CN111719020B - Kit, primer and probe for detecting bovine rotavirus - Google Patents
Kit, primer and probe for detecting bovine rotavirus Download PDFInfo
- Publication number
- CN111719020B CN111719020B CN202010568416.9A CN202010568416A CN111719020B CN 111719020 B CN111719020 B CN 111719020B CN 202010568416 A CN202010568416 A CN 202010568416A CN 111719020 B CN111719020 B CN 111719020B
- Authority
- CN
- China
- Prior art keywords
- probe
- kit
- primer
- pcr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention relates to the field of virus detection, in particular to a kit, primers and a probe for detecting bovine rotavirus. The invention provides a kit for detecting bovine rotavirus, which contains a nucleic acid amplification reagent, wherein the nucleic acid amplification reagent contains a primer and a probe for detecting the bovine rotavirus, and the primer comprises an upstream primer shown by SEQ ID NO. 1 and a downstream primer shown by SEQ ID NO. 2; the probe includes the probe shown by SEQ ID NO. 3. The kit has the technical advantages of high sensitivity and high specificity.
Description
Technical Field
The invention relates to the field of virus detection, in particular to a kit, primers and a probe for detecting bovine rotavirus.
Background
Rotaviruses (RV) are one of the major pathogens responsible for diarrhea in children and young stock, and have a major impact on a variety of mammals and birds in nature. Bovine Rotavirus (BRV), also known as Calf diarrhea virus (Calf diarrhea virus), belongs to the genus Rotavirus (Rotavirus) of the family reoviridae (Reoviridea). The bovine rotavirus mainly infects calves within 1 month of age, wherein the calves within 1 week of age are most susceptible, the main symptoms comprise inappetence, mental retardation, watery diarrhea and even death, the severity can be divided into asymptomatic infection, mild self-limiting diarrhea and severe diarrhea with serious dehydration and electrolyte imbalance, the morbidity of the calves infected with the virus can reach 90-100 percent, after the calves are infected with the virus, bacterial infection is easily caused secondarily, the mortality of the calves is increased, meanwhile, the growth and development of the calves are seriously influenced, and further, the production performance is influenced, and besides, the rotavirus can also infect animals such as human, sheep, piglets, dogs, cats, chickens, horses, rabbits, rhesus monkeys, mice and the like.
Calf diarrhea is one of the important causes of losses in the cattle industry, and also causes direct and indirect economic losses in beef and dairy production. There are many pathogens that cause calf diarrhea, including viruses such as BRV, bovine viral diarrhea virus, bovine coronavirus, etc., bacteria such as Salmonella, escherichia coli, etc., and parasites. Among them, BRV infection has a high morbidity and mortality, and is susceptible to secondary infections by other pathogens that cause diarrhea in calves with highly similar clinical symptoms. In addition, large-scale and intensive rearing has increased the physical contact between cattle with the development of the cattle industry. Laboratory testing is particularly important because it often leads to mixed infections of two or more pathogens, thereby accelerating the spread of the infection.
The main diagnostic methods of rotavirus at present comprise separation and identification, serum neutralization test, ELISA technology, PCR, real-time fluorescent quantitative PCR technology and the like. Virus isolation and identification are classical technical methods, but the method is complicated to operate and takes a long time for diagnosis; the serum neutralization test and the ELISA technology have simple operation, strong specificity and wide application, but the method has strict requirements in detection, and the positive rate is possibly reduced due to errors; the traditional PCR technology is developed in 1985, but the traditional PCR technology cannot quantify the template DNA, and the final result is that the template DNA can be judged only by the assistance of electrophoresis, the operation time is relatively long, and false positive can occur; higuchi et al, 1993, invented a real-time fluorescent quantitative PCR technique by combining fluorescent material with conventional PCR techniques to allow the amplified product to fluoresce. The technology integrates the spectrum technology, the traditional PCR technology and the computer technology, has high sensitivity and strong specificity, can monitor all processes of PCR amplification, and can accurately quantify samples. However, the existing PCR amplification technology has the defects of insufficient sensitivity and specificity.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first invention of the invention is to provide a kit for detecting bovine rotavirus.
The second purpose of the invention is to provide a primer and a probe for detecting bovine rotavirus.
In order to achieve the purpose of the invention, the invention adopts the technical scheme that:
the invention provides a kit for detecting bovine rotavirus, which contains a nucleic acid amplification reagent, wherein the nucleic acid amplification reagent contains a primer and a probe for detecting the bovine rotavirus, and the primer comprises an upstream primer shown by SEQ ID NO. 1 and a downstream primer shown by SEQ ID NO. 2; the probe includes a probe represented by SEQ ID NO 3.
Optionally, the 5 'end of the probe is connected with a fluorescent group, and the 3' end of the probe is connected with a fluorescence quenching group.
Optionally, the fluorescent group is selected from HEX, and the fluorescence quenching group is selected from BHQ1.
Optionally, the concentrations of the primer and the probe are respectively: the upstream primer is 350-450 nmol/L, the downstream primer is 350-450 nmol/L, and the probe is 250-350 nmol/L;
the concentrations of the primer and the probe are respectively as follows: the upstream primer is 400nmol/L, the downstream primer is 400nmol/L, and the probe is 350nmol/L.
Optionally, the nucleic acid amplification reagent further comprises 2 × Reaction Buffer, DNA polymerase and RT Enzyme Mix.
Optionally, the kit contains a reference substance for quantification, wherein the reference substance contains a recombinant plasmid, and the recombinant plasmid comprises a nucleotide sequence shown by SEQ ID NO. 4.
Optionally, the kit contains a negative control and a positive control, wherein the negative control is process water, the positive control contains a recombinant plasmid, and the recombinant plasmid contains a nucleotide sequence shown by SEQ ID NO. 4.
The invention also provides a primer and a probe for detecting the bovine rotavirus, wherein the primer comprises an upstream primer shown by SEQ ID NO. 1 and a downstream primer shown by SEQ ID NO. 2; the probe includes a probe represented by SEQ ID NO 3.
Optionally, the 5 'end of the probe is connected with a fluorescent group, and the 3' end of the probe is connected with a fluorescence quenching group, preferably, the fluorescent group is selected from HEX, and the fluorescence quenching group is selected from BHQ1.
The invention also provides a recombinant plasmid containing the nucleotide sequence shown by SEQ ID NO. 4.
The invention has at least the following beneficial effects:
the kit has the technical advantages of high sensitivity and high specificity.
Drawings
FIG. 1 is a pMD19T-BRV PCR electrophoretogram, M is 500bp DNA marker,1 is a negative control, 2-4 is a pMD19T-BRV PCR product;
FIG. 2 is a diagram showing the result of quantitative RT-PCR amplification, in which 1 is a positive plasmid, 2 is total RNA, and 3 is a negative control;
FIG. 3 shows the optimization results of the concentration of the quantitative RT-PCR primers, wherein 1-5 are respectively 300nmol/L, 350nmol/L, 400nmol/L, 450nmol/L and 500nmol/L, and 6 is a negative control;
FIG. 4 shows the optimized result of the concentration of the quantitative RT-PCR probe, wherein 1-5 are respectively 150nmol/L, 200nmol/L, 250nmol/L, 300nmol/L and 350nmol/L, and 6 is a negative control;
FIG. 5 shows the amplification curve of the quantitative RT-PCR standard curve, 1-6 is 1X 10 8 copies/μL～1×10 3 copies/. Mu.L, 7 is negative control;
FIG. 6 is a quantitative RT-PCR standard curve;
FIG. 7 shows the result of quantitative RT-PCR sensitivity test, 1-9 is 1X 10 1 ～1×10 9 copies/. Mu.L, 10 is negative control;
FIG. 8 shows the results of ordinary RT-PCR sensitivity tests, where M is DL 500DNA marker,1-9 is 1X 10 1 ～1×10 9 A copies/mu L plasmid template amplification band, and 10 is a negative control;
FIG. 9 shows the result of specific detection, wherein 1 is RNA;2 is positive plasmid; 3 is negative control and other virus nucleic acid respectively;
FIG. 10 shows the result of repetitive detection, 1 is 1X 10 6 copies/mu, 2 is 1X 10 5 copies/. Mu.L, 3 is 1X 10 4 copies/. Mu.L, 4 is negative control;
FIG. 11 shows the general RT-PCR detection results of clinical samples, where M is 500bp DNA ladder,1-13 are clinical sample amplification products, 14-15 are positive controls, and 16 are negative controls;
FIG. 12 shows the general RT-PCR detection results of clinical samples, where M is 500bp DNA ladder,17-33 are amplification products of clinical samples, 34-35 are positive controls, and 36 are negative controls;
FIG. 13 shows the results of quantitative RT-PCR based clinical sample detection, where 1 is a positive control, 2 is a negative control and 30 samples of clinical bovine diarrhea;
the invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
Detailed Description
The present invention is further illustrated by the following examples and comparative examples, which are intended to be illustrative only and are not to be construed as limiting the invention. It is intended to cover by the present invention all such modifications as come within the scope of the invention as defined by the appended claims.
In the embodiment of the invention, reference is made to VP6 whole gene sequences of BRV Sun9 isolate (AB-374146.1), KJ9-1 isolate (HM-988974.1), KJ19-2 isolate (MF-940662), KV0418 isolate (EU 873011.1), KV0426 isolate (EU 873012.1) and M-1 isolate (HM 235508.1) published in GenBank, megAlign programs in Lasergene software are utilized to carry out multiple sequence alignment, and conserved sequences on VP6 gene segments are selected to respectively design and synthesize a pair of specific primers and a probe. The upstream and downstream primers and probes are named as BRV-F1, BRV-R1 and BRV-P, respectively, the fluorescence reporter group at the 5 'end of the probe is HEX, and BHQ1 is the fluorescence quenching group at the 3' end.
Specifically, primer and probe sequences are shown in Table 1.
TABLE 1
Optionally, the concentrations of the primer and the probe are respectively: the upstream primer is 350-450 nmol/L, the downstream primer is 350-450 nmol/L, and the probe is 250-350 nmol/L.
Preferably, the concentrations of the primer and the probe are respectively: the upstream primer is 350-400 nmol/L, the downstream primer is 350-400 nmol/L, and the probe is 300-350 nmol/L
Further preferably, the concentrations of the primer and the probe are respectively: the upstream primer is 400nmol/L, the downstream primer is 400nmol/L, and the probe is 350nmol/L.
Optionally, the nucleic acid amplification reagent further comprises 2 × Reaction Buffer, DNA polymerase and RT Enzyme Mix.
Optionally, the kit contains a reference for quantification, the reference contains a recombinant plasmid, and the recombinant plasmid comprises a nucleotide sequence shown by SEQ ID NO. 4. The reference substance is a group of reagents containing recombinant plasmids with different concentrations, and the specific concentrations are as follows: 1 x 10 8 copies、1×10 7 copies、1×10 6 copies、1×10 5 copies、1×10 4 copies、1×10 3 copies。
The nucleotide sequence shown in SEQ ID NO. 4 is specifically:
gaattgaatctgcagtttgtgaatcagtgctcgccgacgcaagtgaaacaatgctagcaaatgtgacatctgttagacaagaatacgcgataccagttggacccgtttttccaccaggtatgaattggactgatttgatcactaactattcaccatctagagaggttaacttgcagcgtgtatttacagtggcttccattagaagca
optionally, the kit contains a negative control and a positive control, the negative control is process water, the positive control contains a recombinant plasmid, and the recombinant plasmid contains a nucleotide sequence shown by SEQ ID NO. 4.
The embodiment of the invention also provides a primer and a probe for detecting the bovine rotavirus, wherein the primer comprises an upstream primer shown by SEQ ID NO. 1 and a downstream primer shown by SEQ ID NO. 2; the probe includes the probe shown by SEQ ID NO. 3. The 5 'end of the probe is connected with a fluorescent group, the 3' end of the probe is connected with a fluorescence quenching group, the fluorescent group is selected from HEX, and the fluorescence quenching group is selected from BHQ1.
The embodiment of the invention also provides a recombinant plasmid containing the nucleotide sequence shown by SEQ ID NO. 4.
The reagents used in the examples and experimental examples of the present invention are:
Access Quick TM RT-PCR System kits were purchased from Promega (Beijing) Biotechnology Ltd; one Step qRT-PCR Kit was purchased from Toyo Boseki; 6 × Loading Buffer, 500bpDNA ladder and Premix Ex Taq from TaKaRa; the kit for recovering the agarose gel was purchased from Axygen corporation; plasmid mini-extraction kit and RNase-Free ddH 2 O and RNAscope Total RNA Kit was purchased from Beijing Tiangen (TIANGEN) Biotechnology, inc.
EXAMPLE 1 kit
A detection kit, the composition of which is shown in Table 2:
TABLE 2
The use method of the kit provided by the embodiment of the invention comprises the following steps:
1. sample treatment:
nucleic acid extraction (preferably using commercial kits to extract RNA) was performed, and negative controls were processed simultaneously with the specimens. The extracted nucleic acid is recommended to be detected immediately, otherwise, the nucleic acid is required to be stored below-20 ℃.
2. Preparation of amplification reagents:
taking out corresponding PCR reaction solution from the kit, melting and uniformly mixing at room temperature, centrifuging at 2000rpm for 10s, and preparing 1 part of template PCR reaction solution system according to the following steps: 10 μ L of 2 × Reaction Buffer +0.5 μ L of DNA Polymerase +0.5 μ L of RT Enzyme Mix +1.0 μ L of upstream and downstream primers (10 μmol/L) +0.5 μ L of probe +5.5 μ L of RNase-Free ddH 2 And O, respectively subpackaging the prepared PCR premixed solution into each PCR tube according to the amount of 19 mu l per tube.
The preparation of 1 part of reference PCR reaction solution system is the same as that of 1 part of template PCR reaction solution system.
3. Sample adding:
and taking out the reference substance, the two groups of reference substances and the sample treatment solution in the kit, melting and uniformly mixing at room temperature, and centrifuging at 2000rpm for 10s. The PCR solution was added to each PCR tube containing the above-mentioned PCR master mix. The total volume of each reaction system was 20. Mu.l. The PCR tube was closed and centrifuged at 2000rpm for 10s before transferring to the detection amplification zone.
4. And (3) PCR amplification:
the conditions for PCR amplification are specifically shown in Table 3:
TABLE 3
5. And (3) detection:
(1) Determination of the baseline: the section with smaller fluctuation and more stability of the fluorescence curve is selected as the baseline, and the user can adjust the baseline according to the actual situation. The start point is where the signal has dropped to background level and is stable, and the end point is to avoid covering where the signal has started to increase significantly.
(2) Determination of a threshold value: in the case of no amplification of the negative control, the threshold is set at the highest point of the sample without amplification curve, i.e. higher than the highest point of the growth curve without amplification (i.e. no point appears in the column of result analysis "Component"), and the initial threshold is determined on the basis that no negative control is detected.
(3) The computer automatically processes and analyzes the data.
EXAMPLE 2 preparation of bovine rotavirus TaqMan quantitative RT-PCR Standard
The recombinant plasmid pMD19T-BRV was synthesized by the firm of Venetian Biotechnology engineering (Shanghai). Mainly referring to VP6 complete gene sequences of BRV Sun9 isolate (AB-374146.1), KJ9-1 isolate (HM-988974.1), KJ19-2 isolate (MF-940662), KV0418 isolate (EU 873011.1), KV0426 isolate (EU 873012.1) and M-1 isolate (HM 235508.1) published in GenBank, a BRV VP6 gene sequence of 207bp in full length is synthesized, specifically as shown in SEQ ID NO:4, and the sequence is connected to pMD TM And cloning the Vector on the 19-T Vector to obtain a recombinant plasmid pMD19T-BRV.
1. Identification of recombinant plasmid pMD19T-BRV of conventional PCR product
The synthesized plasmid DNA pMD19T-BRV is used as a template for PCR amplification by using upstream and downstream specific primers. As shown in FIG. 1, a band of about 207bp was obtained, indicating that the target gene fragment of bovine rotavirus and the cloning vector pMD TM The 19-T Vector has been successfully connected.
Reaction system: 12.5 μ L of 2 XTaq PCR Master Mix, 9.5 μ L of RNase-Free ddH 2 O, upstream and downstream primers and Mix were all 1.0. Mu.L.
Reaction procedure: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 20s, annealing at 54 ℃ for 30s, extension at 72 ℃ for 30s and final extension at 72 ℃ for 10min, and 35 cycles.
2. Calculation and dilution of DNA copy number of BRV recombinant plasmid
The concentration of the recombinant plasmid pMD19T-BRV was determined and determined by the calculation formula: plasmid copy number (copies/. Mu.L) =6.02 × (recombinant plasmid concentration ng/. Mu.L.times.10) -9 )×10 23 /(660 × recombinant plasmid base number) plasmid copy number was calculated. Preparation of Positive markersThe recombinant plasmid pMD19T-BRV was diluted 10-fold with triple distilled water as a standard.
The concentration of BRV positive plasmid is 72.15 ng/. Mu.L, and the plasmid copy number can be calculated to be 2.27 × 10 by the corresponding formula 10 copies/. Mu.L. The plasmid DNA was diluted to 1X 10 9 ～1×10 1 Nine gradients of copies/. Mu.L were prepared as standard positive templates.
Example 3 quantitative RT-PCR reaction System and parameter optimization
BRV quantitative RT-PCR reaction parameters are shown in Table 3, and BRV quantitative RT-PCR 20 μ L reaction system is shown in Table 4:
TABLE 4
The BRV positive plasmid sample and the BRV total RNA are amplified by using a CFX96 Real-time PCR instrument, and have good amplification effect as shown in figure 2.
2.2.4.2 primer concentration optimization
The concentration of BRV primers was optimized by pipetting 0.6. Mu.L (300 nmol/L concentration), 0.7. Mu.L (350 nmol/L concentration), 0.8. Mu.L (400 nmol/L concentration), 0.9. Mu.L (450 nmol/L concentration), and 1. Mu.L (500 nmol/L concentration) of the primers for BRV as a template. Reaction parameters and systems, see tables 3 and 4.
The results of the experiment are shown in FIG. 3. As can be seen from FIG. 3, the Ct value was the smallest and the primer concentration for a good amplification curve was 400nmol/L. Therefore, the optimal primer concentration in the embodiment of the present invention is selected to be 400nmol/L.
2.2.4.3 Probe concentration optimization
The template is the standard positive recombinant plasmid DNA of BRV, the primer concentration is the optimized concentration in 2.2.4.2, the BRV probe concentration is optimized by adding 0.3 muL (concentration 150 nmol/L), 0.4 muL (concentration 200 nmol/L), 0.5 muL (concentration 250 nmol/L), 0.6 muL (concentration 300 nmol/L) and 0.7 muL (concentration 350 nmol/L) to the probes, and the reaction parameters and the system are referred to Table 3 and Table 4.
The results of the experiment are shown in FIG. 4. As can be seen from FIG. 4, the Ct value is the smallest and the probe concentration at which the amplification curve is good is 350nmol/L. Therefore, the optimal probe concentration for the embodiment of the present invention is 350nmol/L.
2.2.4.4 establishment of fluorescent quantitative RT-PCR Standard Curve
The template is 1X 10 3 copies/μL、1×10 4 copies/μL、1×10 5 copies/μL、1×10 6 copies/μL、1×10 7 copies/. Mu.L and 1X 10 8 The copies/mu L total 6 standard positive plasmids, the optimal concentration of primer and probe is used for reaction, and a standard curve for detecting BRV quantitative RT-PCR is established. As shown in fig. 5.
The regression equation of the standard curve obtained from FIG. 6 is y = -3.488x +46.176, and the correlation coefficient reaches 0.995.
EXAMPLE 4 sensitivity test of fluorescent quantitative RT-PCR
The template is 1X 10 1 copies/μL、1×10 2 copies/μL、1×10 3 copies/μL、1×10 4 copies/μL、1×10 5 copies/μL、1×10 6 copies/μL、1×10 7 copies/μL、1×10 8 copies/. Mu.L, and 1X 10 9 Copies/. Mu.L total 9 standard positive plasmids, negative control is ddH 2 And O. And performing conventional PCR and quantitative RT-PCR to obtain the lowest concentration capable of being detected by the conventional PCR and quantitative RT-PCR detection method. The results of the experiment are shown in FIG. 7 (quantitative RT-PCR) and FIG. 8 (conventional RT-PCR).
As can be seen from FIGS. 7 and 8, the lowest detectable concentration of the BRV quantitative RT-PCR established in the examples of the present invention is 1X 10 1 copies/. Mu.L plasmid, whereas the lowest detectable concentration of conventional RT-PCR is 1X 10 3 copies/. Mu.L of plasmid, 100-fold difference.
EXAMPLE 5 specificity test for fluorescent quantitative RT-PCR
To determine the specificity of the method, nucleic acids of bovine viral diarrhea virus, bovine Escherichia coli, bovine Salmonella, bovine infectious rhinotracheitis virus and bovine respiratory syncytial virus were extracted as templates, respectively, and the positive control was 1 × 10 6 copies/. Mu.L of standard positive plasmid and BRV total RNA, negative control ddH 2 O quantitative RT-PCR was performed.
The established quantitative RT-PCR method is applied to detect bovine viral diarrhea virus, escherichia coli, salmonella, bovine infectious rhinotracheitis virus and bovine respiratory syncytial virus nucleic acid. The results of the experiment are shown in FIG. 9.
As can be seen in FIG. 9, the nucleic acids of other viruses did not produce an amplification curve, except that the positive plasmid and RNA for BRV as the template produced an amplification curve.
EXAMPLE 6 reproducibility test of fluorescent quantitative RT-PCR
Selecting three standards with different concentrations, i.e. 1 × 10 4 copies/μL、1×10 5 copies/. Mu.L and 1X 10 6 And (3) respectively carrying out repeated detection in three groups and between groups by copies/mu L, analyzing experimental data, and verifying the stability of the quantitative RT-PCR method established by the test.
The template is 1X 10 4 copies/μL-1×10 6 3 positive plasmids at different concentrations, copies/. Mu.L, were subjected to quantitative RT-PCR. The results of the experiment are shown in FIG. 11.
As can be seen from FIG. 10, the Ct values of the same template are not very different, and the amplification curves are also approximately the same; the repeated variation coefficients in groups with different copy numbers of the same template are less than 2 percent, which shows that the method provided by the embodiment of the invention has good repeatability and stability.
Example 7 application of quantitative RT-PCR method
30 parts of nucleic acid samples of the cow dung swabs are detected by a common RT-PCR method and a quantitative RT-PCR detection method of the cow rotavirus established in the test.
Firstly, nucleic acid extraction is carried out on the collected sample, and detection is carried out by using a common RT-PCR method and a quantitative RT-PCR method in sequence. 30 calf diarrhea cases collected from a certain pathogenic cattle farm in inner Mongolia are detected by the two methods, 10 BRV positive pathological materials (figure 11 and figure 12) are detected by common RT-PCR, 23 BRV positive pathological materials (figure 13) are detected by quantitative RT-PCR, and the 23 BRV positive pathological materials are all positive by sequencing identification method. Specifically, the results are shown in Table 5. The sensitivity of the quantitative RT-PCR method of the embodiment of the invention is proved to be higher than that of the common RT-PCR method.
TABLE 5
| Sample numbering | Cq | Concentration (copies/. Mu.l) | The result of the |
| 1 | 36.38 | 1×10 2.8 | Positive for |
| 2 | 33.71 | 1×10 3.6 | Positive for |
| 3 | 32.61 | 1×10 2.7 | Positive for |
| 4 | 37.94 | 1×10 2.4 | Positive for |
| 5 | 28.3 | 1×10 5.1 | Positive for |
| 6 | 40.16 | 1×10 1.7 | Positive for |
| 7 | 32.08 | 1×10 4 | Positive for |
| 8 | 36.16 | 1×10 2.9 | Positive for |
| 9 | 35.31 | 1×10 3 | Positive for |
| 10 | 36.38 | 1×10 2.8 | Positive for |
| 11 | 38.17 | 1×10 2.3 | Positive for |
| 12 | 37.23 | 1×10 2.6 | Positive for |
| 13 | 34.34 | 1×10 3.4 | Positive for |
| 14 | 33.94 | 1×10 3.5 | Positive for |
| 15 | 34.58 | 1×10 3.3 | Positive for |
| 16 | 37.67 | 1×10 2.4 | Positive for |
| 17 | 34.97 | 1×10 3.2 | Positive for |
| 18 | 32.08 | 1×10 4 | Positive for |
| 19 | 34.76 | 1×10 3.3 | Positive for |
| 20 | 34.37 | 1×10 3.4 | Positive for |
| 21 | 35.02 | 1×10 3.2 | Positive for |
| 22 | 40.05 | 1×10 1.8 | Positive for |
| 23 | 37.43 | 1×10 2.5 | Positive for |
Although the present application has been described with reference to preferred embodiments, it is not intended to limit the scope of the claims, and many possible variations and modifications may be made by one skilled in the art without departing from the spirit of the application.
Sequence listing
<110> university of inner Mongolia agriculture
<120> kit, primer and probe for detecting bovine rotavirus
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaattgaatc tgcagtttgt gaatc 25
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgcttctaat ggaagccact gt 22
<210> 3
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
caagaatacg cgataccagt tggacc 26
<210> 4
<211> 207
<212> DNA
<213> Bovine rotavirus (Bovine rotavirus)
<400> 4
gaattgaatc tgcagtttgt gaatcagtgc tcgccgacgc aagtgaaaca atgctagcaa 60
atgtgacatc tgttagacaa gaatacgcga taccagttgg acccgttttt ccaccaggta 120
tgaattggac tgatttgatc actaactatt caccatctag agaggttaac ttgcagcgtg 180
tatttacagt ggcttccatt agaagca 207
Claims (6)
1. A kit for detecting bovine rotavirus is characterized in that the kit contains a nucleic acid amplification reagent, the nucleic acid amplification reagent contains a primer and a probe for detecting bovine rotavirus, and the primer comprises an upstream primer shown by SEQ ID NO. 1 and a downstream primer shown by SEQ ID NO. 2; the probe comprises a probe represented by SEQ ID NO. 3; the concentration of the primer and the probe is as follows: the upstream primer is 400nmol/L, the downstream primer is 400nmol/L, and the probe is 350nmol/L.
2. The kit of claim 1, wherein the probe has a fluorophore attached to the 5 'end and a fluorescence quencher attached to the 3' end.
3. The kit of claim 2, wherein the fluorescent group is selected from HEX and the fluorescence quenching group is selected from BHQ1.
4. The kit according to claim 1, wherein the nucleic acid amplification reagent further comprises 2 x Reaction Buffer, DNA polymerase and RT Enzyme Mix.
5. The kit of claim 1, wherein the kit comprises a reference for quantification, and the reference comprises a recombinant plasmid comprising a nucleotide sequence represented by SEQ ID No. 4.
6. The kit according to claim 1, wherein the kit comprises a negative control and a positive control, wherein the negative control is process water, and the positive control comprises a recombinant plasmid comprising a nucleotide sequence represented by SEQ ID NO. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010568416.9A CN111719020B (en) | 2020-06-19 | 2020-06-19 | Kit, primer and probe for detecting bovine rotavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010568416.9A CN111719020B (en) | 2020-06-19 | 2020-06-19 | Kit, primer and probe for detecting bovine rotavirus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111719020A CN111719020A (en) | 2020-09-29 |
| CN111719020B true CN111719020B (en) | 2022-11-11 |
Family
ID=72568375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010568416.9A Active CN111719020B (en) | 2020-06-19 | 2020-06-19 | Kit, primer and probe for detecting bovine rotavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111719020B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094953B (en) * | 2020-10-30 | 2022-11-11 | 内蒙古农业大学 | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868227A (en) * | 2017-04-27 | 2017-06-20 | 西南民族大学 | Yak rotavirus detection kit and application based on constant temperature isolation type fluorescent PCR platform |
| CN107699639A (en) * | 2017-11-23 | 2018-02-16 | 广西壮族自治区兽医研究所 | A kind of primer and method for differentiating bovine rota and producing intestines poison Escherichia coli |
| CN108546779A (en) * | 2018-04-20 | 2018-09-18 | 山东师范大学 | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota |
-
2020
- 2020-06-19 CN CN202010568416.9A patent/CN111719020B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868227A (en) * | 2017-04-27 | 2017-06-20 | 西南民族大学 | Yak rotavirus detection kit and application based on constant temperature isolation type fluorescent PCR platform |
| CN107699639A (en) * | 2017-11-23 | 2018-02-16 | 广西壮族自治区兽医研究所 | A kind of primer and method for differentiating bovine rota and producing intestines poison Escherichia coli |
| CN108546779A (en) * | 2018-04-20 | 2018-09-18 | 山东师范大学 | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota |
Non-Patent Citations (6)
| Title |
|---|
| Abe,M.等.Rotavirus A RVA/Cow-tc/JPN/GB14-45/2007/G6P[11]VP6 gene for VP6 protein，complete cds.《GenBank Database》.2020,ACCESSION NO. LC553610 REGION：973…1180. * |
| Mengmeng Wang等.Simultaneous Detection of Bovine Rotavirus, Bovine Parvovirus, and Bovine Viral Diarrhea Virus Using a Gold Nanoparticle-Assisted PCR Assay With a Dual-Priming Oligonucleotide System.《Frontiers in Microbiology》.2019,第10卷2884，第1-9页. * |
| Zhixun Xie等.Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus.《BMC Vet Res》.2012,第8卷133，第1-9页. * |
| 丽平.牛轮状病毒定量RT-PCR检测方法的建立及VP6基因的遗传性分析.《中国优秀博硕士学位论文全文数据库(硕士)基础科学辑》.2021,(第02期),第A006-1003页. * |
| 王梓等.牛轮状病毒实时荧光定量PCR检测方法的建立.《中国兽医科学》.2017,第47卷(第06期),第750-754页. * |
| 范晴等.牛轮状病毒TaqMan实时荧光RT-PCR快速检测方法的建立.《中国畜牧兽医》.2011,第38卷(第4期),第105-108页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111719020A (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112094953B (en) | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus | |
| CN110777220B (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110373500B (en) | Double-gene-based double-fluorescence PCR detection kit and application thereof | |
| CN107034309B (en) | Real-time fluorescent RPA kit and test strip RPA kit for rapidly detecting porcine pseudorabies virus and application thereof | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN112430686B (en) | Kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3 | |
| CN107365843B (en) | LAMP primer combination for detecting two main parasites causing calf diarrhea and application thereof | |
| CN113025734A (en) | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN112011646A (en) | Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof | |
| CN114438265B (en) | Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kokumi virus | |
| CN114634996A (en) | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof | |
| CN114395643A (en) | Double-channel digital PCR detection kit and method for African swine fever virus | |
| CN110257560B (en) | Reagent for bluetongue virus type 8 detection, detection method and application | |
| CN113337643A (en) | RT-LAMP primer group and kit for detecting bluetongue virus, animal epidemic hemorrhagic disease virus and paliyama virus | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN112391501A (en) | Quadruple PCR (polymerase chain reaction) primer set for identifying canine distemper virus, mink parvovirus, Aleutian mink virus and pseudorabies virus of minks | |
| CN112877479A (en) | Primer for rapidly detecting exogenous viruses in porcine pseudorabies live vaccine and application of primer in kit | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application | |
| CN113322350B (en) | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application | |
| CN111118212B (en) | Primer and probe combination for detecting newcastle disease virus, kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |