CN114395643A - Double-channel digital PCR detection kit and method for African swine fever virus - Google Patents

Abstract

The invention relates to the field of virus detection, in particular to a dual-channel digital PCR detection kit and a method for African swine fever virus. The invention provides a dual-channel microdroplet digital PCR detection kit and a method for African swine fever virus, which can detect various different types of strains and identify whether the strains are EP402R deletion strains. In addition, the product provided by the invention has good specificity and sensitivity: among several common porcine viruses, only African swine fever virus was amplified, with minimum detection limits as low as 0.43 copies/. mu.L and 2.6 copies/. mu.L for the plasmids pMD18T-EP402R and pMD18T-B646L, respectively. Therefore, the method has the potential of accurately detecting the recessive infection of the African swine fever virus, and can be applied to the rapid detection of the swine fever virus, particularly the EP402R gene deletion strain in clinic and production.

Description

Double-channel digital PCR detection kit and method for African swine fever virus

Technical Field

The invention relates to the field of virus detection, in particular to a dual-channel digital PCR detection kit and a method for African swine fever virus.

Background

African Swine Fever (ASF) is a viral hemorrhagic disease, the etiology of which is African Swine Fever Virus (ASFV), which has a very high lethality rate in domestic pigs and European and Asian wild pigs. Although the host range is limited and people cannot be infected, the economic loss and social influence caused by the disease are huge, and the disease has devastating attack on the pig breeding industry in China since the introduction of 2018 into China. The disease is easily transmitted in a direct contact mode through pollutants, fetuses, excrement, pathological tissues, polluted feed, drinking water and the like of infected pigs, a wide-range transmission chain is easily formed, and besides, arthropods (soft ticks), mice, mosquitoes, flies and the like can also carry African swine fever viruses and cause transmission.

The early epidemic African swine fever virus in China is generally a wild strain, and has no obvious gene deletion phenomenon, but along with the continuous propagation and spread of the virus in animals and the continuous spread of the virus among various epidemic areas, particularly the unauthorized use of suspected illegal vaccines, strains with partial gene deletion have appeared at present. Most of the strains lack gene segments related to partial virulence of the virus, such as an EP402R gene (CD2v protein gene), an MGF-505-3R gene and the like, wherein the EP402R gene is mostly deleted. These gene-deleted strains have weakened virulence in pigs, have low virus titer and are clinically frequently recessive infected. The wild strain and the gene deletion strain exist for a long time and continuously expel toxin, so that a new African swine fever epidemic situation is caused, and the accurate prevention, control and purification of the African swine fever virus are not facilitated. Therefore, the detection and identification of the wild strain and the gene deletion strain of the African swine fever virus are significant.

At present, the fluorescence quantitative PCR detection method is widely used in clinic and production, and with the emergence and propagation of the recessive infection of the African swine fever virus, the sensitivity of the fluorescence quantitative PCR detection of the African swine fever virus is challenged. The invention designs and synthesizes primer, probe and recombinant plasmid independently, and adopts micro-drop digital PCR reaction to obtain qualitative or quantitative detection result. Compared with the prior art such as fluorescent quantitative PCR and the like, the method has better sensitivity, specificity and accuracy, can effectively avoid the occurrence of false negative and false positive results, but cannot identify and detect wild strains and gene deletion strains on the basis of two sections of conserved sequences VP72 and K205R.

Therefore, there is a need to develop products for rapid detection and identification of African swine fever virus gene-deleted strains, especially EP402R gene-deleted strains.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide a product and a method of dual-channel digital PCR for detecting wild strains of african swine fever virus and EP402R gene-deleted strains.

The invention provides a detection primer and a probe of African swine fever virus EP402R gene, which comprises the following components:

the upstream primer of the EP402R gene has a nucleic acid sequence shown as SEQ ID NO. 1;

the downstream primer of the EP402R gene has a nucleic acid sequence shown as SEQ ID NO. 2;

the nucleic acid sequence of the EP402R gene probe is shown in SEQ ID NO. 3.

The EP402R gene probe is characterized in that the 5 'end is marked with a fluorescence reporter group HEX, and the 3' end is marked with a fluorescence quenching group BHQ 1.

Compared with the prior art, the primers of the EP402R gene provided by the invention have higher conservative property and can be suitable for more types of strains.

The EP402R primers and probes were able to specifically bind to the EP402R gene.

The invention also provides a detection primer and a probe of the African swine fever virus B646L gene, which comprise:

the upstream primer of the B646L gene has a nucleic acid sequence shown as SEQ ID NO. 4;

the downstream primer of the B646L gene has a nucleic acid sequence shown as SEQ ID NO. 5;

the nucleic acid sequence of the B646L gene probe is shown in SEQ ID NO. 6.

The B646L gene probe is marked with a fluorescence reporter group FAM at the 5 'end and a fluorescence quenching group MGB at the 3' end.

The B646L gene primer and probe can be specifically combined with the B646L gene.

The invention also provides a digital PCR detection kit for wild African swine fever virus and EP402R deletion type, which comprises the primer and the probe.

The kit of the invention also comprises: a plasmid containing an African swine fever virus EP402R gene sequence and a plasmid containing an African swine fever virus B646L gene sequence.

The kit of the invention also comprises microdroplet PCR enzyme and sterile water.

The invention also provides a digital PCR detection method of the African swine fever virus wild type and the EP402R deletion type for non-diagnosis purposes, which comprises the step of detecting a sample by using the primer and the probe.

In the detection method of the invention, the sample is from pig pollutants, including feed, water and pigsty soil.

In the detection method, the source of the sample also comprises collected porcine serum and tissues.

In the detection method, the amplification temperature is detected to be 50-53.9 ℃, and the fluorescence channels are HEX and FAM.

Specifically, the method comprises the following steps:

I. preparing a digital PCR reaction system, wherein the reaction system comprises:

generation of digital PCR droplets

Performing droplet digital PCR amplification. The procedure for amplification was: activating enzyme at 95 deg.C for 10 min; denaturation at 94 ℃ for 30s, annealing (for many hours) at 50-60 ℃ for 1min, and performing 40 cycles; enzyme inactivation at 98 deg.C for 10 min.

Test fluorescence. Sequentially selecting FAM and HEX fluorescence channels, and reading the fluorescence signals of the amplified system;

and V, judging the detection result according to the fluorescence signal.

In the detection method of the invention, the judgment standard of the detection result is as follows:

the FAM channel has no fluorescent signal, and the African swine fever virus is negative.

And the FAM channel and the HEX channel both have fluorescence signals, so that the African swine fever virus is positive.

The FAM channel has a fluorescent signal, but the HEX channel does not have a fluorescent signal, so that the African swine fever virus EP402R deletion strain is positive.

The invention provides a dual-channel microdroplet digital PCR detection kit and a method for African swine fever virus, which can detect various different types of strains and identify whether the strains are EP402R deletion strains. In addition, the product provided by the invention has good specificity and sensitivity: among several common porcine viruses, only African swine fever virus was amplified, with minimum detection limits as low as 0.43 copies/. mu.L and 2.6 copies/. mu.L for the plasmids pMD18T-EP402R and pMD18T-B646L, respectively. Therefore, the method has the potential of accurately detecting the recessive infection of the African swine fever virus, and can be applied to the rapid detection of the swine fever virus, particularly the EP402R gene deletion strain in clinic and production.

Drawings

FIG. 1 shows the sequences in different strains of African swine fever virus that match the upstream primer of the EP402R gene of the prior art;

FIG. 2 shows the sequences of different African swine fever virus strains matched with the upstream primer of the EP402R gene designed by the invention;

FIG. 3 shows the sequences of different African swine fever virus strains matched with the downstream primer of the EP402R gene designed by the invention;

FIG. 4 shows sequences in different strains of African swine fever virus that match the EP402R gene probe designed according to the present invention;

FIG. 5 is an annealing temperature gradient optimization chart of EP402R gene;

FIG. 6 is an annealing temperature gradient optimization chart of the B646L gene;

FIG. 7 is a diagram showing detection of a nonspecific pathogen nucleic acid by a specific primer and a probe for EP402R gene;

FIG. 8 is a diagram showing detection of a nonspecific pathogen nucleic acid by specific primers and probes for the B646L gene;

FIG. 9 shows the result of detecting pMD18T-EP402R plasmid by using a single detection system with different combinations of primers and probes according to the present invention;

FIG. 10 shows the result of detecting pMD18T-B646L plasmid by using a single detection system with different combinations of primers and probes according to the present invention;

FIG. 11 is a microdroplet distribution diagram of microdroplet digital PCR sensitivity detection using pMD18T-EP402R plasmid as a template;

FIG. 12 is a graph of copy number concentrations for microdroplet digital PCR sensitivity tests using pMD18T-EP402R plasmid as a template;

FIG. 13 is a microdroplet distribution diagram of microdroplet digital PCR sensitivity detection using pMD18T-B646L plasmid as a template;

FIG. 14 is a graph of the copy number concentration of the sensitivity of microdroplet digital PCR using pMD18T-B646L plasmid as a template;

FIG. 15 is a copy number standard curve of pMD18T-EP402R plasmid template for microdroplet digital PCR sensitivity testing;

FIG. 16 is a copy number standard curve for microdroplet digital PCR sensitivity testing using pMD18T-B646L plasmid as a template.

Detailed Description

The invention provides a dual-channel digital PCR detection kit and a method for African swine fever virus, and a person skilled in the art can realize the detection by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

Example 1 preparation method of African swine fever virus droplet type digital PCR dual-channel detection kit

1. Design and synthesis of primers and probes

(1) Design of primers and probes

Designing a corresponding probe and primer by referring to a primer aiming at the African swine fever virus B646L gene and a specific Taq-Man probe published by a Chinese animal epidemic disease prevention control center, marking a fluorescence reporter group FAM at the 5 'end of the probe, and marking a fluorescence quenching group MGB at the 3' end of the probe;

designing a specific primer and a Taq-Man probe according to an EP402R gene of a GZ201801 virulent strain of African swine fever virus by using oligo7 primer probe software, and marking a fluorescence reporter group HEX at the 5 'end of the probe and a fluorescence quenching group BHQ1 at the 3' end of the probe;

the primers and probes designed aiming at the EP402R gene are compared with the corresponding sequences in 22 African swine fever viruses, the range of strains which can be detected by the primers and probes designed by the patent is analyzed, and the results are shown in the attached figures 1, 2, 3 and 4. As shown in the attached figure 1, the upstream primer for detecting the gene in the prior art can not be completely matched with the corresponding sequence of the gene in the gene type I strain, and can only be completely matched with the corresponding sequence of the gene in a partial strain; as shown in figure 2, the upstream primer designed by the invention can be completely matched with the corresponding sequences of 22 African swine fever strains; as shown in figure 3, the designed downstream primer can be completely matched with the sequences corresponding to the downstream primer in 22 common African swine fever strains; as shown in figure 4, the probe designed by the invention can be completely matched with the corresponding sequence in 22 common African swine fever strains. Therefore, compared with other commonly used detection primers or probes, the primers and probes of the EP402R gene designed by the invention can detect a wider range of strains.

The primers and probes designed according to the invention aiming at the EP402R gene have extremely high conservation, and are designed based on the conserved segment of the EP402R gene of the GZ201801 virulent strain, but can be completely matched with other 22 common strains including the genotype I and the genotype II. The EP402R primer and the probe designed by the invention have wide detection range, have the potential to cope with unknown African swine fever virus strains which may appear in China in the future, carry out early rapid diagnosis and identification on the unknown African swine fever virus strains, and provide a solid prevention and control means for preventing the unknown African swine fever virus strains from being transmitted into China in the future.

The sequences of the primers and probes designed above are shown below:

EP402R gene upstream primer: 5'-ATGTTGAAGAAATAGAAAGTC-3', respectively;

downstream primer of EP402R gene: 5'-GACTGTAAGGCTTAGGAA-3', respectively;

EP402R gene probe: 5 '- (HEX) TGACACCACTTCCATACATGAACCA (BHQ1) -3';

B646L gene upstream primer: 5'-ATAGAGATACAGCTCTTCCAG-3', respectively;

B646L gene downstream primer: 5'-GTATGTAAGAGCTGCAGAAC-3', respectively;

B646L gene probe: 5 '- (FAM) TATCGATAAGATTGAT(MGB) -3'.

(2) Design and construction of recombinant plasmids

1) Extracting African swine fever virus whole genome DNA

Extracting whole genome DNA from a culture solution of inactivated African swine fever GZ201801 virulent strain virus by using a micro-virus DNA/RNA extraction kit of AXYGEN company;

2) amplifying and purifying specific fragment

And (2) taking the extracted African swine fever virus whole genome DNA as a PCR template, and performing PCR reaction by using the upstream primer and the downstream primer designed in the step 1 to respectively amplify the fragments of the EP402R gene and the B646L gene of the African swine fever virus. The PCR amplification system comprises:

the PCR amplification procedure is as follows:

pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 50 ℃ for 15s, extension at 72 ℃ for 1min, and performing 35 cycles; final extension at 72 deg.C for 5min, and storing at 4 deg.C. The sample PCR reaction was performed while a negative control was set.

Preparing 2% agarose gel, heating to dissolve, cooling to about 60 ℃, adding a corresponding amount of nucleic acid dye (Goldview) by using a liquid-transferring gun, shaking uniformly, pouring into a gel plate, inserting a comb, keeping flat and standing until the gel is solidified. 10 mu.L of 10 Xnucleic acid buffer (loading buffer) and PCR products of a reaction system are mixed uniformly, then the mixture is spotted into the gel, electrophoresis is carried out for 20min at 150V, and the gel is placed in a gel ultraviolet imaging system for electrophoresis result analysis. The products of positive results were purified according to the instructions of the PCR purification kit and sent to Guangzhou Rui Bo Biotech, Inc. for sequencing.

3) T-A cloning and transformation into competent cells:

the purified PCR product was blunt-ended with an A-tail added and purified. The method comprises the following specific steps:

mu.L of the purified PCR product (obtained in step 2) was added with 25. mu.L of thermal amplification enzyme (Ex Taq) and reacted at 72 ℃ for 30min to add an A tail to the blunt end.

The A-tailed product was purified, ligated into a T-Vector (pMD18-T Vector), and subjected to T-A cloning. The reaction system for connecting the product with the A tail and the T carrier is as follows: 0.5. mu.L of Vector (pMD TM18-T Vector), 5. mu.L of buffer (Solution I), and 5.5. mu.L of purified ligation product. After the ligation system was prepared, the reaction mixture was left at 37 ℃ for 30min for ligation. The ligation system was then transformed into competent cell DH 5. alpha. by the following specific steps: adding 10 μ of the ligation system into 100 μ L of competent cells by point, ice-cooling for 30min, water-cooling for 90s at 42 deg.C, ice-cooling for 5min, adding 500 μ L of bacteria-free culture medium, and shake-culturing at 37 deg.C for 45 min. Centrifuging, removing supernatant, uniformly coating the residual thallus in a plate culture medium containing ampicillin, drying, placing in a 37 deg.C incubator, and culturing for 10-12 h.

4) Positive colonies were cultured and sequenced

Selecting positive colonies from the plate culture medium in the step 3 for culture, and specifically comprising the following steps:

and picking positive colonies by using an autoclaved 10-mu-L gun head, putting the positive colonies into 500-mu-L bacteria-free culture medium, carrying out shake culture on a shaker at 37 ℃ for 4 hours, and carrying out PCR identification on bacteria liquid.

The PCR reaction system of the bacterial liquid comprises: 10 μ L of thermal amplification enzyme (Ex Taq), 1 μ L of upstream primer, 1 μ L of downstream primer, 7 μ L of sterile water, and 2 μ L of bacterial liquid.

The PCR reaction procedure of the bacterial liquid is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s, for 25 cycles; final extension at 72 deg.c for 4min, storing at 4 deg.c, and setting negative control while PCR reaction. Then selecting a clone plasmid with a correct sequencing result, and respectively naming the clone plasmid with the correct sequencing as pMD18T-EP402R and pMD18T-B646L to complete the construction.

Example 2 identification of wild and deleted strains of African Swine fever Virus Using digital PCR in the form of droplets

Droplet digital PCR (ddPCR) is a new generation of Polymerase Chain Reaction (PCR) technology that has emerged in recent years. The reaction solution is divided into tens of thousands of microdroplets with nanometer sizes by using a water-in-oil technology, each microdroplet is an independent PCR reaction system, after the PCR amplification is finished, a microdroplet analyzer is used for detecting each microdroplet one by one, and the number and the proportion of positive microdroplets are analyzed according to the Poisson distribution principle in statistics, so that the initial copy number or the concentration of target molecules can be obtained, and the absolute quantification of nucleic acid molecules with the number as low as a single copy is realized. Compared with the traditional real-time fluorescent quantitative PCR (qPCR) method, the method does not depend on a standard curve, so that the quantitative result is more accurate, and meanwhile, the system is greatly reduced by the influence of reaction inhibition factors, and the sensitivity and the specificity are higher. By utilizing the characteristics of microdroplet digital PCR, the technology can be applied to high-sensitivity quantitative detection of trace virus copies in environment and animal blood samples, so that the aim of successfully monitoring the virus in the early stage is fulfilled, and further accurate epidemic prevention measures are taken in time.

1. Specific steps for detecting African swine fever virus by micro-drop digital PCR

The micro-drop type digital PCR experiment needs to use a Bio-Rad QX200 micro-drop PCR instrument, and the main experimental steps are as follows:

1) preparing a 20 mu L micro-drop digital PCR reaction system, wherein the reaction system comprises:

2) generating digital PCR droplets

Adding 20 μ L of the reaction system into 8 wells in the middle row of the droplet generation card, taking care to slowly add to avoid generating bubbles; adding 70 μ L of droplet generation oil to each of the 8 wells in the bottom row of the droplet generation card; covering with rubber pad, and firmly hooking the small holes at two sides. Then placing the microdroplet generation card in a microdroplet generation instrument to start generating microdroplets; eventually, droplets will be generated in the uppermost row of wells of the droplet generation card.

3) Performing droplet digital PCR amplification

Absorbing 40 mu L of the generated water-in-oil droplets, transferring the water-in-oil droplets into a 96-well plate, and sealing the water-in-oil droplets by using a preheated PX1 heat sealing instrument under the conditions of 180 ℃ and 5 s;

the procedure of the droplet-type digital PCR amplification is as follows: activating enzyme at 95 deg.C for 10 min; denaturation at 94 ℃ for 30s, annealing and extension at 50-60 ℃ for 1min, and performing 40 cycles; enzyme inactivation at 98 deg.C for 10 min. The temperature rising and reducing speed is set to be 2 ℃/s; storing at 4 deg.C/s, and setting the cooling rate at 1 deg.C/s. The heating lid was set at 105 ℃ and the sample volume was set at 40. mu.L.

And (4) analyzing results: stably placing the amplified 96-well plate on a QX200 microdroplet reader, opening QuantSoft software, selecting a corresponding fluorescence channel, and reading microdroplet results; the template for the negative control in the experiment was sterile water.

2. Micro-drop type digital PCR annealing temperature optimization experiment

The method of example 2, step 1, was used to perform digital PCR in micro-drop mode with different annealing temperatures. Respectively using 1.5X 10⁴copies/. mu.L of pMD18T-EP402R, 1.2X 10⁴The copy/. mu.L pMD18T-B646L recombinant plasmid is used as a template, and the annealing temperature gradient of the droplet digital PCR is set as follows: 60 ℃, 59.4 ℃, 58.3 ℃, 56.3 ℃, 53.9 ℃, 52 ℃, 50.7 ℃, 50 ℃ to generate the maximum number of positive droplets, and the optimal annealing temperature is selected based on the most obvious distinction between positive droplets and negative droplets.

The results are shown in figures 5 and 6,

FIG. 5 is an annealing temperature gradient optimization chart of EP402R gene detected by HEX fluorescence channel, the abscissa is the number of oil drops, the ordinate is fluorescence intensity, it can be observed that the dividing threshold of positive and negative microdroplets of the probe and primer of EP402R gene is at the position with the fluorescence intensity of 2695, and the temperature interval with the most excellent annealing effect is 50-53.9 ℃;

FIG. 6 is an annealing temperature gradient optimization chart of B646L gene detected by FAM fluorescence channel, the abscissa is the number of oil drops, the ordinate is fluorescence intensity, it can be observed that the dividing threshold of positive and negative microdroplets of the probe and primer of B646L gene is at the position with fluorescence intensity of 1114, and the temperature interval with the most excellent annealing effect is 50-53.9 ℃; when the temperature is lower than 53.9 ℃, the distinction degree of the positive microdroplet and the negative microdroplet is obviously reduced;

in conclusion, the optimal annealing temperature for the double-microdroplet digital PCR for detecting and identifying the wild strain and the gene deletion strain of the classical swine fever virus is selected to be 53.9 ℃ by comprehensively considering the amplification efficiency of the two genes and the differentiation between the positive microdroplet and the negative microdroplet.

3. Microdroplet digital PCR specificity experiment

Porcine Parvovirus (PPV), porcine circovirus type 2 (PCV2), Classical Swine Fever Virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRS), Japanese Encephalitis Virus (JEV) and Porcine Epidemic Diarrhea Virus (PEDV) are common porcine infectious diseases, and therefore, they were selected as detection objects of specific experiments.

The method shown in step 1 of example 2 is adopted, and the specificity detection is carried out by using several common pig disease pathogenic nucleic acids as PCR templates. Respectively taking DNA/cDNA of African Swine Fever Virus (ASFV), Porcine Parvovirus (PPV), porcine circovirus type 2 (PCV2), Classical Swine Fever Virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRS), Japanese Encephalitis Virus (JEV) and Porcine Epidemic Diarrhea Virus (PEDV) as templates to configure a PCR system, simultaneously taking sterile water as a template to configure the PCR system as negative control, setting the annealing temperature to be 53.9 ℃, after the micro-drop digital PCR amplification is finished, respectively using an HEX fluorescence channel to detect the amplification result aiming at the EP402R gene, and using an FAM fluorescence channel to detect the amplification result aiming at the B646L gene. The experimental results are shown in fig. 7 and 8.

FIG. 7 is a diagram showing the detection of a nonspecific pathogen nucleic acid by a specific primer and probe for EP402R gene, with the number of oil droplets on the abscissa and fluorescence intensity on the ordinate. It can be observed that in the assay against the EP402R gene: the PCR system using the nucleic acid of the African swine fever virus as a template is amplified normally, and the PCR system using the nucleic acid of other pathogens as a template is not subjected to specific amplification. The specificity of the primer and the probe designed aiming at the EP402R gene is good;

FIG. 8 is a diagram of the detection of a specific primer and probe for the B646L gene on a non-specific pathogen nucleic acid, the abscissa indicates the number of oil drops, and the ordinate indicates the fluorescence intensity, and it can be observed that in the detection for the B646L gene: the PCR system using the nucleic acid of the African swine fever virus as a template is amplified normally, and the PCR system using the nucleic acid of other pathogens as a template is not subjected to specific amplification. The specificity of the primer and the probe designed aiming at the B646L gene is proved to be good.

In order to verify that in the duplex PCR designed by the invention, the probe and the primer combination can only uniquely amplify the corresponding target gene, different combinations of the primer and the probe are designed, wherein the four combinations comprise the probe of B646L and the primer of B646L, the probe of B646L and the primer of EP402R, the probe of EP402R and the primer of B646L, and the probe of EP402R and the amplification primer of EP402R, and the single microdroplet digital PCR detection is respectively carried out on the gene of EP402R and the gene of B646L. The specific operation steps are as follows:

the procedure as shown in step 1 of example 2 was used to give a concentration of 1.5X 10⁷copies/. mu.L or 1.2X 10⁷The copies/mu L pMD18T-EP402R or pMD18T-B646L recombinant plasmid is used as a template, four different PCR reaction systems are respectively configured according to the combination of the four probes and the primers, and the annealing temperature is set to be 53.9 ℃ for carrying out the micro-drop digital PCR reaction. After the amplification was completed, the amplification results for the EP402R gene were detected using the HEX fluorescence channel and the amplification results for the EP402R or B646L gene were detected using the FAM fluorescence channel, respectively.

The amplification result of the 4 primer probe combinations on the EP402R gene is shown in the attached figure 9, and the amplification result on the B464L gene is shown in the attached figure 10:

FIG. 9 shows the results of amplification reactions of EP402R gene in four reaction systems using different combinations of probes and primers of the present invention, from left to right, the combinations of probes and primers in the four systems are: the result of B646L gene probe and B646L gene amplification primer, B646L gene probe and EP402R gene amplification primer, EP402R gene probe and B646L gene amplification primer, and EP402R gene probe and EP402R gene amplification primer shows that only the micro-drop digital PCR reaction used by matching the EP402R gene probe and the EP402R gene amplification primer can carry out specific amplification and detection on pMD18T-EP402R recombinant plasmid. This indicates that the presence of the B646L primer and probe in the dual PCR system does not affect the PCR reaction of EP 402R.

FIG. 10 shows the results of amplification reaction of B646L gene in four reaction systems using different combinations of probes and primers of the present invention, from left to right, the combinations of probes and primers are as follows: the results of the EP402R gene probe, the EP402R gene amplification primer, the EP402R gene probe, the B646L gene amplification primer, the B646L gene probe, the EP402R gene amplification primer, the B646L gene probe and the B646L gene amplification primer show that the specific amplification and detection reaction can be carried out on the pMD18T-B646L recombinant plasmid only through the droplet type digital PCR reaction which is matched with the B646L gene probe and the B646L gene amplification primer. This indicates that the presence of the primers and probes of EP402R in the duplex PCR system does not affect the PCR reaction of B464L.

In conclusion, the primers and probes of the double PCR designed by the invention aiming at the genes EP402R and B464L are reasonable.

4. Micro-drop digital PCR sensitivity experiment

Carrying out microdroplet digital PCR by taking the positive standard substance as a template, and detecting the sensitivity of the method. The positive standard substance is 1.5 multiplied by 10⁵copies/. mu.L of pMD18T-EP402R plasmid and 1.2X 10⁵copies/. mu.L of pMD18T-B646L plasmid. The 2 plasmids were diluted 7 times with a 10-fold gradient to obtain 7 concentrations of 2 plasmids, and a PCR system was prepared using these solutions in sequence to perform microdroplet digital PCR detection (step 1 of working example 2).

The copy number calculation method comprises the following steps: copies/. mu.L ═ 6.23X 1023 × (ng/. mu.L X10-9)/DNA length X660.

The test results are shown in the attached figures 11, 12, 13 and 14:

FIG. 11 is a droplet distribution plot of digital PCR sensitivity droplet detection using pMD18T-EP402R as a template, with oil droplet number on the abscissa and fluorescence intensity on the ordinate; FIG. 12 is a graph of copy number concentrations for microdroplet digital PCR sensitivity tests using pMD18T-EP402R as templates. With reference to FIGS. 11 and 12, it can be observed that the pMD18T-EP402R recombinant plasmid with copy number concentration of 0.43 copies/. mu.L can be detected in the reaction system with the lowest energy.

FIG. 13 is a diagram of a droplet distribution diagram for digital PCR detection using pMD18T-B646L as a template, with oil droplets on the abscissa and fluorescence intensity on the ordinate; FIG. 14 is a graph of copy number concentrations for microdroplet digital PCR sensitivity tests using pMD18T-B646L as a template. With reference to FIG. 13 and FIG. 14, it can be observed that the pMD18T-B646L recombinant plasmid with copy number concentration of 2.6 copies/. mu.L can be detected with the lowest energy in the reaction system.

In conclusion, in the detection of the pMD18T-EP402R and pMD18T-B646L gradient dilution samples, the lowest detection limit is 0.43 copies/mu L and 2.6 copies/mu L respectively, which is far lower than the lowest detection limit of the prior art.

5. Standard curve

In the sensitivity experiment of the step 4, the actual detection copy number can be obtained by detecting the pMD18T-EP402R plasmid solution with gradient concentration by the micro-drop digital PCR. The actual detected copy number was compared to the theoretical diluted copy number and the results are shown in table 1.

TABLE 1 comparison of the detected and theoretical copy numbers of the pMD18T-EP402R plasmid solution

Theoretical number of copies	120000	12000	1200	120
					Detecting copy number	105400	9940	1494	88

The data in Table 1 were used to plot a standard curve for the detection of the EP402R gene, as shown in FIG. 15, with the regression equation: r²The correlation was good at 0.9999.

In the sensitivity experiment of the step 4, the actual detection copy number can be obtained by using the pMD18T-B646L plasmid solution with the droplet type digital PCR detection gradient concentration. The actual detected copy number was compared to the theoretical diluted copy number and the results are shown in table 2.

TABLE 2 comparison of the detected and theoretical copy numbers of the pMD18T-EP402R plasmid solution

Theoretical number of copies	150000	15000	1500	150
					Detecting copy number	150400	20520	1720	160

The data in Table 2 were used to plot the standard curve for the nucleic acid detection of the B646L gene, as shown in FIG. 16, R of the regression equation²The correlation was good when 0.9981.

In conclusion, the micro-drop digital PCR detection system has good sensitivity, high detection precision and good stability.

6. Criteria for determination of results

The micro-drop digital PCR identification and detection system of the African swine fever virus wild strain and the gene deletion strain nucleic acid is used for identifying and detecting clinical samples. In the detection of the sample: if both the HEX fluorescence channel and the FAM fluorescence channel can detect the existence of fluorescence, the detection sample contains African swine fever wild strain virus; if only the FAM fluorescence channel can detect the existence of fluorescence, but the HEX fluorescence channel does not detect the existence of fluorescence, the sample only contains the African swine fever gene deletion strain virus; and if neither the HEX fluorescence channel nor the FAM fluorescence channel detects the existence of fluorescence, the sample does not contain the African swine fever virus.

Example 3 detection experiments on African swine fever virus clinical samples using digital PCR in microdroplet format.

DNA extraction is carried out on 20 porcine serum and tissue samples to be detected from different domestic pig farms by adopting a micro virus DNA/RNA extraction kit of AXYGEN company. The extracted DNA samples were then assayed as described in step 1 of example 2 above. Results table 3 shows that 20 samples were positive for african swine fever virus, and the copy number of HEX fluorescence channel detection and the copy number of FAM fluorescence channel detection in the negative control well using sterile water as the amplification template were 0.

TABLE 3 clinical test sample results of African swine fever virus

As shown in Table 3, the copy numbers detected by the two channels are substantially identical. The detection result shows that all clinical samples detected are positive to African swine fever virus. The absence of HEX channel positive microdroplets in the test indicates that there is no African swine fever virus gene deletion strain in the sample.

In conclusion, the invention provides the African swine fever virus droplet type digital PCR dual-channel detection kit and the detection method, which can accurately detect various different types of strains and identify whether the strains are gene deletion strains. The detection kit and the detection method have good detection efficiency and specificity, have more excellent sensitivity and precision, are beneficial to finding the virus as early as possible in clinical production and taking prevention and control measures in time, provide new technology and thought for subsequent purification of African swine fever, and lay a solid foundation for detecting and identifying other viruses by using a dual-channel micro-drop digital PCR detection method in the future.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> two-channel digital PCR detection kit and method for African swine fever virus

<130> MP21036693

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgttgaaga aatagaaagt c 21

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gactgtaagg cttaggaa 18

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgacaccact tccatacatg aacca 25

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atagagatac agctcttcca g 21

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtatgtaaga gctgcagaac 20

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tatcgataag attgat 16

Claims (10)

1. Detection primers and probes for African swine fever virus EP402R gene are characterized by comprising:

the upstream primer of the EP402R gene has a nucleic acid sequence shown as SEQ ID NO. 1;

the downstream primer of the EP402R gene has a nucleic acid sequence shown as SEQ ID NO. 2;

the nucleic acid sequence of the EP402R gene probe is shown in SEQ ID NO. 3.

2. The EP402R gene probe as claimed in claim 1, wherein a fluorescent reporter group HEX is labeled at the 5 'end and a fluorescent quencher group BHQ1 is labeled at the 3' end.

3. Detection primers and probes for African swine fever virus B646L gene are characterized by comprising:

the upstream primer of the B646L gene has a nucleic acid sequence shown as SEQ ID NO. 4;

the downstream primer of the B646L gene has a nucleic acid sequence shown as SEQ ID NO. 5;

the nucleic acid sequence of the B646L gene probe is shown in SEQ ID NO. 6.

4. The B646L gene probe of claim 3, wherein the 5 'end is labeled with a fluorescence reporter group FAM and the 3' end is labeled with a fluorescence quencher group MGB.

5. A digital PCR detection kit for wild African swine fever virus and EP402R deletion, which is characterized by comprising the primers and probes of claims 1-4.

6. The kit of claim 5, further comprising:

a plasmid containing the gene sequence of African swine fever virus EP402R,

A plasmid containing the African swine fever virus B646L gene sequence.

7. A method for non-diagnostic digital PCR detection of wild type African swine fever virus and deletion type EP402R, comprising the step of detecting a sample using the primers and probes according to claims 1 to 4.

8. The method of claim 7, wherein the sample is derived from contaminants in swine, including feed, water, soil in piggery.

9. The detection method according to claim 7, wherein the amplification temperature is 50 ℃ to 53.9 ℃ and the fluorescence channels are HEX and FAM.

10. The detection method according to claim 7, wherein the detection result judgment criteria are:

the FAM channel has no fluorescent signal, and the African swine fever virus is negative;

if fluorescence signals exist in both FAM channel and HEX channel, the African swine fever virus is positive;

the FAM channel has a fluorescent signal, but the HEX channel does not have a fluorescent signal, so that the African swine fever virus EP402R deletion strain is positive.

Images