases, and the systematic development analysis based on 5' UTR, Npro and E2 regions of BVDV shows that BVDV-1 has at least 21 subtypes (1 a-1 u). Acute infection caused by BVDV-2 usually presents as symptoms of fever, diarrhea, thrombocytopenia, hemorrhage and the like, and can also cause abortion, congenital malformation of dead and newborn calves, immunosuppression and the like of cows, so that the acute infection is more serious in harm to the cows. At present, Giangaspero et al classify BVDV-2 into 4 subtypes (2 a-2 d). BVDV-3 is a newly emerged pestivirus infecting cattle, the clinical manifestation pattern of the virus is similar to the clinical symptoms caused by BVDV-1 and BVDV-2, and the amino acid sequence of BVDV-3 has higher homology but obviously different antigenicity compared with BVDV-1 and BVDV-2. Therefore, it is important to detect the virus by genotyping. There are many methods for detecting BVDV typing currently, most of them cannot detect BVDV-3 or detect BVDV-3 with low efficiency, and recently, fluorescent quantitative RT-PCR capable of detecting BVDV-3 has been established, but cannot detect BVDV-1 and BVDV-2 simultaneously. 1

At present, the detection method for the BVDV pestivirus mainly comprises etiology detection, serology detection and molecular biology detection. The etiology detection includes electron microscope inspection and indirect immunofluorescence staining (IFA), but the electron microscope inspection has higher requirements on equipment, and is only suitable for laboratory inspection; the IFA technology is long in detection period, complex to operate and not suitable for large-scale screening of large-scale cattle farms; the most widely used serological assay is the enzyme-linked immunosorbent assay (ELISA). Commercial antigen capture ELISA kits can be used to confirm BVDV infection, but cannot distinguish between HoBi pestivirus and BVDV infection. The molecular biological detection comprises reverse transcription-polymerase chain reaction (RT-PCR) and gene chip, but the gene chip is expensive and the screening cost is extremely high

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a kit for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3.

The second invention aims to provide a primer and a probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3.

The third object of the present invention is to provide recombinant plasmids containing gene fragments for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3, respectively.

In order to achieve the purpose of the invention, the technical scheme is as follows:

the invention provides a kit for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3, which comprises a nucleic acid amplification reagent, wherein the nucleic acid amplification reagent comprises a primer and a probe for detecting BVDV-1, BVDV-2 and BVDV-3,

the nucleotide sequence of an upstream primer for detecting BVDV-1 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of a probe is shown as SEQ ID NO. 4;

the nucleotide sequence of an upstream primer for detecting BVDV-2 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of a probe is shown as SEQ ID NO. 5;

the nucleotide sequence of the upstream primer for detecting BVDV-3 is shown as SEQ ID NO. 2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the probe is shown as SEQ ID NO. 6.

Optionally, the 5 'end of the probe is connected with a fluorescent group, and the 3' end of the probe is connected with a fluorescence quenching group;

preferably, the fluorescent group of SEQ ID NO. 4 is selected from Cy5, the fluorescence quenching group is selected from BHQ2, the fluorescent group of SEQ ID NO. 5 is selected from Quasar-705, the fluorescence quenching group is selected from BHQ3, the fluorescent group of SEQ ID NO. 6 is selected from ROX, and the fluorescence quenching group is selected from BHQ 1.

Optionally, the concentration of SEQ ID NO 1 is 600-800 nmol/L, the concentration of SEQ ID NO 2 is 250-350 nmol/L, the concentration of SEQ ID NO 3 is 850-1150 nmol/L, and the concentration of SEQ ID NO 4 is 400-500 nmol/L; the concentration of SEQ ID NO. 5 is 600-700 nmol/L and the concentration of SEQ ID NO. 6 is 300-400 nmol/L;

preferably, the concentration of SEQ ID NO 1 is 800nmol/L, the concentration of SEQ ID NO 2 is 250nmol/L, the concentration of SEQ ID NO 3 is 1050nmol/L, the concentration of SEQ ID NO 4 is 500nmol/L, the concentration of SEQ ID NO 5 is 700nmol/L and the concentration of SEQ ID NO 6 is 350 nmol/L.

Optionally, the nucleic acid amplification reagent further comprises GoTaq Probe qPCRMaster Mix, script TMRT-MIX for 1-Step RT-qPCR2 x.

Optionally, the kit contains a reference substance for quantification, the reference substance contains three recombinant plasmids, and the three recombinant plasmids respectively contain nucleotide sequences shown by SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9;

preferably, the kit contains a negative control and a positive control, the negative control is non-enzyme water, the positive control contains three recombinant plasmids, and the three recombinant plasmids respectively contain nucleotide sequences shown in SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9.

Optionally, the sample to be detected of the kit is a bovine nasal swab and a fecal sample.

The invention also relates to a primer and a probe for detecting BVDV-1, BVDV-2 and BVDV-3, wherein the nucleotide sequence of an upstream primer for detecting BVDV-1 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the probe is shown as SEQ ID NO. 4;

The invention also relates to a recombinant plasmid containing the nucleotide sequence shown by SEQ ID NO. 7.

The invention also relates to a recombinant plasmid containing the nucleotide sequence shown by SEQ ID NO. 8.

The invention also relates to a recombinant plasmid containing the nucleotide sequence shown by SEQ ID NO. 9.

The invention has at least the following beneficial effects:

the invention provides a triple fluorescent quantitative RT-PCR detection method based on TaqMan technology, which is used for rapidly identifying BVDV genotype. Has the characteristics of rapidness, high sensitivity and high specificity, and can be used for virus typing in research or diagnosis application of BVDV. The method of the invention is more sensitive and less time consuming to detect than PT-PCR.

The BVDV-1, BVDV-2 and BVDV-3 triple one-step fluorescence quantitative RT-PCR kit established by the invention has good repeatability, and the ratio of the number of the primers to the number of the primers is 10⁴～10⁶The copies were reproducible within and between the 3 gradient range (CV)<0.02); the sensitivity of the kit of the invention BVDV-1 and BVDV-3 reaches 10 copies/mu L, and the sensitivity of BVDV-2 reaches 100 copies/mu L; the BVDV triple fluorescence quantitative RT-PCR detection method established by the invention can only detect the nucleic acids of BVDV-1, BVDV-2 and BVDV-3, and has no specific amplification curve to other virus nucleic acids. The established triple fluorescent quantitative RT-PCR of the BVDV is used for detecting bovine nasal swab and fecal swab samples, the accuracy rate is 100%, and a reliable method is provided for early diagnosis of the virus and molecular epidemic virus investigation.

Drawings

FIG. 1 is a pMD19T-BVDV-1RT-PCR electrophoresis chart, M is 500bp DNA Marker, 1 is negative control, 2-3 are pMD19T-BVDV-1RT-PCR products;

FIG. 2 is a pMD19T-BVDV-2RT-PCR electrophoresis chart, M is 500bp DNA Marker, 1 is negative control, 2-3 is pMD19T-BVDV-2RT-PCR product;

FIG. 3 is a diagram of the PCR electrophoresis of PUC57-BVDV-3RT-PCR, wherein M is a 500bp DNA Marker, 1 is a negative control, and 2-3 are PUC57-BVDV-3RT-PCR products;

FIG. 4 shows the results of the concentration optimization of triple fluorescent quantitative RT-PCR primers, wherein the concentrations of 1-9 are respectively 150nmol/L, 200nmol/L, 250nmol/L, 300nmol/L and 350nmol/L, 400nmol/L, 450nmol/L, 500nmol/L and 550nmol/L, and 10 is negative control;

FIG. 5 shows the results of the concentration optimization of triple fluorescent quantitative RT-PCR probes, wherein the concentrations of 1-9 are respectively 300nmol/L and 350nmol/L, 400nmol/L, 450nmol/L, 500nmol/L, 550nmol/L, 600nmol/L, 650nmol/L, 700nmol/L, and 10 is negative control;

FIG. 6 shows the amplification curve of triple fluorescent quantitative RT-PCR standard curve, 1-5 is 1X 10⁸copies/μL～1×10³copies/. mu.L, 7 is negative control;

FIG. 7 is a triple fluorescent quantitative RT-PCR standard curve;

FIG. 8 shows the results of triple fluorescent quantitative RT-PCR sensitivity assays, 1-8 is 1X 10¹～1×10⁸copies/. mu.L, 9 is negative control;

FIG. 9 shows the result of detection of BVDV-1 sensitivity in triple fluorescent quantitative RT-PCR, 1-8 is 1X 10¹～1×10⁸copies/. mu.L, 9 is negative control;

FIG. 10 shows the result of sensitivity test of BVDV-1 by ordinary RT-PCR, where M is DL 500DNA Marker, 1-9 is 1X 10⁸～1×10⁰A copies/mu L plasmid template amplification band, and 10 is a negative control;

FIG. 11 shows the result of detection of BVDV-2 sensitivity in triple fluorescent quantitative RT-PCR, 1-8 is 1X 10¹～1×10⁸copies/. mu.L, 9 is negative control;

FIG. 12 shows the result of sensitivity test of BVDV-2 by ordinary RT-PCR, where M is DL 500DNA Marker, 1-9 is 1X 10⁸～1×10⁰A copies/mu L plasmid template amplification band, and 10 is a negative control;

FIG. 13 shows the result of detection of BVDV-3 sensitivity in triple fluorescent quantitative RT-PCR, 1-8 is 1X 10¹～1×10⁸copies/. mu.L, 9 is negative control;

FIG. 14 shows the result of sensitivity detection of BVDV-3 by ordinary RT-PCR, where M is DL 500DNA Marker, 1-9 is 1X 10⁸～1×10⁰A copies/mu L plasmid template amplification band, and 10 is a negative control;

FIG. 15 shows the specific detection results of triple fluorescence quantitative RT-PCR, where BVDV-1 and BVDV-2 are RNA and BVDV-3 is a synthetic plasmid; 1 are negative controls and other viral nucleic acids, respectively;

FIG. 16 shows the result of repetitive detection of triple fluorescence quantitative RT-PCR, 1 is 1X 10⁶copies/. mu.L, 2 is 1X 10⁵copies/. mu.L, 3 is 1X 10⁴copies/. mu.L, 4 is negative control;

FIG. 17 shows that 7 BVDV-1 positive morbid substances, 1 positive, 2 detected 7 positive morbid substances, and 3 other negative morbid substances and negative controls were detected from 30 calf feces samples by triple quantitative RT-PCR;

FIG. 18 triple quantitative RT-PCR method 5 BVDV-1 positive pathogens were detected from 28 nasal swab samples. 1 is positive, 2 is 7 detected positive pathological materials, and 3 is other negative pathological materials and negative control;

FIG. 19 is a primer screening chart of BVDV-1; m is 500marker, 1 is a target band amplified by primers BVDV-1-F2 and BVDV-1-R2, 2 is a target band amplified by primers BVDV-1-F2 and BVDV-1-R3, 3 is a target band amplified by primers BVDV-1-F3 and BVDV-1-R2, and 4 is a target band amplified by primers BVDV-1-F3 and BVDV-1-R3;

FIG. 20 is a view showing the screening of BVDV-2 primer; m is 500marker, 1 is a target band amplified by primers BVDV-2-F2 and BVDV-1-R2, 2 is a target band amplified by primers BVDV-2-F2 and BVDV-2-R3, 3 is a target band amplified by primers BVDV-2-F3 and BVDV-2-R2, and 4 is a target band amplified by primers BVDV-2-F3 and BVDV-2-R3;

FIG. 21 shows a BVDV-3 primer screening map; m is 500marker, 1 is a target strip amplified by primers BVDV-3-F1 and BVDV-3-R2, 2 is a target strip amplified by primers BVDV-3-F1 and BVDV-3-R3, 3 is a target strip amplified by primers BVDV-3-F2 and BVDV-3-R2, and 4 is a target strip amplified by primers BVDV-3-F2 and BVDV-3-R3;

FIG. 22 is a diagram showing the results of BVDV-1 nucleic acid amplification using BVDV-1, BVDV-2 universal primers BVDVF-1.2, BVDVR-1.2.3 for BVDV-1 and BVDV-2; m is 500marker, 1 is negative, 2 and 3 are target fragments expanded by BVDV-1,2-F, BVDV-1,2, 3-R; FIG. 23 is a nucleic acid result chart showing that BVDV-2 is amplified by BVDV-1, BVDV-2 universal primers BVDVF-1.2, BVDVR-1.2.3; m is 500marker, 1 is negative, 2 and 3 are target fragments expanded by BVDV-1,2-F, BVDV-1,2, 3-R;

FIG. 24 shows the target bands amplified by the upstream BVDV-3 primer and the universal downstream BVDV-1, BVDV-2, and BVDV-3 primers; m is 500marker, 1 is negative, 2 and 3 are target fragments expanded by BVDV-3-F, BVDV-1,2, 3-R;

FIG. 25 shows a double fluorescent quantitative RT-PCR of BVDV-1 and BVDV-3, wherein 1 is negative, 2 is BVDV-1, and 3 is BVDV-3;

FIG. 26 is a diagram of dual fluorescent quantitative RT-PCR of BVDV-1 and BVDV-2, wherein 1 is negative, 2 is BVDV-1, and 3 is BVDV-2;

FIG. 27 is a diagram of dual fluorescent quantitative RT-PCR of BVDV-3 and BVDV-2, wherein 1 is negative, 2 is BVDV-2, and 3 is BVDV-3;

FIG. 28 is a BVDV-1 and BVDV-2 dual fluorescence quantitative RT-PCR chart of BVDV-1 and BVDV-2 universal primers, wherein 1 is negative, 2 is BVDV-2, and 3 is BVDV-1;

FIG. 29 shows BVDV-1.2, BVDV-1.2.3 and BVDV-3-F1 primer, BVDV-1 and BVDV-3 dual fluorescent quantitative RT-PCR of BVDV-1.2.3 primer, 1 is negative, BVDV-1 is 2, BVDV-3 is 3;

FIG. 30 shows BVDVF-1.2, BVDVR-1.2.3 and BVDV-3-F1, BVDV-2 and BVDV-3 double fluorescence quantitative RT-PCR of BVDV-1.2.3 primers, 1 is negative, BVDV-2 is 2, and BVDV-3 is 3.

In which the ordinate of the RT-PCR result plot is RFU (relative fluorescence units).

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms also include the plural forms unless the context clearly dictates otherwise, and further, it is understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, devices, components, and/or combinations thereof.

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention refers to BVDV-1 published on GenBank: NADL standard beads (AJ133738), JL-1 isolate (KF501393.1), oregon c24V isolate (AF091605), 3156 isolate (JN704144), CP7 isolate (AF 220247); and BVDV-2: 890 isolate (BVU18059), XJ isolate (FJ527854.1-04), SH-28 isolate (HQ258810.1), New York'93 isolate (AF502399), SD1301 isolate (KJ 000672.1); BVDV-3: d32/00_ 'HoBi' (AB871953.1), CH-KaHo/cont (KF204448.1), Italy-68/13(KJ627179), JS12/01(JX469119), SV757/15(KY 683847); performing multi-sequence comparison by using a MegAlign program in Lasergene software, and selecting conserved sequences on BVDV-1, BVDV-2 and BVDV-35' gene fragments to respectively design and synthesize a universal upstream primer of BVDV-1 and BVDV-2, an upstream primer of BVDV-3 and a universal downstream primer of BVDV-1, BVDV-2 and BVDV-3; three specific probes are designed and synthesized respectively. The universal upstream primers of the BVDV-1 and the BVDV-2, the upstream primer of the BVDV-3 and the universal downstream primers of the BVDV-1, the BVDV-2 and the BVDV-3 are named as BVDV-1,2-F, BVDV-3-F, BVDV-1,2,3-R respectively; the fluorescence report groups at the 5' ends of the BVDV-1, BVDV-2 and BVDV-3 probes are respectively Cy5, Quasar-705 and ROX; the fluorescence quenching groups at the 3' end are BHQ2, BHQ3 and BHQ1 respectively.

Specifically, primer and probe sequences are shown in Table 1.

TABLE 1

Primer/probe	Nucleotide numbering	Sequence of	Decoration
				BVDV-1,2-F	SEQ ID NO:1	catgcccwtagtaggactagc	—
BVDV-3-F	SEQ ID NO:2	cataccttcagtaggacgagc	—
				BVDV-1,2,3-R	SEQ ID NO:3	ctcgtccacrtggcatctcga	—
BVDV-1-P	SEQ ID NO:4	gcc ctg agt aca ggg tag tcg tca gt	5’-Cy5，3’-BHQ2
				BVDV-2-P	SEQ ID NO:5	cccctgagtacagggragtcgtcat	5'Quasar-705,3’-BHQ3
BVDV-3-P	SEQ ID NO:6	gcc ccg agt acg ggg tag tcg tca at	5'ROX-705,3’-BHQ1

Specifically, the concentrations of the primers and probes are shown in Table 2.

TABLE 2

Name of primer	Range of concentration	Preferred concentration	Nucleotide numbering
				BVDV-1 upstream primer	300～400nmol/L	400nmol/L	SEQ ID NO:1
BVDV-1 downstream primer	300～400nmol/L	400nmol/L	SEQ ID NO:3
				BVDV-2 upstream primer	300～400nmol/L	400nmol/L	SEQ ID NO:1
BVDV-2 downstream primer	300～400nmol/L	400nmol/L	SEQ ID NO:3
				BVDV-3 upstream primer	250～350nmol/L	250nmol/L	SEQ ID NO:2
BVDV-3 downstream primer	250～350nmol/L	250nmol/L	SEQ ID NO:3
				BVDV-1 probe	400～500nmol/L	500nmol/L	SEQ ID NO:4
BVDV-2 probe	600～700nmol/L	700nmol/L	SEQ ID NO:5
				BVDV-3 probe	300～400nmol/L	350nmol/L	SEQ ID NO:6

Specifically, the concentration of SEQ ID NO 1 is 600-800 nmol/L, the concentration of SEQ ID NO 2 is 250-350 nmol/L, the concentration of SEQ ID NO 3 is 850-1150 nmol/L, and the concentration of SEQ ID NO 4 is 400-500 nmol/L; the concentration of SEQ ID NO. 5 is 600-700 nmol/L and the concentration of SEQ ID NO. 6 is 300-400 nmol/L;

Optionally, the nucleic acid amplification reagent of the embodiment of the invention further comprises GoTaq Probe qPCRMaster Mix, script TMRT-MIX for 1-Step RT-qPCR2 x.

Optionally, the kit of the embodiment of the invention contains a reference substance for quantification, the reference substance contains three recombinant plasmids, and the three recombinant plasmids are recombinant plasmids respectively containing nucleotide sequences shown by SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9. The reference substance is a group of mixtures formed by mixing and gradiently diluting recombinant plasmids of BVDV-1, BVDV-2 and BVDV-3 at the same concentration, and the specific concentrations are respectively as follows: 1 x 10⁸copies、1×10⁷copies、1×10⁶copies、1×10⁵copies、 1×10⁴copies、1×10³copies。

The nucleotide sequence shown in SEQ ID NO. 7 is specifically:

catgcccttagtaggactagcataatgaggggggtagcaacagtggtgagttcgttggatggcttaagccctgagtacagggtagtc gtcagtggttcgacgccttggaataaaggtctcgagatgccacgtggacgag

the nucleotide sequence shown in SEQ ID NO. 8 is specifically:

catgcccttagtaggactagcaaaataaggggggtagcaacagtggcgagttcgttggatggctgaagccctgagtacagggtagt cgtcagtggttcgacgctttggaggacaagcctcgagatgccacgtggacgag

the nucleotide sequence shown in SEQ ID NO. 9 is specifically:

ctcatgtcggcgtatatgattggctatcccaaattaataatttggtttagggactaactcccctagcgaaggccgaaatgggttaaccat accttcagtaggacgagcataatgggggactagtggtagcagtgagctccttggattaccgaagccccgagtacggggtagtcgtcaatg gttcgacgcatcaaggaatgcctcgagatgccatgtggacgagggcgtgcccacggtgaatcttaactcaagcgggggccgcttgggtga aagagggtcattatatggctctttgggagtacagcctgatagggtgttgcagagacctgctacatcactagtataaaaactctgctgtacatgg cac

optionally, the kit of the embodiment of the invention contains a negative control and a positive control, wherein the negative control is non-enzyme water, the positive control contains three recombinant plasmids, and the three recombinant plasmids are recombinant plasmids respectively containing nucleotide sequences shown by SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9.

Alternatively, BVDV infection is mainly manifested by respiratory symptoms and diarrhea, and the samples to be tested of the kit of the present embodiment are bovine nasal swab and stool sample.

The embodiment of the invention also relates to a primer and a probe for detecting BVDV-1, BVDV-2 and BVDV-3, wherein the nucleotide sequence of an upstream primer for detecting BVDV-1 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the probe is shown as SEQ ID NO. 4; the nucleotide sequence of an upstream primer for detecting BVDV-2 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of a probe is shown as SEQ ID NO. 5; the nucleotide sequence of the upstream primer for detecting BVDV-3 is shown as SEQ ID NO. 2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the probe is shown as SEQ ID NO. 6.

The reagents used in the examples and experimental examples of the present invention are: access Quick^TMRT-PCR System kits were purchased from Promega, Beijing Biotechnology Ltd; one Step qRT-PCR Kit was purchased from Promega; 6 × Loading Buffer, 500bpDNA ladder and Premix Ex Taq from TaKaRa; the kit for recovering the agarose gel was purchased from Axygen corporation; plasmid mini-extraction kit and RNase-Free ddH₂O and RNAscope Total RNA Kit were purchased from Beijing Tiangen (TIANGEN) Biotechnology Ltd.

EXAMPLE 1 kit

A test kit having the composition shown in table 3:

TABLE 3

Wherein, the mixed recombinant plasmid is a recombinant plasmid which respectively contains nucleotide sequences shown by SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9.

The use method of the kit provided by the embodiment of the invention comprises the following steps:

1. sample treatment:

nucleic acid extraction (RNA extraction using commercial kits is recommended) was performed and negative controls were processed simultaneously with the specimen. The extracted nucleic acid is recommended to be detected immediately, otherwise, the nucleic acid is required to be stored below-20 ℃.

2. Preparation of amplification reagents:

taking out corresponding PCR reaction solution from the kit, melting and uniformly mixing at room temperature, centrifuging at 2000rpm for 10s, and preparing 1 part of template PCR reaction solution system according to the following steps: 10 μ L of GoTaq Probe qPCRMaster Mix, 0.4 μ L of Script^TMRT-MIX for 1-Step RT-qPCR2x, 0.8. mu.L BVDV-1, BVDV-2 upstream and downstream primers (10. mu. mol/L) + 0.5. mu.L BVDV-3 upstream and downstream primers (10. mu. mol/L) +1. mu. LBVDV-1 probe + 1.4. mu. LBVDV-2 probe + 0.7. mu.L BVDV-3 probe, and the prepared PCR premixes were dispensed into each PCR tube at 19. mu.L/tube.

The preparation of 1 part of the reference PCR reaction solution system is the same as that of 1 part of the template PCR reaction solution system.

3. Sample adding:

and taking out the reference substance, the two groups of reference substances and the sample treatment solution in the kit, melting and uniformly mixing at room temperature, and centrifuging at 2000rpm for 10 s. Adding into the PCR tube containing the PCR premix. The total volume of each reaction system was 20. mu.l. The PCR tube was closed and centrifuged at 2000rpm for 10s before transferring to the detection amplification zone.

4. And (3) PCR amplification:

the conditions for PCR amplification are specifically shown in Table 4:

TABLE 4

5. And (3) detection:

(1) determination of the baseline: the section with smaller fluctuation and more stability of the fluorescence curve is selected as the baseline, and the user can adjust the baseline according to the actual situation. The start point is where the signal has dropped to background level and is stable, and the end point is to avoid covering where the signal has started to increase significantly.

(2) Determination of the threshold: in the case of no amplification of the negative control, the threshold is set at the highest point of the sample without amplification curve, i.e. higher than the highest point of the growth curve without amplification (i.e. no point appears in the column "Component" of the result analysis), and the initial threshold is determined on the basis that no negative control is detected.

(3) The computer automatically processes and analyzes the data.

Example 2 preparation of BVDV-1, BVDV-2, and BVDV-3 quantitative RT-PCR standards

1. The recombinant plasmids pMD19T-BVDV-1, pMD19T-BVDV-2 and PUC57-BVDV-3 were synthesized by Competition Biotechnology (Shanghai) Ltd.

BVDV-1 preparation of standard positive templates reference published on GenBank: a139 bp full-length gene sequence (SEQ ID NO:7) was prepared from NADL standard beads (AJ133738), JL-1 isolate (KF501393.1), Oregon C24V isolate (AF091605), 3156 isolate (JN704144) and CP7 isolate (AF220247), and the sequences were ligated to pMD19-T Vector cloning Vector to obtain recombinant plasmid pMD 19T-BVDV-1.

BVDV-2 preparation of standard positive templates reference published on GenBank: 890 isolate (BVU18059), XJ isolate (FJ527854.1-04), SH-28 isolate (HQ258810.1), New York'93 isolate (AF502399) and SD1301 isolate (KJ000672.1), a 139bp full-length gene sequence (SEQ ID NO:8) was synthesized and ligated to pMD19-T Vector cloning Vector to obtain recombinant plasmid pMD 19T-BVDV-2.

BVDV-3 preparation of standard positive templates reference published on GenBank: d32/00_ 'HoBi' (AB871953.1), CH-KaHo/cont (KF204448.1), Italy-68/13(KJ627179), JS12/01(JX469119) and SV757/15(KY683847) to synthesize a gene sequence (SEQ ID NO:9) with a full length of 367bp, and the sequence is connected to a PUC57 cloning vector to obtain a recombinant plasmid PUC 57-BVDV-2I.

2. Identification of recombinant plasmids

The synthesized plasmid DNA pMD19T-BVDV-1, pMD19T-BVDV-2 and PUC57-BVDV-3 are respectively used as templates for PCR amplification by using upstream and downstream specific primers. As shown in FIGS. 1,2 and 3, bands of about 139bp, 139bp and 141bp were obtained, respectively, indicating that the target gene fragment of the virus and the cloning vector pMD^TMThe 19-T Vector has been successfully connected.

Reaction system: 12.5 μ L of 2 XTaq PCR Master Mix, 9.5 μ L of RNase-Free ddH₂O, upstream and downstream primers and Mix were all 1.0. mu.L.

Reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 20s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 30s and final extension at 72 ℃ for 10min for 35 cycles.

2. Calculation and dilution of DNA copy number of BVDV-1, BVDV-2 and BVDV-3 recombinant plasmids

The concentrations of the recombinant plasmids pMD19T-BVDV-1, pMD19T-BVDV-2 and PUC57-BVDV-3 are determined and calculated by the following formula: plasmid copy number (copies/. mu.L). times.6.02 × (recombinant plasmid concentration ng/. mu.L.times.10)^-9)×10²³/(660 × recombinant plasmid base number) plasmid copy number was calculated. Positive standards were prepared by 10-fold gradient dilution of recombinant plasmids pMD19T-BVDV-1, pMD19T-BVDV-2, and PUC57-BVDV-3 using plasmid dilutions.

The concentrations of positive plasmids of BVDV-1, BVDV-2 and BVDV-3 are respectively 98.1 ng/. mu.L, 70.8 ng/. mu.L and 51.9 ng/. mu.L, and the copy number of the plasmids is 3.108 x 10 calculated by the corresponding formula¹⁰copies/μL、2.27×10¹⁰copies/μL、1.52×10¹⁰copies/. mu.L. Three plasmid DNAs were diluted to 1X 10⁹～1×10¹Nine gradients of copies/μ L were prepared as standard positive templates and then expressed as 85 μ LH₂BVDV-1, BVDV-2 and BVDV-31 x 10 are added to O respectively⁹Standard positive templates were 10. mu.L each.

Example 3 Triplex fluorescent quantitative RT-PCR reaction System and parameter optimization

The reaction parameters of the triple fluorescence quantitative RT-PCR are shown in Table 4, and the 20 mu L reaction systems of the triple fluorescence quantitative RT-PCR of BVDV-1, BVDV-2 and BVDV-3 are shown in Table 5:

10μL GoTaq Probe qPCRMaster Mix，0.4μL Script^TMRT-MIX for 1-Step RT-qPCR2x, 0.8. mu.L BVDV-1, BVDV-2 upstream and downstream primers (10. mu. mol/L) + 0.5. mu.L BVDV-3 upstream and downstream primers (10. mu. mol/L) +1. mu.L BVDV-1 Probe + 1.4. mu.L LBVDV-2 Probe + 0.7. mu.L BVDV-3 Probe.

TABLE 5

BVDV-1, BVDV-2 and BVDV-3 mixed positive plasmid samples were amplified by CFX96 Real-time PCR instrument as shown in FIG. 4 and FIG. 5, and good amplification curves were selected.

1. Primer concentration optimization

1X 10 of standard positive recombinant plasmid with BVDV-1 and BVDV-2 as templates⁶The concentrations of optimized double BVDV-1 and BVDV-3 primers are respectively extracted from the DNA of copies/mu L, and the downstream primers are respectively 400nmol/L and 250 nmol/L; the concentrations of the BVDV-1, BVDV-2 and BVDV-3 probes, which are respectively extracted, are as follows: 500nmol/L, 700nmol/L, 350nmol/L, respectively, and the concentrations of BVDV-3 primers are respectively extracted as follows: optimization of BVDV-3 primer concentration in triple quantitation was performed at 150nmol/L, 200nmol/L, 250nmol/L, 300nmol/L, and 350nmol/L, 400nmol/L, 450nmol/L, 500nmol/L, and 550 nmol/L. Reaction parameters and systems, see tables 4 and 5.

The results of the experiment are shown in FIG. 4. As can be seen from FIG. 4, the Ct value was the smallest and the primer concentration for a good amplification curve was 400 nmol/L. Therefore, the optimal primer concentration in the embodiment of the present invention is selected to be 400 nmol/L.

2. Probe concentration optimization

1 x 10 of standard positive recombinant plasmid with BVDV-1, BVDV-2 and BVDV-3 as template⁶Taking the primer concentration of the DNA of copies/mu L as the optimized concentration in the previous step, and respectively extracting the optimized probe concentrations in the double quantification of BVDV-1 and BVDV-3, wherein the concentrations are respectively as follows: 500nmol/L, 350nmol/L, and the concentrations of BVDV-2 probes aspirated respectively are: 300nmol/L, 350nmol/L, 400nmol/L, 450 nmol-L, 500nmol/L, 550nmol/L, 600nmol/L, 650nmol/L and 700nmol/L, wherein the reaction parameters and the system are referred to tables 4 and 5.

The results of the experiment are shown in FIG. 5. As can be seen from FIG. 5, the Ct value is the smallest, and the probe concentration for a good amplification curve is 700nmol/L, so the optimal probe concentration for the embodiment of the present invention is 700 nmol/L.

3. Establishment of triple fluorescent quantitative RT-PCR standard curve

The template is 1 x 10³copies/μL、1×10⁴copies/μL、1×10⁵copies/μL、1×10⁶copies/μL、1×10⁷5 standard positive plasmids are used in total in copies/mu L, the reaction is carried out by using optimal concentration of primers and probes, and a standard curve for detecting and quantifying the BVDV-1, BVDV-2 and BVDV-3 is established. As shown in fig. 6.

The regression equation of the standard curve of BVDV-1 is shown in FIG. 7 as y ═ 3.495x +37.188, respectively, and the correlation coefficient is 1;

obtaining standard curve regression equations of BVDV-2, wherein y is-3.357 x +35.454, and the correlation coefficient reaches 0.998;

the regression equation of the standard curve of BVDV-3 is-3.677 x +39.039 respectively, and the correlation coefficient reaches 0.999.

EXAMPLE 4 sensitivity test of fluorescent quantitative RT-PCR

1 × 10 mixed standard positive recombinant plasmids with BVDV-1, BVDV-2 and BVDV-3 as templates⁰copies/μL、 1×10¹copies/μL、1×10²copies/μL、1×10³copies/μL、1×10⁴copies/μL、1×10⁵copies/μL、 1×10⁶copies/μL、1×10⁷copies/μL、1×10⁸copies/. mu.L total 9 standard positive plasmids, negative control is ddH₂And O. BVDV-1, BVDV-2, and BVDV-3 were subjected to conventional PCR (reaction system: 12.5. mu.L of 2 XTaq PCR Master Mix, 9.5. mu.L of RNase-Free ddH, respectively₂O, upstream and downstream primers and Mix were all 1.0. mu.L. Reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 20s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 30s and final extension at 72 ℃ for 10min for 35 cycles. ) And triple quantitative RT-PCR (reaction parameters and systems reference tables 4 and 4)5) Thereby obtaining the lowest concentration of each genotype which can be detected by the conventional PCR and triple quantitative RT-PCR detection methods of BVDV-1, BVDV-2 and BVDV-3. The results of the experiment are shown in FIG. 8 (triple quantitative RT-PCR), FIG. 9(BVDV-1 quantitative RT-PCR), FIG. 10(BVDV-1 general RT-PCR), FIG. 11(BVDV-2 quantitative RT-PCR), FIG. 12(BVDV-2 general RT-PCR), FIG. 13 (BVDV-3 quantitative RT-PCR) and FIG. 14(BVDV-3 general RT-PCR).

As can be seen from FIG. 8, the lowest detectable concentration of the triple quantitative RT-PCR established in the practice of the present invention is 1X 10²Plasmid of copies/. mu.L; as can be seen from FIGS. 9 and 10, the lowest detectable concentration of BVDV-1 in the triple quantitative RT-PCR established in the present invention is 1X 10¹copies/. mu.L plasmid, whereas the lowest detectable concentration of conventional RT-PCR is 1X 10²copies/. mu.L of plasmid, 10-fold different; as can be seen from FIGS. 11 and 12, the lowest detectable concentration of BVDV-2 in triple quantitative RT-PCR established in the present invention is 1X 10²copies/. mu.L plasmid, whereas the lowest detectable concentration of conventional RT-PCR is 1X 10⁵copies/. mu.L of plasmid, 1000-fold different. As can be seen from FIGS. 13 and 14, the lowest detectable concentration of BVDV-3 in triple quantitative RT-PCR established in the present invention is 1X 10¹copies/. mu.L plasmid, whereas the lowest detectable concentration of conventional RT-PCR is 1X 10³copies/. mu.L of plasmid, 100-fold difference.

EXAMPLE 5 specificity test for fluorescent quantitative RT-PCR

In order to determine the specificity of the method, nucleic acids of bovine viral diarrhea virus, bovine Escherichia coli, bovine salmonella, bovine infectious rhinotracheitis virus, bovine respiratory syncytial virus, bovine rotavirus and bovine coronavirus are respectively extracted as templates, and the positive control is 1 × 10⁵Mixing copies/. mu.L BVDV-3 standard positive recombinant plasmid, BVDV-2 nucleic acid and BVDV-1 nucleic acid, and negative control ddH₂O quantitative RT-PCR was performed. Nucleic acids obtained by mixing bovine viral diarrhea virus, Escherichia coli, Salmonella, infectious bovine rhinotracheitis virus, bovine respiratory syncytial virus, bovine rotavirus and bovine coronavirus were detected using the kit of example 1 as a template. The results of the experiment are shown in FIG. 15.

As can be seen from FIG. 15, except for the BVDV-3 standard positive recombinant plasmid 1X 10⁵Mixing copies/. mu.L with BVDV-2 nucleic acid and BVDV-1 nucleic acid generated amplification curves, and nucleic acids of other viruses did not generate amplification curves.

EXAMPLE 6 reproducibility test of fluorescent quantitative RT-PCR

Selecting three standard substances with different concentrations, namely 1 × 10 standard substances mixed by standard positive recombinant plasmids of BVDV-1, BVDV-2 and BVDV-3⁴copies/μL、1×10⁵copies/. mu.L and 1X 10⁶And (3) copies/mu L, repeatedly detecting in three groups and among groups respectively, analyzing experimental data, and verifying the stability of the kit and the detection method. The template is 1 x 10⁴copies/μL～ 1×10⁶copies/. mu.L positive plasmids of 3 different concentrations were subjected to quantitative RT-PCR. The results of the experiment are shown in FIG. 16.

As can be seen from FIG. 16, the Ct values of the same template are not very different, and the amplification curves are also approximately the same; the repeated variation coefficient in groups and the repeated variation coefficient between groups with different copy numbers of the same template are both less than 2 percent, which shows that the kit and the detection method provided by the embodiment of the invention have good repeatability and stability.

Example 7 application of the quantitative RT-PCR method

The nucleic acid samples of 30 parts of cow dung swabs and 28 parts of nose swabs are detected by using a common RT-PCR method and a BVDV-1, BVDV-2 and BVDV-3 triple quantitative RT-PCR detection method established in the test, wherein mixed plasmids with the same concentrations of BVDV-1, BVDV-2 and BVDV-3 are used as positive controls, and enzyme-free water is used as a negative control. The positive control amplification results are positive, and the negative control amplification curve is not seen. 7 BVDV-1 positive morbid agents were detected from 30 calf feces samples (the results are shown in FIG. 17), and 5 BVDV-1 positive morbid agents were detected from 28 nasal swab samples.

Example 8 primer sequence screening experiments

Respectively designing two pairs of primers on 5' untranslated regions of BVDV typing virus genomes according to conserved sequences of three types of BVDV registered and submitted in GenBank; then, a universal upstream primer of BVDV-1 and BVDV-2 and a downstream primer of BVDV-1, BVDV-2 and BVDV-3 are designed, and are shown in Table 6.

TABLE 6

Respectively carrying out common PCR on the primer sequences for designing three types of BVDV

As a result: the primer sequences designed for BVDV-1, BVDV-2 and BVDV-3 were subjected to general PCR (the reaction system and procedure were the same as in example 4).

The result of primer screening for BVDV-1 is shown in FIG. 19; the result of BVDV-2 primer screening is shown in FIG. 20; the result of BVDV-3 primer screening is shown in FIG. 21; the results of amplifying BVDV-1 and BVDV-2 nucleic acids with universal primers BVDVF-1.2 and BVDV-1.2.3 of BVDV-1 and BVDV-2 are shown in FIG. 22 and FIG. 23, respectively; BVDV-3 upstream primer BVDV-3-F1 of BVDV-3 and BVDV-1, BVDV-2 and BVDV-3 universal downstream primer BVDV1.2.3 amplify the synthetic plasmid of BVDV-3, as shown in FIG. 24.

According to the experimental results shown in FIGS. 19-21, a single brighter band was selected as the target fragment, and three pairs of primers for BVDV-1, BVDV-2 and BVDV-3 were BVDV-1-F3 and BVDV-1-R2; BVDV-2-F3, BVDV-2-R2; BVDV-3-F2 and BVDV-3-R2 are used as primers in fluorescence quantification.

The following combinations were used to perform the multiplex fluorescence quantification assay, the specific procedure is shown in table 4 and table 5:

1X 10 of standard positive mixed recombinant plasmid of BVDV-1 and BVDV-3 of example 2 by using primers BVDV-1-F3, BVDV-1-R2, BVDV-3-F2 and BVDV-3-R2⁶FIG. 25 shows graphs of experiments performed with copies/. mu.L; 1X 10 mixed standard positive recombinant plasmids of BVDV-1 and BVDV-2 of example 2 by using primers BVDV-1-F3, BVDV-1-R2, BVDV-2-F3 and BVDV-2-R2 as templates⁶The graph of the experiments performed with copies/. mu.L is shown in FIG. 26; 1X 10 mixed standard positive recombinant plasmids of BVDV-3 and BVDV-2 of example 2 by using primers BVDV-2-F3, BVDV-2-R2, BVDV-3-F2 and BVDV-3-R2 as templates⁶FIG. 27 shows graphs of experiments performed with copies/. mu.L; 1X 1 mixed standard positive recombinant plasmids of BVDV-1 and BVDV-2 of example 2 by using primer BVDVF-1.2-F, BVDVR-1.2.3-R as template0⁶The graph of the experiment performed with copies/. mu.L is shown in FIG. 28; 1X 10 mix of standard positive recombinant plasmids of BVDV-1 and BVDV-3 of example 2 using primers BVDVF-1.2-F, BVDVR-1.2.3-R and BVDV-3-F1, BVDVR-1.2.3-R, templates⁶The graphs of experiments with copies/. mu.L are shown in FIGS. 29 and 30.

In multiple fluorescence quantitative experiments, specific operations are shown in tables 4 and 5, and a competition relationship exists among different primers, for example, CT values and fluorescence values of FIGS. 25, 26 and 27 are too different, in order to reduce the competition relationship among the different primers, the invention selects a universal primer upstream primer 1.2-F capable of simultaneously amplifying BVDV-1 and BVDV-2, a BVDV-3-F capable of amplifying BVDV-3 with strong specificity and without problems of dimer, mismatch and the like, and a downstream primer BVDV-1.2.3-R capable of simultaneously amplifying BVDV-1, BVDV-2 and BVDV-3, for example, FIGS. 28, 29 and 30. And a solid foundation is laid for the establishment of the BVDV typing triple quantitative RT-PCR detection method.

Although the present application has been described with reference to preferred embodiments, it is not intended to limit the scope of the claims, and many possible variations and modifications may be made by one skilled in the art without departing from the spirit of the application.

Sequence listing

<110> university of inner Mongolia agriculture

<120> kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

catgcccwta gtaggactag c 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cataccttca gtaggacgag c 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctcgtccacr tggcatctcg a 21

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gccctgagta cagggtagtc gtcagt 26

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cccctgagta cagggragtc gtcat 25

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gccccgagta cggggtagtc gtcaat 26

<210> 7

<211> 139

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

catgccctta gtaggactag cataatgagg ggggtagcaa cagtggtgag ttcgttggat 60

ggcttaagcc ctgagtacag ggtagtcgtc agtggttcga cgccttggaa taaaggtctc 120

gagatgccac gtggacgag 139

<210> 8

<211> 139

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

catgccctta gtaggactag caaaataagg ggggtagcaa cagtggcgag ttcgttggat 60

ggctgaagcc ctgagtacag ggtagtcgtc agtggttcga cgctttggag gacaagcctc 120

gagatgccac gtggacgag 139

<210> 9

<211> 367

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctcatgtcgg cgtatatgat tggctatccc aaattaataa tttggtttag ggactaactc 60

ccctagcgaa ggccgaaatg ggttaaccat accttcagta ggacgagcat aatgggggac 120

tagtggtagc agtgagctcc ttggattacc gaagccccga gtacggggta gtcgtcaatg 180

gttcgacgca tcaaggaatg cctcgagatg ccatgtggac gagggcgtgc ccacggtgaa 240

tcttaactca agcgggggcc gcttgggtga aagagggtca ttatatggct ctttgggagt 300

acagcctgat agggtgttgc agagacctgc tacatcacta gtataaaaac tctgctgtac 360

atggcac 367

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggaggggact agcggtagca 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agtgagtcca ttggatggcc 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ataagggggg tagcaacagt g 21

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tggtgagttc gttggatggc t 21

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggcacatctt aacccacgc 19

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgtggacgag ggcatgccca 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgggcatgcc ctcgtccacg 20

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gctgtgggca tgccctcgtc cacg 24

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ggtagcagtg agctccttgg a 21

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gctgtactcc caaagagcca 20

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

actagtgatg tagcaggtct ct 22

Claims

1. A kit for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3, which is characterized in that the kit contains a nucleic acid amplification reagent, wherein the nucleic acid amplification reagent contains a primer and a probe for detecting BVDV-1, BVDV-2 and BVDV-3,

2. The kit of claim 1, wherein the probe has a fluorophore attached to the 5 'end and a fluorescence quencher attached to the 3' end.

3. The kit according to claim 2, wherein the fluorophore of SEQ ID NO. 4 is Cy5, the fluorescence quenching group is BHQ2, the fluorophore of SEQ ID NO. 5 is Quasar-705, the fluorescence quenching group is BHQ3, the fluorophore of SEQ ID NO. 6 is ROX, and the fluorescence quenching group is BHQ 1.

4. The kit according to claim 1, wherein the concentration of SEQ ID NO 1 is 600 to 800nmol/L, the concentration of SEQ ID NO 2 is 250 to 350nmol/L, the concentration of SEQ ID NO 3 is 850 to 1150nmol/L, the concentration of SEQ ID NO 4 is 400 to 500 nmol/L; the concentration of SEQ ID NO 5 is 600-700 nmol/L and the concentration of SEQ ID NO 6 is 300-400 nmol/L.

5. The kit according to claim 1, wherein the concentration of SEQ ID NO 1 is 800nmol/L, the concentration of SEQ ID NO 2 is 250nmol/L, the concentration of SEQ ID NO 3 is 1050nmol/L, the concentration of SEQ ID NO 4 is 500nmol/L, the concentration of SEQ ID NO 5 is 700nmol/L, and the concentration of SEQ ID NO 6 is 350 nmol/L.

6. The kit according to claim 1, wherein the kit contains a reference substance for quantification, the reference substance contains three recombinant plasmids, and the three recombinant plasmids are recombinant plasmids respectively containing nucleotide sequences shown in SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9.

7. The kit according to claim 1, wherein the kit comprises a negative control and a positive control, the negative control is water without enzyme, the positive control comprises three recombinant plasmids, and the three recombinant plasmids comprise the nucleotide sequences shown in SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9 respectively.

8. A primer and probe combination for detecting BVDV-1, BVDV-2 and BVDV-3 is characterized in that the nucleotide sequence of an upstream primer for detecting BVDV-1 is shown as SEQ ID NO. 1, the nucleotide sequence of a downstream primer is shown as SEQ ID NO. 3, and the nucleotide sequence of a probe is shown as SEQ ID NO. 4;