CN113322350B - Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application - Google Patents
Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application Download PDFInfo
- Publication number
- CN113322350B CN113322350B CN202110488980.4A CN202110488980A CN113322350B CN 113322350 B CN113322350 B CN 113322350B CN 202110488980 A CN202110488980 A CN 202110488980A CN 113322350 B CN113322350 B CN 113322350B
- Authority
- CN
- China
- Prior art keywords
- porcine circovirus
- circovirus type
- primer
- amplification
- raa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses a real-time fluorescent RAA primer and a probe capable of simultaneously and rapidly detecting porcine circovirus type 2 and type 3 viruses, a kit comprising the primer and the probe and application of the kit. The sensitivity of the method of the invention is 102Copies/reactions, each reaction detectable simultaneously at a minimum of 102Copied porcine circovirus type 2 and 102A copied porcine circovirus type 3 virus. The invention can quickly, efficiently and sensitively detect the porcine circovirus type 2 and the porcine circovirus type 3 simultaneously, and provides an effective technical means for quick identification and detection of mixed infection of the porcine circovirus type 2 and the porcine circovirus type 3.
Description
Technical Field
The invention belongs to the technical field of biology, particularly relates to the field of biomedical preventive veterinary medicine inspection, and particularly relates to a kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application thereof.
Background
PCV2 and PCV3 are often infected in a mixed manner, so that the toxicity is mutually enhanced, the immunosuppression of infected swinery is caused, the prevention and control of the infected swinery are more complicated and difficult, and the production efficiency of the swinery is seriously influenced. At present, the detection technologies for PCV2 and PCV3 are mainly serology technology, common PCR method and fluorescent quantitative PCR method. However, these methods have the disadvantages of high cost, special equipment, time consumption, complex sample processing, etc., and generally aim at a single pathogen, and two viruses cannot be identified and detected at the same time, so that the practical application range of the methods is severely limited. Therefore, it is necessary to establish a novel rapid detection method which is simple, rapid, suitable for field application, and capable of simultaneously identifying and detecting the two pathogens.
Disclosure of Invention
The invention aims to solve the technical problem of providing a detection method and a kit which can quickly, simply and specifically identify the porcine circovirus type 2 virus and the porcine circovirus type 3 virus simultaneously. In order to achieve the purpose, the inventor designs primers and probes respectively aiming at porcine circovirus type 2 and porcine circovirus type 3, designs a plurality of primers and probes together, and screens out the optimal primer and probe combination for application in the invention through cross reaction.
The first purpose is to provide primers for identifying and detecting PCV2 and PCV3, which comprise a forward primer and a reverse primer, and are four in total. The primers are designed according to the conserved genes of PCV2 and PCV3, and the conserved regions of PCV2 and PCV3 genes are further determined by performing comparative analysis on gene homologous sequences through software. The PCV2 conserved region is a sequence of Cap genome (MH931449.1), comprises a nucleotide fragment of 758 bases and has a nucleotide sequence shown in SEQ ID NO. 7; the PCV3 conserved region is a segment of sequence of Cap genome (KY075986.1), contains nucleotide fragment of 678 bases, and has a nucleotide sequence shown in SEQ ID NO. 8. The invention designs specific primers by screening from SEQ ID NO.7 and SEQ ID NO.8 sequences respectively. The screened primers comprise a forward primer and a reverse primer, and the length of the primers is about 30 bp.
The invention provides in a first aspect a primer and a probe for simultaneous detection of porcine circovirus type 2 and porcine circovirus type 3 viruses, the primer and probe comprising:
a first primer with a sequence shown as SEQ ID NO.1,
a second primer with the sequence shown in SEQ ID NO.2,
a first probe with a sequence shown in SEQ ID NO.3,
wherein the first primer and the second primer form a primer pair;
a third primer with the sequence shown as SEQ ID NO.4,
a fourth primer with the sequence shown as SEQ ID NO.5,
a second probe with the sequence shown in SEQ ID NO.6,
wherein the third primer and the fourth primer form a primer pair.
It is a second object of the present invention to provide probes for detecting PCV2 and PCV 3. The probes are based on the conserved genes of PCV2 and PCV3, and the conserved regions of PCV2 and PCV3 genes are further determined by the comparative analysis of gene homologous sequences through software. Wherein, the PCV2 region contains a nucleotide fragment of 758 bases and has a nucleotide sequence shown in SEQ ID NO.7, and the PCV3 region contains a nucleotide fragment of 678 bases and has a nucleotide sequence shown in SEQ ID NO. 8. Specific probes are respectively screened from the sequences of SEQ ID NO.7 and SEQ ID NO.8, and the PCV2 probe is designed to have the sequence of SEQ ID NO.3 and modified as follows: (1) the 35 th base modifies BHQ 1-dT; (2) the 33 th base is modified by 6-FAM-dT; (3) the 34 th base is replaced by dSpacer; (4)3' end is modified with C3 Spacer; the PCV3 probe is designed to have a sequence shown in SEQ ID NO.6, and the modification is as follows: (1) a base 33 modified BHQ 1-dT; (2) HEX-dT modified by 29 th base; (3) replacing the 31 st base with dSpacer; (4) the 3' end is modified with C3 Spacer.
In some embodiments, the primer to probe concentration ratio is 2: 1; in some preferred embodiments, the concentration of each primer is 10. mu. mol/L and the concentration of each probe is 5. mu. mol/L.
The third purpose of the invention is to provide a composition or a real-time fluorescent RAA detection kit for simultaneously identifying and detecting porcine circovirus type 2 and porcine circovirus type 3, wherein the composition or the kit adopts the four primers and the two probes,
wherein, the sequences of the four primers and the two probes are shown as follows:
a first primer with a sequence shown as SEQ ID NO.1,
a second primer with the sequence shown in SEQ ID NO.2,
a first probe with a sequence shown in SEQ ID NO.3,
wherein the first primer and the second primer form a primer pair;
a third primer with the sequence shown as SEQ ID NO.4,
a fourth primer with the sequence shown as SEQ ID NO.5,
a second probe with the sequence shown in SEQ ID NO.6,
wherein the third primer and the fourth primer form a primer pair.
In one embodiment, the modification of the first probe SEQ ID NO.3 is as follows: (1) the 35 th base modifies BHQ 1-dT; (2) the 33 th base is modified by 6-FAM-dT; (3) the 34 th base is replaced by dSpacer; (4)3' end is modified with C3 Spacer; the second probe SEQ ID NO.6 is modified as follows: (1) a base 33 modified BHQ 1-dT; (2) HEX-dT modified by 29 th base; (3) replacing the 31 st base with dSpacer; (4) the 3' end is modified with C3 Spacer.
In some embodiments, the primer to probe concentration ratio is 2: 1; in some preferred embodiments, the primer concentration is 10. mu. mol/L and the probe concentration is 5. mu. mol/L.
In one embodiment, the real-time fluorescence RAA detection kit of the present invention further comprises a hydrolysis buffer, magnesium acetate and ddH2O。
In one embodiment, the kit further comprises the use of an isothermal amplification apparatus.
The invention also provides a method for simultaneously and rapidly identifying and detecting porcine circovirus type 2 and porcine circovirus type 3, which comprises the following steps:
(1) extracting a DNA sample of a sample to be detected;
(2) performing a dual real-time fluorescent RAA assay using the primers and probes of the first and second aspects of the invention or using the kit of the third aspect of the invention, using the DNA sample as a template:
in some embodiments, the concentration ratio of the primer to the probe is 2:1, and the amplification reaction is 15-20 min; preferably, the concentration of each primer is 10 μ M/L, the concentration of each probe is 5 μ M/L, and the amplification reaction is 15 min.
Detecting fluorescence signals of FAM and HEX in real time in the reaction process;
the amplification result is analyzed, the average value of the fluorescence signal intensity within 2.5-3.5min from the beginning of amplification plus 3-4 times of Standard Deviation (SD) is taken as a detection threshold, and the result is judged as follows:
(1) if the FAM fluorescence signal value exceeds the threshold value and an inflection point appears within 15min of RAA amplification, and the HEX fluorescence signal does not exceed the threshold value or the inflection point does not appear, the amplification result is that the porcine circovirus type 2 is positive, and the porcine circovirus type 3 is negative;
(2) if the HEX fluorescence signal value exceeds the threshold and an inflection point appears within 15min of RAA amplification, and the FAM fluorescence signal value does not exceed the threshold or the inflection point does not appear, the amplification result is that the porcine circovirus type 3 is positive and the porcine circovirus type 2 is negative;
(3) if the FAM and HEX fluorescence signal values exceed the threshold value and an inflection point appears within 15min of RAA amplification, the amplification result is double positive of porcine circovirus type 2 and porcine circovirus type 3;
(4) if the fluorescence signal values of FAM and HEX do not exceed the threshold value or have no inflection point within 15min of RAA amplification, the amplification result is double negative of porcine circovirus type 2 and porcine circovirus type 3.
In one embodiment, the test sample is subjected to DNA extraction using a Thermo viral nucleic acid extraction kit.
In one embodiment, isothermal amplification apparatus T16-ISO own software Desktop amplification results were used for analysis.
The invention also provides application of the primer and the probe or the real-time fluorescent RAA detection kit in preparation of reagents for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 in a fourth aspect.
Compared with the prior art, the invention at least has the following advantages:
the detection principle of the invention is that the RAA technology is adopted to detect specific conserved target sequences of PCV2 and PCV3, namely conserved sequences of capsid proteins (Cap) of PCV2 and PCV3, and the sequences can be used as one of marker genes of PCV2 and PCV 3. The invention designs specific primers and probes, is the key for detecting PCV2 and PCV3 viruses by using RAA technology, and overcomes the problem that no specific primers and probes for quickly identifying and detecting PCV2 and PCV3 exist at present. The kit prepared based on the primer probe system has strong specificity, high sensitivity and wide detection range: the sensitivity test result shows that the kit can be used for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses, and the sensitivity of the porcine circovirus type 2 and the sensitivity of the porcine circovirus type 3 are both 102Copy/reaction, and has wide detection range, each reaction can detect 106-102A copied virus sample. The result of a specificity test shows that the kit has good specificity, can simultaneously detect the porcine circovirus type 2 and the porcine circovirus type 3, and other viruses such as Classical Swine Fever Virus (CSFV), Swine Vesicular Disease Virus (SVDV), Foot and Mouth Disease Virus (FMDV) and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) can not generate an amplification curve. Clinical samples (30) of suspected porcine circovirus type 2 and porcine circovirus type 3 virus collected were tested by the established real-time fluorescent RAA method and the test was performedThe result is compared with the detection result of the common PCR standard method, and the result shows that the detection result of the invention is completely consistent with the common PCR, namely has 100 percent of conformity.
(2) The method of the invention can be used for simultaneously and rapidly detecting the porcine circovirus type 2 and the porcine circovirus type 3, and can save a great deal of detection time: the whole reaction time of the invention only needs 15min, which is far less than that of real-time fluorescence PCR and common PCR, the single virus needs at least 1.5 hours of reaction, and the two viruses need more than 3 hours to complete;
(3) the method of the invention does not need large-scale instruments and equipment: the invention reduces the reaction temperature, and can complete the test only by keeping the constant temperature at 39 ℃, and the temperature is far lower than 60-95 ℃ of the fluorescent quantitative PCR and 63 ℃ of LAMP. Meanwhile, the invention does not need complicated denaturation and renaturation cycles, so that an expensive fluorescent PCR instrument is not needed, and only small-sized thermostatic equipment is needed. The isothermal amplification instrument T16-ISO adopted by the invention is small in size and can be carried about;
(4) the method of the invention has high sensitivity: the invention can simultaneously detect two viruses of the circovirus type 2 and the porcine circovirus type 3, and each reaction can simultaneously detect 10 viruses at the lowest2Copied porcine circovirus type 2 and 102The sensitivity of the copied porcine circovirus type 3 is consistent with that of the common PCR;
(5) the kit is convenient to carry and simple to operate: the enzyme and other necessary matters required by the reaction are all freeze-dried and stored, and can be stored for a long time at normal temperature; the operation is simple, and corresponding buffer solution, primers, probes, templates, magnesium ions and the like are only needed to be added during the amplification reaction.
(6) The RAA method for detecting PCV2 and PCV3 has high sensitivity and strong specificity. Can be used for rapidly screening porcine circovirus type 2 and porcine circovirus type 3 in the field, basic laboratories or pig farms, and has wide application prospect.
Drawings
The invention is illustrated by the following figures:
FIG. 1 shows the result of PCV2 sensitivity test for detecting dual real-time fluorescence RAA method: the synthesized PCV2, carrying out dilution on the standard plasmid by times, wherein the dilution range is 106-101Copying/reacting, the test conditions are the optimal test conditions, and the test results are shown in the figure. As can be seen from FIG. 1, each reaction of the present invention is detectable 106-102Individual porcine circovirus type 2. Wherein the curves 1 to 6 represent 10 respectively6，105，104，103，102，101(ii) a And 7 represents a negative control.
FIG. 2 shows the result of PCV3 sensitivity test for detecting dual real-time fluorescence RAA method: the synthesized pUC-PCV3 standard plasmid is diluted by times, and the dilution range is 106-101Copying/reacting, the test conditions are the optimal test conditions, and the test results are shown in the figure. It can be seen from FIG. 2 that each reaction of the present invention is detectable 106-102Individual porcine circovirus type 3. Wherein the curves 1 to 6 represent 10 respectively6，105，104，103，102，101(ii) a And 7 represents a negative control.
Fig. 3 is the results of a dual real-time fluorescent RAA specificity assay: and performing reverse transcription on the extracted virus RNAs such as Classical Swine Fever Virus (CSFV), Swine Vesicular Disease Virus (SVDV), Foot and Mouth Disease Virus (FMDV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and the like to synthesize cDNA, and storing for later use. The established double real-time fluorescence RAA detection method is used for detecting cDNA of FMDV, PRRSV, SVDV and CSFV and DNA samples of PCV2 and PCV3, and the specificity of the double real-time fluorescence RAA detection method is tested. As shown in the figure, the PCV2 and PCV3 can generate amplification curves, and no amplification curve is generated in other viruses, so that the detection has good specificity. Wherein curve 1 represents PCV3 and curve 2 represents PCV 2.
Detailed Description
Embodiments of the present application will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present application and should not be construed as limiting the scope of the present application. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market.
Definition of partial terms
Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.
As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.
Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.
The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.
The recombinase polymerase amplification technique (RAA) in the invention is a nucleic acid isothermal rapid amplification technique, and can detect nucleic acid at normal temperature (37 ℃ -42 ℃) within 15-20 minutes. The basic principle is to use recombinase obtained from bacteria or fungi, which can be tightly combined with primer DNA at normal temperature to form enzyme and primer aggregate, when the primer searches the complementary sequence which is completely matched with the primer on the template DNA, the double-stranded structure of the template DNA is opened under the help of single-stranded DNA binding protein, and new DNA complementary strand is formed under the action of DNA polymerase, and the amplification product grows exponentially.
The RAA method established by the invention has higher specificity and has no cross with other common porcine pathogenic pathogen nucleic acidsCarrying out reaction; higher sensitivity, and the minimum detectable PCV2 and PCV3 plasmid copy number is 102Copying/reacting. The method established by the research is the same as the detection sensitivity of the common PCR method established by Sun forest sea and the like. The RAA method established by the research has simple reaction procedure and does not need complex instruments and equipment; the reaction time is short and is less than one third of that of real-time fluorescent quantitative PCR. The detection time of RAA isothermal amplification established in the research can be controlled within 20min, a complex temperature changing device and professional technical personnel guidance are not needed, the rapid and efficient PCV2 and PCV3 nucleic acid detection method suitable for the field can be developed, certain application scenes and practical values are realized, the popularization and the use of basic institutions are facilitated, and the technical guarantee can be provided for the prevention and the control of porcine circovirus.
All primers and probes used in the examples of the present invention were synthesized by Probiotics (Shanghai) Limited liability company. The basic research method of the invention is as follows:
1. the inactivated antigen of the invention:
inactivated antigens such as porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), Classical Swine Fever Virus (CSFV), Swine Vesicular Disease Virus (SVDV), Foot and Mouth Disease Virus (FMDV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and the like are provided and stored by Shenzhen customs animal plant inspection and quarantine technology center.
2. The RAA primer and the probe of the invention are designed, synthesized and screened:
a plurality of specific primers and probes are designed according to a pig genome sequence and a pig related virus gene sequence published in NCBI GenBank, wherein the pig related virus, particularly porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), Classical Swine Fever Virus (CSFV), swine vesicular virus (SVDV), Foot and Mouth Disease Virus (FMDV) and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), and the fluorescent groups of the PCV2 probe and the PCV3 probe are two sets of optimal primer and probe combinations for respectively detecting PCV2 and PCV3 through cross tests. The two sets of primers respectively amplify the fragments of SEQ ID NO.7 and SEQ ID NO. 8.
SEQ ID NO.7:
ttcgtaatggtttttattattcacttagggttaagtggggggtctttaagattaaattctctgaattgtacatacatggttatacggatattgtagtcctggtcgtatatactgttttcgaacgcagtgccgaggcctacatggtctacatttccagtagtttgtagtctcagccagagttgatttcttttgttattgggttggaagtaatcgattgtcctatcaaggacaggtttcggggtaaagtaccgggagtggtaggagaagggctgggttatggtatggcgggaggagtagtttacataggggtcataggttagggcattggcctttgttacaaagttatcatctagaataacagcagtggagcccactcccctgtcaccctgggtgattggggagcagggccagaattcaaccttaaccttccttattctgtagtattcaaagggcacagtgagggggtttgagccccctcctgggggaagaaaatcattaatattaaatctcatcatgtccacattccaggagggcgttctgactgtggttttcttgacagtataaccgatggtgcgggagaggcgggtgttgaagatgtcatttttccttctccagcggtaacggtggcgggggtggacgagccaggggcggcggcggaggatctggccaagatggctgcgggggcggtgtcttcgtctgcggaaacgcctccttggatacgtcatcgctgaaaacgaaagaagtgcgctgtaagtatt。
SEQ ID NO.8:
agatttatatttattttcacttagagaacggacttgtaacgaatccaaacttctttggtgccgtagaagtctgtcattccagttttttccgggacataaatgctccaaagcagtgctccccattgaacggtggggtcatatgtgttgagccatggggtgggtctggagaaaaagaagaggctttgtcctgggtgagcgctggtagttcccgccagaagtggtttgggggtgaagtaacggctgtgtttttttttagaagtcataactttacgagtggaactttccgcataagggtcgtcttggagccaagtgtttgtggtccaggcgccgtctagatctatggctgtgtgcccgaacatagtttttgtttgctgagccggagaaattacagggctgagtgtaactttcatctttagtatcttataatattcaaaggtaattgcagtttcccattcgtttaggcgggtaatgaagtggttggcgtgccagggcttgttattctgaggggttccaacggatatgacgttcatggtggagtatttctttgtgtagtatgtgccagctgtgggcctcctaatgaatagtcttcttctggcatagcgccttctgtggcgtcgtcgtctccttgggcggggtcttcttctgaatatagctctgtgtctcattttggtgccgggc。
TABLE 1 optimal primer and Probe nucleotide sequences for Dual real-time fluorescent RAA method
Wherein the PCV2-P probe (SEQ ID NO.3) is modified as follows: the 35 th base modifies BHQ 1-dT; (2) the 33 th base is modified by 6-FAM-dT; (3) the 34 th base is replaced by dSpacer; (4) modifying C3Spacer at the 3' end;
PCV3-P probe (SEQ ID NO.6) was modified as follows: (1) a base 33 modified BHQ 1-dT; (2) HEX-dT modified by 29 th base; (3) replacing the 31 st base with dSpacer; (4) the 3' end is modified with C3 Spacer.
dSpacer, tetrahydrofuran, serves as an endonuclease recognition site. The C3spacer (C3spacer) is a blocking group to prevent amplification of the probe after self-ligation. The C3spacer is used primarily to mimic the three-carbon spacing between the 3 'and 5' hydroxyls of ribose, or to "replace" an unknown base in a sequence. The 3'-C3 spacer was used to introduce a 3' spacer to prevent the 3 'exonuclease and 3' polymerase from acting, and was supplied by sequence synthesis. BHQ1-dT (tert-butyl-p-propanediol 1-deoxythymidine) is a fluorescence quenching group. 6-FAM-dT (6-carboxyfluorescein-deoxythymidine) is a fluorescent reporter group and emits green fluorescence; HEX-dT (hexachloro-6-methyl fluorescein-deoxythymidine) is a fluorescent reporter group and emits pink fluorescence.
3. Extracting a virus genome:
viral nucleic acids such as porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), swine fever virus (CSFV), Swine Vesicular Disease Virus (SVDV), Foot and Mouth Disease Virus (FMDV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) are respectively extracted on a magnetic bead extraction and purification system by using a Thermo Viral nucleic acid extraction Kit (MagMAX TM-96Viral RNA Isolation Kit, AM 1836). And the concentration of the extracted various virus nucleic acids is determined by a ultramicro nucleic acid protein concentration analyzer.
4. Plasmid DNA standards:
biotechnology engineering (Shanghai) Co., Ltd, synthesizes gene fragment SEQ ID NO.7(758bp) and gene fragment SEQ ID NO.8(678bp), and clones to pUC vector respectively, named as pUC-PCV2 and pUC-PCV 3. The pUC-PCV2 and pUC-PCV3 plasmids were extracted with a plasmid miniprep kit. The concentration of the extracted plasmid is measured by a ultramicro nucleic acid protein concentration analyzer, and the copy number of the plasmid is calculated. The plasmids were diluted to respective copy number concentrations of 106copy/μL、105copy/μL、104copy/μL、103copy/μL、102copy/μL、101copy/. mu.L, as a standard plasmid.
The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
Example 1 establishment of a dual RAA detection method for porcine circovirus type 2 and porcine circovirus type 3.
1) Example 1 design and screening of primers and probes for PCV2 and PCV3
At present, no special program exists for designing RAA primer probes, and primers and probes need to be subjected to an optimized screening test in the test. In the research, 2 pairs of primers and 2 probes are preferentially screened out finally, and a real-time fluorescence RAA detection method for PCV2 and PCV3 is established. The method comprises the following specific steps:
(1) design of primers and probes
The inventors analytically determined that the specific sequences of PCV2 and PCV3 are used as target genes by literature search. Obtaining a known template gene sequence from an NCBI database, and screening a sequence of a Cap genome (MH931449.1) of a PCV2 conserved region, wherein the sequence comprises a nucleotide fragment of 758 bases and has a nucleotide sequence shown in SEQ ID NO. 7; a segment of sequence of Cap genome (KY075986.1) of conserved region of PCV3 region contains nucleotide fragment of 678 bases, has nucleotide sequence shown in SEQ ID NO.8, is synthesized by Biotechnology engineering (Shanghai) GmbH, and is used as positive plasmid which can be used as template in the processes of subsequent primer probe screening, reaction system optimization and the like.
According to the RAA primer and probe design principle, using Prime 6 software, 6 upstream primers, 5 downstream primers and 4 probes (as shown in Table 1) were designed, and the inventors screened the optimal primer sequences by comparing the detection efficiency and fluorescence intensity of different primer combinations.
TABLE 1 primers and probes
(2) Primer screening
Sequences shown in SEQ ID NO.7 and SEQ ID NO.8 of plasmid standard products of PCV2 and PCV3 are artificially synthesized, the plasmid is used as a template, primers and probes are comprehensively combined into 15 groups of primer combinations, and the combination numbers are shown in Table 2. And (3) RAA amplification is carried out on the 15 groups of primer combinations respectively at the temperature of 39 ℃, and the primer probe combination with the highest amplification efficiency at the temperature of 39 ℃ is screened out for evaluation and application of subsequent RAA detection.
The 50 μ L RAA reaction system selected was as follows: hydrolysis buffer 40. mu.L, four primers (PCV2-F, PCV2-R, PCV3-F and PCV3-R) (10. mu.M) each 0.5. mu.L, two probes (PCV-P and PCV-P) (5. mu.M) each 0.5. mu.L, DEPC water 2.5. mu.L, and nucleic acid template 2. mu.L, mixed well and added to RAA lyophilized enzyme powder reaction tube. Then, 2.5. mu.L of a 280mM magnesium acetate solution was added to the reaction tube and mixed well. Considering the conditions that the sensitivity of RAA reaction is high and false positive is easy to occur, the invention sets a group of negative control for each group of primer probe combination, the template is not added in the negative control, and the volume of the template is complemented by water.
And (3) placing the prepared reaction tube into a reaction device for amplification at 39 ℃ for 15 min. Detecting fluorescence signals of FAM and HEX in real time in the reaction process; and finally, analyzing and judging the amplification result.
TABLE 2 Forward and reverse primer Probe combination No. (14 groups)
As is clear from the amplification efficiency and false positive rate in Table 2, group 13 works best, and therefore the primer combinations identified in the present invention include: 4 forward primers P2-F3, P3-F2 and reverse primers P2-R2 and P3-R1 respectively have oligonucleotide sequences shown as SEQ ID NO.1-2 and SEQ ID NO. 4-5.
(3) Determination of the Probe
Sequences shown in SEQ ID NO.7 and SEQ ID NO.8 of plasmid standard products of PCV2 and PCV3 are artificially synthesized, the plasmids are used as templates, and screened primers P3-F2+ P3-R1+ P2-F3+ P2-R2 and 4 probes are used for comprehensively combining into 4 groups of probe combinations, and the combination numbers are shown in Table 3. And (3) RAA amplification is carried out on the 4 groups of probe combinations respectively at the temperature of 39 ℃, and the probe combination with the highest amplification efficiency at the temperature of 39 ℃ is screened out for evaluation and application of subsequent RAA detection.
TABLE 34 group Probe combination numbering
| Numbering | Probe combination | Efficiency of |
| 1 | P2-P1+P3-P1 | +++ |
| 2 | P2-P1+P3-P2 | ++ |
| 3 | P2-P2+P3-P1 | + |
| 4 | P2-P2+P3-P2 | + |
As seen from the amplification efficiencies of table 3, group 1 works best, and therefore the optimal probe combinations identified include: 2P 2-P1+ P3-P1, which have the oligonucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.6 respectively.
Wherein, the nucleotide sequence shown in SEQ ID NO.3 is modified as follows: (1) the 35 th base modifies BHQ 1-dT; (2) the 33 th base is modified by 6-FAM-dT; (3) the 34 th base is replaced by dSpacer; (4)3' end is modified with C3 Spacer;
the nucleotide sequence shown in SEQ ID NO.6 and modified as follows: (1) a base 33 modified BHQ 1-dT; (2) HEX-dT modified by 29 th base; (3) replacing the 31 st base with dSpacer; (4) the 3' end is modified with C3 Spacer.
Example 2: RAA reaction system, optimization of amplification and detection conditions
(1) Concentration of primer Probe
The concentration of each primer is set to be 10 mu mol/L, the concentration gradient of the probe is set to be 10 mu mol/L, 5 mu mol/L and 2.5 mu mol/L, the primers with one concentration are respectively combined with the probes with three concentrations to form 3 groups of combinations (see table 4), and each group of combinations is provided with a group of negative controls. RAA amplification is carried out at 39 ℃ respectively, and after the amplification is finished, the best combination of the amplification effects is screened.
TABLE 4 combination numbering of reverse primer concentrations and Probe concentrations
| Numbering | Combination of | Efficiency of |
| 1 | 10μM(P3-F2+P3-R1+P2-F3+P2-R2)+10μM(P2-P1+P3-P1) | + |
| 2 | 10μM(P3-F2+P3-R1+P2-F3+P2-R2)+5μM(P2-P1+P3-P1) | +++ |
| 3 | 10μM(P3-F2+P3-R1+P2-F3+P2-R2)+2.5μM(P2-P1+P3-P1) | ++ |
Through analysis of detection results, the optimal concentration ratio of the primers to the probes is 2:1, wherein the effect is most obvious when the concentration of each primer is 10 mu mol/L and the optimal concentration of each probe is 5 mu mol/L.
(4) Time of amplification
The 50 μ L RAA reaction was as follows: hydrolysis buffer 40. mu.L, four primers (PCV2-F, PCV2-R, PCV3-F and PCV3-R) (10uM) each 0.5. mu.L, two probes (PCV-P and PCV-P) (5uM) each 0.5. mu.L, DEPC water 2.5. mu.L, and nucleic acid template 2. mu.L were mixed well and added to RAA lyophilized enzyme powder reaction tube. Then, 2.5. mu.L of a 280mM magnesium acetate solution was added to the reaction tube and mixed well. Amplification: the reaction tube is subjected to instantaneous centrifugation and then amplified for 5min,10min, 15min and 20min at 39 ℃.
And (5) judging a result: by analyzing the detection result, the samples with the amplification time of 10min and 5min are detected in a shorter way, and the amplification time finally determined by the method is 15min in consideration of the subsequent sensitivity test.
In conclusion, by optimizing the RAA reaction system, amplification and detection conditions, the present inventors have determined that the detection effect is best when the primer with a concentration of 10. mu.M and the probe with a concentration of 5. mu.M are used for amplification for 15 min.
Based on the optimized system, the double real-time fluorescence RAA detection is carried out by taking the porcine circovirus type 2 and porcine circovirus type 3 double-positive virus DNA extracted from the step 3 as a template, and the specific steps are as follows:
the dual real-time fluorescent RAA reaction system is 50 μ L: 40 mu L of hydrolysis buffer solution, 0.5 mu L of each of four primers (PCV2-F, PCV2-R, PCV3-F and PCV3-R) (10uM), 0.5 mu L of each of two probes (PCV2-P and PCV3-P) (5uM), 2.5 mu L of DEPC water and 2 mu L of nucleic acid template are mixed uniformly and then added into a RAA freeze-dried enzyme powder reaction tube, the mixture is mixed uniformly and centrifuged, and finally, magnesium acetate solution (2.5 mu L) is added and mixed uniformly. Reaction conditions are as follows: and (3) reacting for 15min at 39 ℃ by using an isothermal amplification instrument T16-ISO, and detecting fluorescence signals of FAM (carboxyfluorescein) and HEX (methyl fluorescein) channels in real time in the reaction process.
The isothermal amplification instrument T16-ISO software Desktop analyzes the amplification result, and the result is judged as follows by taking the average value of the fluorescence signal intensity within 3min of the initial amplification plus 3.5 times of Standard Deviation (SD) as a detection threshold:
(1) if the FAM channel fluorescence signal value exceeds the threshold value and an inflection point appears within 15min of RAA amplification, and the HEX channel fluorescence signal does not exceed the threshold value or the inflection point does not appear, the amplification result is that the porcine circovirus type 2 is positive and the porcine circovirus type 3 is negative;
(2) if the HEX channel fluorescence signal value exceeds the threshold value and an inflection point appears within 15min of RAA amplification, and the FAM channel fluorescence signal value does not exceed the threshold value or the inflection point does not appear, the amplification result is that the porcine circovirus type 3 is positive and the porcine circovirus type 2 is negative;
(3) if the fluorescence signal values of the FAM channel and the HEX channel exceed the threshold value and have inflection points within 15min of RAA amplification, the amplification result is double positive of porcine circovirus type 2 and porcine circovirus type 3;
(4) if the fluorescence signal values of the FAM channel and the HEX channel do not exceed the threshold value or have no inflection point within 15min of RAA amplification, the amplification result is double negative of porcine circovirus type 2 and porcine circovirus type 3.
Example 2 sensitivity comparison of dual real-time fluorescent RAA kit and general PCR.
1. And (3) comparing the sensitivity of the double real-time fluorescent RAA kit for detecting the porcine circovirus type 2 with that of the common PCR.
The standard plasmid pUC-PCV2 which was previously prepared in a dilution-by-volume manner was used as a template (the amount of the template was 10 each)6copy/reaction, 105copy/reaction, 104copy/reaction, 103copy/reaction, 102copy/reaction, 101copy/reaction), sensitivity assays were performed according to the dual real-time fluorescent RAA method of example 1. Meanwhile, standard plasmids diluted in the same fold ratio are used as templates, and a common PCR method for porcine circovirus type 2 virus (reference: Sunweier et al. porcine circovirus type 3 and porcine circovirus type 2 double PCR detection) is adopted for samplingEstablishment of the method [ J]The sensitivity comparison was carried out according to the Chinese veterinary bulletin 2019,39(3):393 and 396). As a result, from 102Samples above the beginning of copy/reaction are all positive, which indicates that the sensitivity of the RAA detection method of the invention reaches 102copy/reaction.
Wherein the primer probe of PCV2 common PCR:
an upstream primer: 5'-TTTCAGCGATGACGTATCCAAGGAG-3' (SEQ ID NO.9)
A downstream primer: 5'-TAGTATTCAAAGGGCACAGTGAGGG-3' (SEQ ID NO. 10).
PCV2 general PCR reaction System:
a 25 μ L reaction was used: each reaction contained 12.5. mu.L of premixed DNA polymerase solution-FS, 1. mu.L of each of the upstream and downstream primers (10uM), and 1. mu.L of DNA template, and 4.5. mu.L of sterile deionized water was added thereto and mixed well. The reaction system was placed in a PCR apparatus (T3000) for reaction. Reaction conditions are as follows: pre-denaturation at 98 ℃/300 s; amplification was 98 ℃/10s, 58 ℃/20s, 72 ℃/20s,35 cycles, 72 ℃/300 s. And (4) observing the result after the amplification product is electrophoresed by using a QIAxcel capillary electrophoresis apparatus. The common PCR judgment basis is as follows: under the premise that the negative control and the positive control are both established, the amplified specific band can be judged to be positive.
Results the detection limit of the double real-time fluorescence RAA method for porcine circovirus type 2 virus is 102copy/reaction, consistent with the detection limits of the disclosed PCR detection methods, demonstrates the good sensitivity of the present method. The results of the sensitivity test are shown in FIG. 1, and the results of the sensitivity comparison of the two detection methods are shown in Table 5.
TABLE 5 comparison of the sensitivity of dual real-time fluorescent RAA and real-time fluorescent PCR for porcine circovirus type 2 nucleic acid detection
2. And (3) detecting the porcine circovirus type 3 virus by using the dual real-time fluorescent RAA kit and comparing the sensitivity of the porcine circovirus type 3 virus with the sensitivity of real-time fluorescent PCR. The standard plasmid pUC-PCV3 which was previously prepared in a dilution-by-volume manner was used as a template (the amount of the template was 10 each)6copy/reaction, 105copy/reaction, 104copy/reaction, 103copy/reaction, 102copy/reaction, 101copy/reaction), sensitivity assays were performed according to the dual real-time fluorescent RAA method of example 1. Meanwhile, the standard plasmid diluted by the same fold ratio is used as a template, and a porcine circovirus type 3 virus common PCR method (refer to Sunsheng super et al. double PCR detection method for porcine circovirus type 3 and porcine circovirus type 2) is adopted to establish [ J]The sensitivity comparison was carried out according to the Chinese veterinary bulletin 2019,39(3):393 and 396).
Wherein PCV3 general PCR method:
an upstream primer: 5'-TTACTTAGAGAACGGACTTGTAACG-3' (SEQ ID NO. 11);
a downstream primer: 5'-AAATGAGACACAGAGCTATATTCAG-3' (SEQ ID NO.12),
PCV3 general PCR reaction System:
a 25 μ L reaction was used: each reaction contained 12.5. mu.L of premixed DNA polymerase solution-FS, 1. mu.L of each of the upstream and downstream primers (10uM), and 1. mu.L of DNA template, and 4.5. mu.L of sterile deionized water was added thereto and mixed well. The reaction system was placed in a PCR apparatus (T3000) for reaction. Reaction conditions are as follows: pre-denaturation at 98 ℃/300 s; amplification was 98 ℃/10s, 58 ℃/20s, 72 ℃/20s,35 cycles, 72 ℃/300 s. And (4) observing the result after the amplification product is electrophoresed by using a QIAxcel capillary electrophoresis apparatus.
Results the detection limit of the double real-time fluorescence RAA method for porcine circovirus type 3 virus is 102copy/reaction, consistent with the detection limit of the existing PCR detection method, indicates that the method of the invention has good sensitivity. The results of the dual real-time fluorescence RAA sensitivity test are shown in FIG. 2, and the results of the sensitivity comparison of the two detection methods are shown in Table 6.
TABLE 6 detection of porcine circovirus type 3 viral nucleic acids by dual real-time fluorescent RAA and real-time fluorescent PCR
Example 3 specific assay for dual real-time fluorescent RAA kit.
And performing reverse transcription on the extracted virus RNA such as FMDV, SVDV, PRRSV, CSFV and the like to synthesize cDNA, and storing for later use. The double real-time fluorescent RAA kit is used for detecting cDNA of FMDV, SVDV, PRRSV and CSFV and DNA samples of PCV2 and PCV3 so as to determine the specificity of the double real-time fluorescent RAA detection method.
The results are shown in FIG. 3. The test result shows that the invention can simultaneously detect the porcine circovirus type 2 and the porcine circovirus type 3, and other virus nucleic acids have no amplification curve, which shows that the dual real-time fluorescence RAA kit has good specificity.
Example 4 clinical sample application.
Furthermore, 28 parts (numbered as 1-28) of clinical samples suspected of porcine circovirus type 2 and porcine circovirus type 3 viruses and 2 parts (numbered as 29, 30) of negative control samples are detected by using the kit provided by the invention, wherein the clinical samples are blood samples of pigs, and the negative control samples are blood samples of healthy uninfected pigs. DNA was extracted separately on a magnetic bead extraction purification system using a Thermo Viral nucleic acid extraction Kit (MagMAXTM-96Viral RNA Isolation Kit, AM 1836). The double real-time fluorescent RAA kit of the invention is used for detecting the DNA sample, and the result is compared with the detection result of real-time fluorescent PCR, and the result is shown in Table 4. The results show that: in 28 clinical samples, 6 parts of porcine circovirus type 2 and porcine circovirus type 3 virus double positive, 10 parts of single porcine circovirus type 2 positive, 3 parts of single porcine circovirus type 3 virus and 9 parts of two virus double negative; the negative control detection results are negative.
Therefore, the coincidence rate of the dual real-time fluorescence RAA kit established by the invention and the real-time fluorescence PCR is 100%.
Table 7 comparison of PCV2 and PCV3 dual real-time fluorescence RAA and common PCR clinical detection results
In view of the foregoing, it is intended that the present invention cover all such modifications as would be obvious to one skilled in the art. The contents of the present invention are not limited to the above-described embodiments, and equivalent changes or modifications made according to the spirit of the technical idea of the present invention are within the protective scope of the present invention.
Sequence listing
<110> Shenzhen customs animal and plant inspection and quarantine technical center
<120> kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctctgaattg tacatacatg gttatacgga tattg 35
<210> 2
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctgtccttga taggacaatc gattacttcc aaccc 35
<210> 3
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgaacgcagt gccgaggcct acatggtcta caccagtagt ttgtag 46
<210> 4
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cggacttgta acgaatccaa acttctttgg tgccg 35
<210> 5
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccccatggct caacacatat gaccccaccg ttcaa 35
<210> 6
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtctgtcatt ccagtttttt ccgggacagc tccaaagcag tgc 43
<210> 7
<211> 758
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttcgtaatgg tttttattat tcacttaggg ttaagtgggg ggtctttaag attaaattct 60
ctgaattgta catacatggt tatacggata ttgtagtcct ggtcgtatat actgttttcg 120
aacgcagtgc cgaggcctac atggtctaca tttccagtag tttgtagtct cagccagagt 180
tgatttcttt tgttattggg ttggaagtaa tcgattgtcc tatcaaggac aggtttcggg 240
gtaaagtacc gggagtggta ggagaagggc tgggttatgg tatggcggga ggagtagttt 300
acataggggt cataggttag ggcattggcc tttgttacaa agttatcatc tagaataaca 360
gcagtggagc ccactcccct gtcaccctgg gtgattgggg agcagggcca gaattcaacc 420
ttaaccttcc ttattctgta gtattcaaag ggcacagtga gggggtttga gccccctcct 480
gggggaagaa aatcattaat attaaatctc atcatgtcca cattccagga gggcgttctg 540
actgtggttt tcttgacagt ataaccgatg gtgcgggaga ggcgggtgtt gaagatgtca 600
tttttccttc tccagcggta acggtggcgg gggtggacga gccaggggcg gcggcggagg 660
atctggccaa gatggctgcg ggggcggtgt cttcgtctgc ggaaacgcct ccttggatac 720
gtcatcgctg aaaacgaaag aagtgcgctg taagtatt 758
<210> 8
<211> 678
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
agatttatat ttattttcac ttagagaacg gacttgtaac gaatccaaac ttctttggtg 60
ccgtagaagt ctgtcattcc agttttttcc gggacataaa tgctccaaag cagtgctccc 120
cattgaacgg tggggtcata tgtgttgagc catggggtgg gtctggagaa aaagaagagg 180
ctttgtcctg ggtgagcgct ggtagttccc gccagaagtg gtttgggggt gaagtaacgg 240
ctgtgttttt ttttagaagt cataacttta cgagtggaac tttccgcata agggtcgtct 300
tggagccaag tgtttgtggt ccaggcgccg tctagatcta tggctgtgtg cccgaacata 360
gtttttgttt gctgagccgg agaaattaca gggctgagtg taactttcat ctttagtatc 420
ttataatatt caaaggtaat tgcagtttcc cattcgttta ggcgggtaat gaagtggttg 480
gcgtgccagg gcttgttatt ctgaggggtt ccaacggata tgacgttcat ggtggagtat 540
ttctttgtgt agtatgtgcc agctgtgggc ctcctaatga atagtcttct tctggcatag 600
cgccttctgt ggcgtcgtcg tctccttggg cggggtcttc ttctgaatat agctctgtgt 660
ctcattttgg tgccgggc 678
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tttcagcgat gacgtatcca aggag 25
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tagtattcaa agggcacagt gaggg 25
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttacttagag aacggacttg taacg 25
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aaatgagaca cagagctata ttcag 25
Claims (8)
1. A real-time fluorescent RAA primer probe group capable of simultaneously and rapidly detecting porcine circovirus type 2 and type 3 is characterized in that the primer sequences are shown as SEQ ID NO.1-2 and 4-5, and the probe sequences are shown as SEQ ID NO.3 and 6; the SEQ ID NO.3 is modified as follows: (1) the 35 th base modifies BHQ 1-dT; (2) the 33 th base is modified by 6-FAM-dT; (3) the 34 th base is replaced by dSpacer; (4)3' end is modified with C3 Spacer;
the SEQ ID NO.6 is modified as follows: (1) a base 33 modified BHQ 1-dT; (2) HEX-dT modified by 29 th base; (3) replacing the 31 st base with dSpacer; (4)3' end is modified with C3 Spacer;
the concentration ratio of the primer to the probe is 2: 1.
2. The real-time fluorescent RAA primer probe set of claim 1, wherein: the primer concentration is 10 mu mol/L for each primer, and the probe concentration is 5 mu mol/L for each probe.
3. A composition comprising the real-time fluorescent RAA primer probe set of claim 1 or 2.
4. A detection kit for simultaneously and rapidly detecting porcine circovirus type 2 and type 3, comprising the fluorescent RAA primer probe set of claim 1 or 2.
5. Use of the fluorescent RAA primer probe set of claim 1 or 2 in the preparation of a formulation for simultaneous detection of porcine circovirus type 2 and porcine circovirus type 3 viruses.
6. The use of claim 5, wherein said detecting comprises:
(1) extracting DNA of a sample to be detected;
(2) performing dual real-time fluorescence RAA detection by using the DNA as a template and the primer probe set according to claim 1 or 2, wherein the concentration ratio of the primer to the probe is 2:1, and the amplification reaction lasts for 15-20 min; the concentration of each primer is 10 mu mol/L, the concentration of each probe is 5 mu mol/L, and the amplification reaction lasts 15 min; and detecting fluorescence signals of FAM and HEX in real time during the reaction process.
7. Use according to claim 6, characterized in that the results are judged as follows:
(a) if the FAM fluorescence signal value exceeds the threshold value and an inflection point appears within 15min of RAA amplification, and the HEX fluorescence signal does not exceed the threshold value or the inflection point does not appear, the amplification result is that the porcine circovirus type 2 is positive, and the porcine circovirus type 3 is negative;
(b) if the HEX fluorescence signal value exceeds the threshold value and an inflection point appears within 15min of RAA amplification, and the FAM fluorescence signal value does not exceed the threshold value or the inflection point does not appear, the amplification result is that the porcine circovirus type 3 virus is positive and the porcine circovirus type 2 virus is negative;
(c) if the FAM and HEX fluorescence signal values exceed the threshold value and an inflection point appears within 15min of RAA amplification, the amplification result is that the porcine circovirus type 2 and porcine circovirus type 3 viruses are double positive;
(d) if the fluorescence signal values of FAM and HEX do not exceed the threshold value or have no inflection point within 15min of RAA amplification, the amplification result is double negative of porcine circovirus type 2 and porcine circovirus type 3.
8. The use of claim 7, wherein the sample to be tested is subjected to DNA extraction using a Thermo viral nucleic acid extraction kit; the results of the amplification were analyzed using isothermal amplification apparatus T16-ISO software Desktop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110488980.4A CN113322350B (en) | 2021-05-06 | 2021-05-06 | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110488980.4A CN113322350B (en) | 2021-05-06 | 2021-05-06 | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113322350A CN113322350A (en) | 2021-08-31 |
| CN113322350B true CN113322350B (en) | 2022-04-08 |
Family
ID=77414346
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110488980.4A Active CN113322350B (en) | 2021-05-06 | 2021-05-06 | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113322350B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384890A (en) * | 2018-03-29 | 2018-08-10 | 河南省动物疫病预防控制中心 | Differentiate the double FQ-PCR detection kits of porcine circovirus 2 type and 3 types |
| CN110423846A (en) * | 2019-07-26 | 2019-11-08 | 博奥生物集团有限公司 | A kind of primer combination, detection method and the kit of the LAMP for the parting detection that can distinguish porcine circovirus 2 type and 3 types |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2313806A1 (en) * | 1997-12-11 | 1999-06-17 | University Of Saskatchewan | Postweaning multisystemic wasting syndrome virus from pigs |
| KR100923345B1 (en) * | 2007-03-26 | 2009-10-22 | 대한민국(관리부서 : 농림수산식품부 국립수의과학검역원) | Dna chip, gene analysis test kit using oligo-gene chip |
| CN105525040B (en) * | 2016-01-28 | 2019-03-01 | 中国农业科学院兰州兽医研究所 | The quickly real-time fluorescence RPA kit, test strips RPA kit and application thereof of detection 2 type circovirus of pig |
| CN106566896A (en) * | 2016-10-25 | 2017-04-19 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Reagent and detection method for detecting porcine circovirus type 2 and application |
| CN107287349B (en) * | 2017-06-23 | 2018-10-23 | 河南农业大学 | A kind of multiple RPA primer and probes and its detection method being used for while detecting NDV, IBV and H9N2 hypotype AIV |
| CN107385112A (en) * | 2017-08-22 | 2017-11-24 | 河北省检验检疫科学技术研究院 | Detect nucleic acid, real-time fluorescence RPA kits and the method for the type of pig circular ring virus 3 |
| CN108504778B (en) * | 2018-04-20 | 2019-06-11 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application |
| CN110283938B (en) * | 2019-06-20 | 2023-08-08 | 华南农业大学 | Dual RT-RAA detection primer set of PEDV and PDCoV, kit and application |
-
2021
- 2021-05-06 CN CN202110488980.4A patent/CN113322350B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384890A (en) * | 2018-03-29 | 2018-08-10 | 河南省动物疫病预防控制中心 | Differentiate the double FQ-PCR detection kits of porcine circovirus 2 type and 3 types |
| CN110423846A (en) * | 2019-07-26 | 2019-11-08 | 博奥生物集团有限公司 | A kind of primer combination, detection method and the kit of the LAMP for the parting detection that can distinguish porcine circovirus 2 type and 3 types |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113322350A (en) | 2021-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN107190104B (en) | Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application | |
| CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| CN108866243B (en) | Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit | |
| CN108950068B (en) | Kit for identifying and detecting QX-type strains of chicken infectious bronchitis viruses | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| CN110699485A (en) | RPA primer pair, probe, kit and detection method for rapidly detecting Marek's disease virus | |
| CN108624713B (en) | Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus | |
| CN113174446A (en) | One-step double RT-PCR detection method for bovine viral diarrhea virus typing | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN113322350B (en) | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application | |
| CN114214458B (en) | Multiplex fluorescent quantitative PCR (polymerase chain reaction) primer and probe for simultaneously detecting four pig reproductive disorder pathogens and method thereof | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN112626278B (en) | Primer and probe for identifying canine distemper virus wild strain and vaccine strain and application | |
| CN108676922A (en) | Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN114634996A (en) | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof | |
| CN113337643A (en) | RT-LAMP primer group and kit for detecting bluetongue virus, animal epidemic hemorrhagic disease virus and paliyama virus | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN112877479A (en) | Primer for rapidly detecting exogenous viruses in porcine pseudorabies live vaccine and application of primer in kit | |
| CN111500773A (en) | Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus | |
| CN111235317A (en) | Primer composition, kit and method for detecting PRRSV (porcine reproductive and respiratory syndrome Virus) and PCV (porcine circovirus Virus) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |