CN112011646A - Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit - Google Patents
Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit Download PDFInfo
- Publication number
- CN112011646A CN112011646A CN202010955621.0A CN202010955621A CN112011646A CN 112011646 A CN112011646 A CN 112011646A CN 202010955621 A CN202010955621 A CN 202010955621A CN 112011646 A CN112011646 A CN 112011646A
- Authority
- CN
- China
- Prior art keywords
- virus
- swine fever
- primer
- african swine
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention provides a primer, a probe and a kit for combined detection of African swine fever virus and wild strains of porcine pseudorabies virus, and application thereof, wherein the primer and the probe comprise: the sequence of the forward primer for detecting the African swine fever virus is shown as SEQ ID NO. 1; the sequence of the reverse primer for detecting the African swine fever virus is shown as SEQ ID NO. 2; the sequence of the TaqMan probe for detecting the African swine fever virus is shown as SEQ ID NO. 3; the sequence of the forward primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 4, the sequence of the reverse primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 5, and the sequence of the TaqMan probe for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 6. The primer, the probe and the kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus, and the application of the kit can simultaneously detect single or mixed infection of the African swine fever virus and the wild strain of the porcine pseudorabies virus, and improve the monitoring and diagnosis efficiency of the ASF and PR in a pig farm.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a primer, a probe, a kit and application for jointly detecting African swine fever virus and wild strains of porcine pseudorabies virus.
Background
African Swine Fever (ASF) is an acute, highly contagious disease caused by African Swine Fever Virus (ASFV). ASF clinical symptoms are manifested by fever, dyspnea, cyanosis of the skin and significant bleeding of the lymph nodes, kidneys, gastrointestinal mucosa, with mortality rates up to 100%. Because the disease has great harm to the pig industry and the etiology and epidemiology are complex, no effective vaccine is used clinically, so the world animal health Organization (OIE) ranks the African swine fever as a legal report animal epidemic disease, and China ranks the African swine fever as a type of animal epidemic disease. Particularly, since the first epidemic situation of African swine fever occurs in China in 2018 and 9 months, the method causes very serious loss to the breeding of domestic pigs in China, even seriously affects the vegetable basket of common people, and brings great influence to the economic and civil guarantee of China. Therefore, relevant departments have come out corresponding prevention and control measures for African swine fever successively, particularly, the introduction and transportation of the breeding pigs are strictly regulated, and ASFV detection must be strictly carried out on the breeding pigs transported across provinces.
Pseudorabies (PR) is a highly contagious disease caused by pseudorabies virus (PRV) and common to livestock and various wild animals, and can cause symptoms such as fever, itching, reproductive failure, encephalomyelitis, etc. PRV infects ruminants, rodents, carnivores, etc., but pigs are the only transmission and storage host for PRV, may harbor infections, and are chronically toxic. PRV infects pigs at various stages and clinical symptoms vary with age. Especially PRV infection can cause the boar to carry virus and spread vertically, so once the boar carries the virus, the boar can carry the virus for life, expel the toxin, pollute the environment and cause infection and morbidity of piglets. Meanwhile, PRV is easy to have deletion/insertion variation, so that the existing vaccine can not effectively protect the swinery, and in addition, the PRV vaccine is mainly live vaccine in the breeding process of the existing live pigs, and the risk of virulence reversion exists, so that the PRV is widely popularized in the swinery in China for a long time and is difficult to control, and huge loss is caused to the pig industry in China. Therefore, in the scheme for preventing and treating the middle-long term animal epidemic diseases in China (2012-2020), PR is classified as purifying the key epidemic diseases of livestock and poultry.
In order to realize large-scale screening and monitoring of the ASF and PR in the breeding pig farm, a quick and effective ASFV and PRV detection method is urgently needed. The conventional molecular diagnosis comprises common PCR, fluorescent quantitative PCR, a gene chip, a constant-temperature amplification detection technology and the like, the common PCR, the gene chip, the constant-temperature amplification detection technology and the like have the defects of low sensitivity, high cost, high development technology difficulty, easy aerosol pollution and the like, and the fluorescent quantitative PCR has the advantages of high sensitivity, good specificity, high flux, low pollution and the like compared with other conventional molecular diagnosis technologies. Among them, the real-time TaqMan fluorescence quantitative PCR technology is widely applied in animal epidemic disease diagnosis, gene qualitative and quantitative detection, and has become the main method for rapid detection of virus nucleic acid at present. At present, the type of a real-time fluorescent quantitative PCR detection kit for ASFV or PRV is single, the dual detection of ASFV and PRV cannot be realized by simply detecting the wild virus or vaccine virus of ASFV and PRV, and the kit wastes time and labor and has relatively high cost, so that the current situation of mixed infection of the virus in the pig farm is difficult to deal with.
Therefore, the dual real-time fluorescent quantitative PCR kit for jointly detecting the African swine fever virus and the porcine pseudorabies virus is developed, is beneficial to improving the ASF and PR monitoring and diagnosis efficiency of a breeding pig farm, and ensures the biological safety of the breeding pig farm.
Disclosure of Invention
The invention solves the technical problem of providing a primer, a probe, a kit and an application for jointly detecting African swine fever virus and porcine pseudorabies virus wild strains, simultaneously detecting single or mixed infection of the African swine fever virus and the porcine pseudorabies virus wild strains, and improving the monitoring and diagnosis efficiency of the ASF and PR in a pig farm.
In order to solve the above problems, one aspect of the present invention provides a primer and a probe for combined detection of african swine fever virus and wild strain of porcine pseudorabies virus, comprising:
the sequence of the forward primer for detecting the African swine fever virus is shown as SEQ ID NO. 1; the sequence of the reverse primer for detecting the African swine fever virus is shown as SEQ ID NO. 2; the sequence of the TaqMan probe for detecting the African swine fever virus is shown as SEQ ID NO. 3;
the sequence of the forward primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 4, the sequence of the reverse primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 5, and the sequence of the TaqMan probe for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 6.
The sequence of SEQ ID NO. 1 is: 5'-GTCTGGAAGAGCTGTATC-3' are provided.
The sequence of SEQ ID NO. 2 is: 5'-GGAACATCTCCGATCAAA-3' are provided.
The sequence of SEQ ID NO. 3 is: 5'-CCTCATCAACACCGAGATTGGCACA-3' are provided.
The sequence of SEQ ID NO. 4 is: 5'-GTACGTGCTCGTGATGAC-3' are provided.
The sequence of SEQ ID NO. 5 is: 5'-CGTCAGCTCCTTGATGAC-3' are provided.
The sequence of SEQ ID NO. 6 is: 5'-CCTGGGACTACACGCTCGTC-3' are provided.
According to the invention, a specific primer and a TaqMan probe are designed according to conserved sequences of a B646L gene of ASFV and a gE gene of PRV, different primer probe combinations are screened, the primer and the TaqMan probe are optimized, and the primer and the probe with high detection specificity and high sensitivity to ASFV and PRV are obtained.
Preferably, the TaqMan probe for detecting African swine fever virus has a fluorescence reporter group marked at the 5 'end of FAM and a fluorescence quencher group marked at the 3' end of BHQ 1;
the TaqMan probe for detecting the wild strain of the porcine pseudorabies virus is characterized in that a fluorescence reporter group marked at the 5 'end is VIC, and a fluorescence quenching group marked at the 3' end is BHQ 1.
The invention also provides a dual real-time fluorescent quantitative PCR detection kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus, which comprises a primer and a probe mixed solution, wherein the primer and the probe mixed solution comprise the primer and the probe for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus.
Preferably, the kit further comprises a qPCR premix, a positive control and a negative control.
Preferably, the positive control is a mixed solution of plasmid standard substances of African swine fever virus B646L gene and standard strains of porcine pseudorabies virus, and the negative control is nuclease-free water.
Preferably, the qPCR Premix is Premix Ex Taq Probe qPCR 2X.
Preferably, the concentrations of the forward primer, the reverse primer and the TaqMan probe for detecting the African swine fever virus in the primer and probe mixed solution are all 0.1 mu mol/L;
the concentrations of the forward primer, the reverse primer and the TaqMan probe in the primer and probe mixed solution for detecting the wild strain of the porcine pseudorabies virus are all 0.4 mu mol/L.
In another aspect, the invention provides the application of the primer and the probe for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus in the preparation of a kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus.
Compared with the prior art, the invention has the following beneficial effects:
1. the primers, the probes and the reagent kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus can simultaneously detect single or mixed infection of ASFV and PRV through one PCR reaction, thereby reducing the environmental pollution caused by multiple sample addition;
2. the primer, the probe and the reagent kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus can realize the detection of ASFV and PRV by one-time fluorescence quantitative PCR test on the same sample, the detection process only needs 1h, and compared with the detection of one sample in a single-time fluorescence quantitative PCR test, the detection needs two times, the work load is greatly reduced, the detection efficiency is improved, the cost is saved, and the large-scale detection in a laboratory is facilitated;
3. the primers and the probes for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus are designed and screened aiming at the conserved sequences of ASFV and PRV respectively to obtain the optimal primers and TaqMan probes, so that the detection kit and the method can specifically, accurately and sensitively detect the ASFV and the PRV;
4. the positive reference substance used in the kit for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus is a mixed solution of a plasmid standard substance of the African swine fever virus B646L gene and a standard strain of the porcine pseudorabies virus (PRV) after the numerical PCR (polymerase chain reaction) value determination, thereby not only realizing the monitoring of the nucleic acid extraction process, but also judging the effectiveness and the accuracy of the detection.
Drawings
FIG. 1 is an amplification curve of the optimum primer probe combination for detecting African swine fever virus B646L gene plasmid standard substance in example 1
FIG. 2 is an amplification curve for detecting porcine pseudorabies virus (PRV) standard strain by using the optimal primer probe combination in example 1
FIG. 3 is an amplification curve optimized for ASFV annealing temperature in example 1
FIG. 4 is a PRV annealing temperature optimized amplification curve in example 1
FIG. 5 shows the specificity verification of the ASFV/PRV wild virus dual real-time fluorescent quantitative PCR method in example 3
FIG. 6 is a standard curve of ASFV/PRV wild virus dual real-time fluorescent quantitative PCR method in example 4.
Detailed Description
The technical solutions of the present invention will be described clearly and completely below with reference to embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. Example 1ASFV/PRV wild virus double real-time fluorescent quantitative PCR method establishment 1 primer and TaqMan probe design MegAlign software was used to perform sequence alignment on the B646L gene sequences (accession numbers: MK128995.1, MK333181.1, MN172368.1, MK333180.1, MK645909.1) of different ASFVs and the gE gene sequences (accession numbers: MN240564.1, MH507059.1, MK622288.1, KU962922.1, KF017615.1) of different PRVs published by GenBank, further determine the conserved segments of the respective genes, and for the conserved segments, 3 sets of primers and probes were designed using Oligo7 software. The 5 'ends of the ASFV and PRV probes are respectively marked with FAM and VIC fluorescence emission groups, the 3' ends are both marked with BHQ1 fluorescence quenching groups, and the sequences of the ASFV and PRV primers and probes are shown in Table 1.
TABLE 1 sequences of ASFV, PRV primers and probes
| Primer/probe (5 '-3') | Sequence of |
| ASFV-F1 | GGAGATGTTCCAGGTAGG |
| ASFV-R1 | GTCCATAAAACGCAGGTG |
| ASFV-P1 | CACACCAACAATAACCACCACGATG |
| ASFV-F2 | CTGCATAATGGCGTTAAC |
| ASFV-R2 | GCTGATACGTGTCCATAA |
| ASFV-P2 | CCACACCAACAATAACCACCACG |
| ASFV-F3 | GTCTGGAAGAGCTGTATC |
| ASFV-R3 | GGAACATCTCCGATCAAA |
| ASFV-P3 | CCTCATCAACACCGAGATTGGCACA |
| PRV-F1 | GTACGTGCTCGTGATGAC |
| PRV-R1 | CGTCAGCTCCTTGATGAC |
| PRV-P1 | CCTGGGACTACACGCTCGTC |
| PRV-F2 | CATGCTCTCTCCGGTGTAC |
| PRV-R2 | GCTGCTGAACTCGTCCTC |
| PRV-P2 | ACTACTACGACGGCGACGACGA |
| PRV-F3 | TCTGGTGAACGTGTCCGA |
| PRV-R3 | CTCGAAGCACACCGTGGTC |
| PRV-P3 | TGGCCGGGATCTGGACGTTCCT |
2. Preparation of positive control the positive control is selected from African swine fever virus B646L gene plasmid standard substance and porcine pseudorabies virus (PRV) standard strain, and is subjected to accurate value determination by adopting a digital PCR method. The standard strain of porcine pseudorabies virus (PRV) is subjected to value setting through digital PCR, and the result of the value setting is 7.6 multiplied by 104copies/. mu.L. Plasmid standard substance (5.8 × 10) of African swine fever virus B646L gene4copies/. mu.L) with a constant value of 7.6X 104And mixing copies/mu L of porcine pseudorabies virus (PRV) standard strains in equal volume to obtain a positive control. ASFV, PRV nucleic acid digital PCR quantitation: the ddPCR reaction system included 2 XDddPCR Supermix 10. mu.L, DNA template 2. mu.L, forward primer (10 pmol/. mu.L) 1.8. mu.L, reverse primer (10 pmol/. mu.L) 1.8. mu.L, probe (10 pmol/. mu.L) 0.5. mu.L, DNase-free water 3.9. mu.L, and total volume 20. mu.L. Wherein, ASFV and PThe RV forward primer, reverse primer and probe are shown in Table 2.
TABLE 2 ASFV and PRV Forward primer, reverse primer and Probe sequences
Transferring the configured ddPCR reaction solution into a microdroplet generation card, and generating microdroplets by using a microdroplet generation instrument; transferring the microdroplets into a PCR plate, and placing the plate in a PCR instrument for amplification according to the following reaction program: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s (note: ASFV annealing temperature is 52 ℃ and PRV annealing temperature is 60 ℃), and 40 cycles; 10min at 98 ℃; 4 ℃ for 1h, and the temperature rising and reducing speed is 2 ℃/s. And after the amplification is finished, placing the PCR plate in a microdroplet analyzer for fluorescence reading, and calculating the content of the target nucleic acid fragment.
3. The nucleic acid was extracted by using TGuide S32 magnetic bead method virus DNA/RNA extraction kit (purchased from Tiangen Biochemical technology (Beijing) Ltd., product No. DP604) according to the instruction for product use, and the extracted nucleic acid was stored in a refrigerator at-80 ℃ for further use.
4. Primer, TaqMan probe screening
A single fluorescent quantitative PCR method is established by adopting a designed and synthesized primer and a TaqMan probe, and the African swine fever virus B646L gene plasmid standard substance (5.8 multiplied by 10) is prepared4copies/. mu.L), constant value 7.6X 104The standard strains of copies/mu L porcine pseudorabies virus (PRV) are respectively diluted by 10 times and selected to be 5.8 multiplied by 102copies/mu L African swine fever virus B646L gene plasmid standard substance, 7.6X 102The copies/mu L standard strain of porcine pseudorabies virus (PRV) is respectively used as a template, TaKaRa Premix Ex TaqTM (Probe qPCR) reagent, a recommended reaction system and reaction conditions are adopted, the amplification result is shown in figures 1 and 2, the optimal combination of the primer and the probe group with the lowest Ct value and the highest fluorescence intensity increase value (delta Rn) is selected, and the optimal primer combination is obtained by screening. The optimal primer combinations obtained by screening are shown in Table 3.
TABLE 3 optimal primer, TaqMan probe combinations
Optimization of ASFV/PRV wild virus dual real-time fluorescent quantitative PCR method
(1) Optimization of primer probe concentration
Respectively diluting the optimal primer probe combination determined in the step 4 to different working concentrations, optimally selecting the final concentration of each virus primer probe by taking the positive reference substance determined in the step 2 as a template, wherein the range of the final concentration of the primers is 0.1-1 mu M, the gradient increment is 0.1 mu M, the range of the final concentration of the probes is 0.1-0.5 mu M, and the gradient increment is 0.1 mu M, so that the orthogonal test is carried out. The method adopts TaKaRa PremixEx TaqTM (Probe qPCR) reagent, a recommended reaction system and reaction conditions, and takes factors such as the lowest Ct value, higher fluorescence intensity increment value (delta Rn), amplification efficiency, repeatability, platform period and the like as comprehensive judgment basis to determine the optimal final concentration of the primer as follows: ASFV-F (0.1. mu. mol/L), ASFV-R (0.1. mu. mol/L), ASFV-P (0.1. mu. mol/L); PRV-F (0.4. mu. mol/L), PRV-R (0.4. mu. mol/L), and PRV-P (0.4. mu. mol/L).
(2) Optimization of annealing temperature
And (3) taking the positive reference substance determined in the step (2) as a template, optimizing the annealing temperature, setting the annealing temperature within the range of 54-62 ℃, and adopting a TaKaRa Premix Ex TaqTM (ProbeqPCR) reagent, a recommended reaction system and recommended reaction conditions. The amplification results are shown in fig. 3 and 4, and the optimal annealing temperature is determined to be 54 ℃ by taking factors such as the lowest Ct value, the higher fluorescence intensity increase value (Delta Rn), the amplification efficiency, the plateau period and the like as comprehensive judgment bases.
Establishment of ASFV/PRV wild virus dual real-time fluorescent quantitative PCR method under the guide of the primer and TaqMan probe, the detection system is shown in Table 4.
TABLE 4 detection System
| Reagent | Volume of | Final concentration |
| Premix Ex Taq Probe qPCR 2X | 12.5μL | 1X |
| ASFV Forward Primer(10μmol/L) | 0.25μL | 0.1μmol/L |
| ASFV Reverse Prim er(10μmol/L) | 0.25μL | 0.1μmol/L |
| ASFV Probe(10μmol/L) | 0.25μL | 0.1μmol/L |
| PRV Forward Primer(10μmol/L) | 1μL | 0.4μmol/L |
| PRV Reverse Primer(10μmol/L) | 1μL | 0.4μmol/L |
| PRV Probe(10μmol/L) | 1μL | 0.4μmol/L |
| Form panel | 2μL | |
| H2O | 6.75μL | |
| Total | 25μL |
The amplification conditions were: 30s at 95 ℃; 5s at 95 ℃ and 30s at 54 ℃ for 40 cycles.
The detection result judging method comprises the following steps: 1): in FAM and VIC channels, the Ct value of a positive control substance is less than 32 and presents an S-type amplification curve, and the negative control substance has no Ct value and no amplification curve, so that the experiment is established when the requirements are met.
2): in the FAM channel, the Ct value of the sample is less than or equal to 40, and an S-shaped amplification curve appears, so that ASFV is considered to be positive;
3): in the VIC channel, the Ct value of the sample is less than or equal to 40, and if an S-type amplification curve appears, the PRV is considered to be positive;
4): in FAM and VIC channels, no S-type amplification curve or Ct value is negative.
Example 2 the kit for ASFV/PRV wild virus dual real-time fluorescent quantitative PCR comprises the primer probe/needle mixture, qPCR premix, positive control, and negative control described in example 1. When the kit uses a 25 mu L real-time fluorescent quantitative PCR detection system, the dosage of the primer and the TaqMan probe is preferably as follows: 3.75 μ L.
The qPCR Premix is TaKaRa Premix Ex TaqTM (Probe qPCR).
The positive control is African swine fever virus B646L gene plasmid standard substance (5.8 multiplied by 10)4copies/. mu.L) with a constant value of 7.6X 104The negative control substance is nuclease-free water.
The application of the kit to the detection of ASFV and PRV also belongs to the content of the invention. The application of the reagent kit comprises the following steps: (1) preparing a multiple fluorescent quantitative PCR system: according to the total number of samples to be detected and the number of positive control and negative control, a reaction system is prepared according to the table 5.
TABLE 5 detection System reagents
(2) Sample adding: and (3) extracting the nucleic acid, the negative control substance and the positive control substance of the sample according to the instruction of the nucleic acid extraction kit, respectively taking 2 mu L of the nucleic acid, the negative control substance and the positive control substance, respectively adding the nucleic acid, the negative control substance and the positive control substance into corresponding reaction tubes, covering tube caps, uniformly mixing, and performing instantaneous centrifugation to avoid bubbles.
(3) And (3) PCR amplification: and (3) placing the reaction tube in the step (2) in a fluorescent quantitative PCR instrument for amplification, and setting a detection channel, sample information, a reaction system and amplification conditions.
(4) And (4) analyzing results: the results were analyzed and judged according to the judgment method in the above-described example 1.
Example 3 specific detection
The positive nucleic acids of classical swine fever virus, porcine reproductive and respiratory syndrome virus, foot and mouth disease virus, porcine parvovirus, porcine pseudorabies virus, porcine epidemic diarrhea virus and porcine transmissible gastroenteritis virus stored in the laboratory are respectively used as specific samples, and the B646L gene plasmid standard substance (5.8 multiplied by 10) described in the example 1 is used as the standard substance4copies/. mu.L) with a constant value of 7.6X 104The mixture of copies/μ L of porcine pseudorabies virus (PRV) standard virus strains is used as a positive control, nuclease-free water is used as a negative control, and the nucleic acid extraction and detection system and detection conditions are as described in example 1 above.
The detection results are shown in fig. 5, and it can be seen from the results that the positive control satisfies the test establishment conditions, the Ct value is less than 32 and shows a specific S-type amplification curve, and the negative control has no Ct value and no amplification curve. The result shows that the method has no cross reaction with other viruses and can specifically detect ASFV and PRV.
Example 4 sensitivity detection and Standard Curve construction
The positive control in example 1 was serially diluted 10-fold, and the concentration of the plasmid standard substance of the African swine fever virus B646L gene in the mixture was 5.8X 104copies/μL-5.8×100The concentration of copies/mu L, standard strain of porcine pseudorabies virus (PRV) is 7.6X 104copies/μL-7.6×100copies/. mu.L, each gradient is repeated for 3 times, and multiple fluorescent quantitative PCR detection is carried out under the guide of the primer and the TaqMan probe in the example 1, and the detection system and the detection conditions are as described in the example 1.
The detection result shows that the minimum detection limit of the multiplex fluorescence quantitative PCR method on ASFV is 58 copies/mu L, and the minimum detection limit on PRV is 7.6 copies/mu L, and the result shows that the multiplex fluorescence quantitative PCR method established by the invention has higher sensitivity.
The logarithm of the initial template concentration was plotted as the abscissa and the Ct value as the ordinate to obtain a standard curve, as shown in FIG. 6, the correlation coefficient (R) of the standard curve2) Are all made ofAbove 0.99, the amplification efficiency E is 90-110%, which shows that the method has good linear relation.
Example 5 reproducibility test
Taking positive reference substances diluted by different gradients as templates, performing multiplex fluorescence quantitative PCR detection under the combination of the primers and the TaqMan probes in the embodiment 1, and repeating the detection for 3 times, wherein the detection system and the detection conditions are as described in the embodiment 1. And (3) detecting for 3 times at different time periods, respectively calculating the variation coefficient of the Ct value, and evaluating the repeatability in and among groups of the multiplex fluorescence quantitative PCR method. The results are shown in Table 6, and the coefficient of variation is less than 2%, which indicates that the ASFV/PRV wild virus dual real-time fluorescence quantitative PCR method established by the invention has good repeatability.
TABLE 6 analysis of repeatability within and between groups
Example 6 clinical application assay
(1) Sample preparation: 180 clinical samples collected from pig farms in Beijing area comprise 100 parts of whole blood samples, 40 parts of tissue disease samples, 20 parts of environment samples and 20 parts of feed samples; 20 parts of African swine fever positive nucleic acid. Wherein the African swine fever positive nucleic acid is stored in laboratories of animal epidemic prevention control centers in Beijing.
(2) Extraction of nucleic acid from clinical samples: nucleic acids from clinical samples were extracted as templates for multiplex fluorescent quantitative PCR detection according to the viral nucleic acid extraction method described in example 1.
(3) Multiplex fluorescent quantitative PCR assays were performed using the kit described in example 2. Meanwhile, ASFV and PRV are respectively compared and detected by using a Qingdao African swine fever virus fluorescent PCR detection kit and a Beijing Shijiyuan Henry porcine pseudorabies virus (gE gene) fluorescent PCR detection kit.
(4) The results are shown in the following table 7, and the coincidence rate of the results of the dual real-time fluorescent quantitative PCR detection and the results of the single real-time fluorescent quantitative PCR detection is 100%, which indicates that the ASFV/PRV wild virus dual real-time fluorescent quantitative PCR kit can be used for rapid diagnosis and epidemiological investigation.
TABLE 7 clinical sample test results
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Variations and modifications in other variations will occur to those skilled in the art upon reading the foregoing description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
Sequence listing
<110> prevention and control center of animal diseases in Beijing
<120> primer, probe, kit and application for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtctggaaga gctgtatc 18
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggaacatctc cgatcaaa 18
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cctcatcaac accgagattg gcaca 25
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtacgtgctc gtgatgac 18
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgtcagctcc ttgatgac 18
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cctgggacta cacgctcgtc 20
Claims (8)
1. A primer and a probe for jointly detecting African swine fever virus and wild strains of porcine pseudorabies virus are characterized by comprising the following components:
the sequence of the forward primer for detecting the African swine fever virus is shown as SEQ ID NO. 1; the sequence of the reverse primer for detecting the African swine fever virus is shown as SEQ ID NO. 2; the sequence of the TaqMan probe for detecting the African swine fever virus is shown as SEQ ID NO. 3;
the sequence of the forward primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 4, the sequence of the reverse primer for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 5, and the sequence of the TaqMan probe for detecting the wild strain of the porcine pseudorabies virus is shown as SEQ ID NO. 6.
2. The primers and probes for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus according to claim 1, wherein:
the TaqMan probe for detecting the African swine fever virus is characterized in that a fluorescence reporter group marked at the 5 'end is FAM, and a fluorescence quenching group marked at the 3' end is BHQ 1;
the TaqMan probe for detecting the wild strain of the porcine pseudorabies virus is characterized in that a fluorescence reporter group marked at the 5 'end is VIC, and a fluorescence quenching group marked at the 3' end is BHQ 1.
3. A dual real-time fluorescent quantitative PCR detection kit for jointly detecting African swine fever virus and wild strains of porcine pseudorabies virus is characterized in that:
comprises a primer and a probe mixed solution, wherein the primer and the probe mixed solution comprise the primer and the probe which are used for jointly detecting the African swine fever virus and the wild strain of the porcine pseudorabies virus according to claim 1 or 2.
4. The dual real-time fluorescent quantitative PCR detection kit for jointly detecting African swine fever virus and wild strains of porcine pseudorabies virus according to claim 3, which is characterized in that:
also comprises qPCR premix, a positive control substance and a negative control substance.
5. The dual real-time fluorescent quantitative PCR detection kit for the combined detection of African swine fever virus and wild strain of porcine pseudorabies virus according to claim 4, which is characterized in that:
the positive control substance is a mixed solution of an African swine fever virus B646L gene plasmid standard substance and a porcine pseudorabies virus standard strain, and the negative control substance is nuclease-free water.
6. The dual real-time fluorescent quantitative PCR detection kit for the combined detection of African swine fever virus and wild strain of porcine pseudorabies virus according to claim 4, which is characterized in that:
the qPCR Premix is Premix Ex Taq Probe qPCR 2X.
7. The dual real-time fluorescent quantitative PCR detection kit for jointly detecting African swine fever virus and wild strains of porcine pseudorabies virus according to claim 3, which is characterized in that:
the concentrations of the forward primer, the reverse primer and the TaqMan probe in the primer and probe mixed solution for detecting the African swine fever virus are all 0.1 mu mol/L;
the concentrations of the forward primer, the reverse primer and the TaqMan probe in the primer and probe mixed solution for detecting the wild strain of the porcine pseudorabies virus are all 0.4 mu mol/L.
8. Use of the primers and probes for the combined detection of African swine fever virus and wild strain of porcine pseudorabies virus according to claim 1 or 2 for the preparation of a kit for the combined detection of African swine fever virus and wild strain of porcine pseudorabies virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010955621.0A CN112011646A (en) | 2020-09-11 | 2020-09-11 | Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010955621.0A CN112011646A (en) | 2020-09-11 | 2020-09-11 | Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112011646A true CN112011646A (en) | 2020-12-01 |
Family
ID=73523111
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010955621.0A Pending CN112011646A (en) | 2020-09-11 | 2020-09-11 | Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112011646A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604610A (en) * | 2021-08-11 | 2021-11-05 | 中国科学院武汉病毒研究所 | Kit for synchronously detecting African swine fever virus and porcine pseudorabies virus |
| CN114480726A (en) * | 2021-08-13 | 2022-05-13 | 深圳市博德致远生物技术有限公司 | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561374A (en) * | 2014-12-18 | 2015-04-29 | 河南省动物疫病预防控制中心 | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain |
| CN106957925A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate Pseudorabies virus, pig parvoviral and pig circular ring virus |
| CN109593893A (en) * | 2019-02-03 | 2019-04-09 | 郑州中道生物技术有限公司 | African hog cholera virus fluorescent PCR quick detection kit |
-
2020
- 2020-09-11 CN CN202010955621.0A patent/CN112011646A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561374A (en) * | 2014-12-18 | 2015-04-29 | 河南省动物疫病预防控制中心 | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain |
| CN106957925A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate Pseudorabies virus, pig parvoviral and pig circular ring virus |
| CN109593893A (en) * | 2019-02-03 | 2019-04-09 | 郑州中道生物技术有限公司 | African hog cholera virus fluorescent PCR quick detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 冷依伊等: "5种猪病毒性传染病病原的多重PCR检测方法的建立", 《中国预防兽医学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113604610A (en) * | 2021-08-11 | 2021-11-05 | 中国科学院武汉病毒研究所 | Kit for synchronously detecting African swine fever virus and porcine pseudorabies virus |
| CN114480726A (en) * | 2021-08-13 | 2022-05-13 | 深圳市博德致远生物技术有限公司 | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105624330B (en) | 12 boar common virus and bacterium Taqman-MGB PCR kit for fluorescence quantitative and method are detected simultaneously | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110373500B (en) | Double-gene-based double-fluorescence PCR detection kit and application thereof | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN112094953B (en) | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus | |
| CN108866243B (en) | Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit | |
| CN111621602B (en) | Porcine circovirus type 3 rapid detection fluorescent quantitative PCR kit and application thereof | |
| CN112011646A (en) | Primer, probe and kit for combined detection of African swine fever virus and wild strain of porcine pseudorabies virus and application of primer, probe and kit | |
| CN112391497A (en) | Primer probe set, application thereof and kit for detecting African swine fever virus and porcine epidemic diarrhea virus | |
| CN113684309A (en) | 7 primer probe and kit for detecting viruses related to porcine reproductive disorder diseases based on liquid chip technology and application of primer probe and kit | |
| CN111763766A (en) | Primer pair, TaqMan probe and method for detecting canine diarrhea virus by one-step method and application | |
| CN113930547A (en) | RT-RAA fluorescence method detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| Dokphut et al. | Development of a loop-mediated isothermal amplification assay for rapid detection of African swine fever. | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| AU2021104086A4 (en) | Detection reagent for fluorescent duplex pcr for classical swine fever virus and african swine fever virus, kit, and detection method | |
| CN113943831A (en) | Multiple fluorescent quantitative primer and probe combination capable of diagnosing three high-incidence pathogens of porcine diarrhea disease simultaneously and application thereof | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN114438265A (en) | Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kobuvirus | |
| CN114634996A (en) | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof | |
| CN110257560B (en) | Reagent for bluetongue virus type 8 detection, detection method and application | |
| CN113862381B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting aedes albopictus | |
| KR102482020B1 (en) | Detection set for canine babesia using real-time pcr and detection method thereof | |
| CN117925908A (en) | Primer pair, probe and kit for fluorescence quantitative PCR detection of porcine pseudorabies virus | |
| CN114736990B (en) | Primer probe set and kit for detecting Alapplication virus and enteritis virus of minks based on double microdroplet digital PCR | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |