CN108504778A - Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application - Google Patents
Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application Download PDFInfo
- Publication number
- CN108504778A CN108504778A CN201810357649.7A CN201810357649A CN108504778A CN 108504778 A CN108504778 A CN 108504778A CN 201810357649 A CN201810357649 A CN 201810357649A CN 108504778 A CN108504778 A CN 108504778A
- Authority
- CN
- China
- Prior art keywords
- primer
- porcine
- type
- pseudorabies virus
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Porcine circovirus 2 type and the real-time fluorescence RPA primer and probes of porcine pseudorabies virus including the kit and application thereof of the primer and probe can be quickly detected simultaneously the invention discloses a kind of.The invention discloses a kind of method the methods that can quickly detect porcine circovirus 2 type and porcine pseudorabies virus simultaneously to use the real-time fluorescence RPA primer and probes and kit.The sensibility of the method for the present invention is 102Copy/reaction, i.e., each reaction lowest detection can go out 10 simultaneously2The porcine circovirus 2 type of copy and 102The porcine pseudorabies virus of copy.Detection porcine circovirus 2 type and porcine pseudorabies virus while the method for the present invention can be quick, efficient, sensitive, the quick detection for the mixed infection of the two provide effective technological means.
Description
Technical field
The invention belongs to biotechnology, especially biomedical Preventive Veterinary Medicines to examine field.The present invention relates to
Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and its application, more particularly to it is a kind of to be based on RPA skills
The real-time fluorescence RPA kits for quickly detecting porcine circovirus 2 type and porcine pseudorabies virus simultaneously of art, further relate to the examination
Purposes of the agent box in quickly detection porcine circovirus 2 type and porcine pseudorabies virus mixed infection.
Background technology
Porcine circovirus 2 type and porcine pseudorabies virus are two kinds of important pathogens for influencing China and global pig breeding industry.Pig
Circovurus type 2 have it is stronger pathogenic, infect 5~12 week old piglets, cause pmws
(PMWS), pigskin inflammation and nephrotic syndrome, PCV2 pneumonias, breeding difficulty and enteritis etc., the death rate is higher.Pseudorabies
Virus can cause sow gestation incipient abortion, latter half of gestation that stillborn foetus, weak tire, the mummification of fetus occurs, and suckling pig is most sensitive, at
Year pig is mostly subclinical infection, but long-term band poison.The frequent mixed infection of the two, mutually enhances virulence, causes infection Swinery immunity
Inhibit, keep the prevention and control on infection pig farm and prevention more complicated with it is difficult, to seriously affect the production efficiency on pig farm.Therefore,
It is very necessary to establish rapid detection method that is a kind of while detecting both cause of diseases.
Invention content
Technical problem to be solved by the invention is to provide it is a kind of can quickly, it is simple, special and can identify that pig is justified simultaneously
The detection method and kit of 2 type of circovirus virus and porcine pseudorabies virus.To achieve the goals above, the present inventor is directed to pig respectively
Circovurus type 2 and porcine pseudorabies virus design primer and probe, design a plurality of primer and probe altogether, by cross reaction,
Best primer and probe combination application is filtered out in the present invention.
Therefore, the present invention provides in first aspect and a kind of be used for while detecting porcine circovirus 2 type and porcine pseudorabies
The primer and probe of poison, the primer and probe include：
Sequence the first primer as shown in SEQ ID NO.1,
Sequence second primer as shown in SEQ ID NO.2,
Sequence first probe as shown in SEQ ID NO.3,
Wherein, the first primer and second primer form primer pair；
Sequence third primer as shown in SEQ ID NO.4,
Sequence the 4th primer as shown in SEQ ID NO.5,
Sequence second probe as shown in SEQ ID NO.6,
Wherein, the third primer and the 4th primer form primer pair.
In one embodiment, the modification of first probe is as follows：(1) the 31st bit base modifies BHQ1-dT；(2)
35th bit base modifies 6-FAM-dT；(3) the 33rd bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'；Described
Two probe modifications are as follows：(1) the 27th bit base modifies BHQ1-dT；(2) the 30th bit bases modify 6-HEX-dT；(3) the 28th alkali
Base replaces with dSpacer；(4) the terminal modified C3Spacer of 3'.
The present invention provides a kind of reality being used for while detecting porcine circovirus 2 type and porcine pseudorabies virus in second aspect
When fluorescence RPA detection kits, the kit include four primers and two probes,
Wherein, the sequence of four primers and two probes is as follows：
Sequence the first primer as shown in SEQ ID NO.1,
Sequence second primer as shown in SEQ ID NO.2,
Sequence first probe as shown in SEQ ID NO.3,
Wherein, the first primer and second primer form primer pair；
Sequence third primer as shown in SEQ ID NO.4,
Sequence the 4th primer as shown in SEQ ID NO.5,
Sequence second probe as shown in SEQ ID NO.6,
Wherein, the third primer and the 4th primer form primer pair.
In one embodiment, the modification of first probe is as follows：(1) the 31st bit base modifies BHQ1-dT；(2)
35th bit base modifies 6-FAM-dT；(3) the 33rd bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'；Described
Two probe modifications are as follows：(1) the 27th bit base modifies BHQ1-dT；(2) the 30th bit bases modify 6-HEX-dT；(3) the 28th alkali
Base replaces with dSpacer；(4) the terminal modified C3Spacer of 3'.
In one embodiment, further include hydrolysis buffering in real-time fluorescence RPA detection kits of the present invention
Liquid, magnesium acetate and ddH2O。
In one embodiment, kit further includes isothermal duplication instrument.
The present invention also provides in the third aspect and a kind of can while quickly detect porcine circovirus 2 type and porcine pseudorabies virus
Method, the method includes：
(1) DNA sample of sample to be detected is extracted；
(2) using the DNA sample as template, using first aspect present invention primer and probe or use the present invention the
The kit of two aspects carries out dual real-time fluorescence RPA detections：
The fluorescence signal of FAM and HEX are detected in reaction process in real time；
Amplification is analyzed, 3- is added with the average value of the fluorescence signal intensity in amplification starting 2.5-3.5min
4 times of standard variance (SD) is used as detection threshold value, as a result judges as follows：
(1) if in the 15min of RPA amplifications, FAM fluorescence signal values are more than threshold value and inflection point occur, and HEX fluorescence signals
It is less than threshold value or does not occur inflection point, then show that amplification is that porcine circovirus 2 type is positive, porcine pseudorabies virus is negative；
(2) if in the 15min of RPA amplifications, HEX fluorescence signal values are more than threshold value and inflection point occur, and FAM fluorescence signals
Value is less than threshold value or does not occur inflection point, then shows that amplification is that porcine pseudorabies virus is positive, porcine circovirus 2 type is negative；
(3) if in the 15min of RPA amplifications, FAM and HEX fluorescence signals value is more than threshold value and inflection point occurs, then shows
Amplification is that porcine circovirus 2 type and porcine pseudorabies virus are double positive；
(4) if in the 15min of RPA amplifications, FAM and HEX fluorescence signals value is less than threshold value or does not occur inflection point, then
Show that amplification is that porcine circovirus 2 type and porcine pseudorabies virus are double-negative.
In one embodiment, DNA is extracted to the sample to be tested using Thermo viral nucleic acids extraction agent box.
In one embodiment, divided using the isothermal duplication instrument T16-ISO software Desktop amplifications carried
Analysis.
The present invention additionally provides the primer and probe in fourth aspect or the real-time fluorescence RPA detection kits exist
It prepares while detecting the purposes in porcine circovirus 2 type and the reagent of porcine pseudorabies virus.
Compared to the prior art, the present invention has the following advantages：
(1) porcine circovirus 2 type and porcine pseudorabies virus are quickly detected simultaneously using the method for the present invention, can save big
Measure detection time：The present invention only needs 20min in the entire reaction time, is far less than real-time fluorescence PCR and regular-PCR, and detection is single
Kind virus at least needs reaction 1.5 hours, and two kinds of viruses, which then need 3, more than hour could complete；
(2) large-scale instrument and equipment is not needed using the method for the present invention：The present invention only needs 40 DEG C of constant temperature that examination can be completed
Test, do not need cumbersome denaturation renaturation cycle, thus should not be expensive fluorescent PCR instrument, it is only necessary to small-sized thermostatic equipment.
The isothermal duplication instrument T16-ISO that the present invention uses is small, be can be carried around, and China's laboratories and pig farm are suitable for
The rapid screening of porcine circovirus 2 type and porcine pseudorabies virus；
(3) method sensibility of the invention is high：The present invention can detect two kinds of circovurus type 2 and porcine pseudorabies virus simultaneously
Virus, each reaction lowest detection can go out 10 simultaneously2The porcine circovirus 2 type of copy and 102The porcine pseudorabies virus of copy,
Susceptibility is suitable with real-time fluorescence PCR, is 100 times of regular-PCR method；
(4) kit of the invention is easy to carry, easy to operate：Enzyme and some other requirement needed for reaction is equal
It is lyophilized preservation, can for a long time be stored under normal temperature condition；It is easy to operate, when amplified reaction only need to be added corresponding buffer solution,
Primer and probe, template and magnesium ion etc. can react；
(5) primer and probe high specificity of the invention：Probe is used in the kit of the present invention, with regular-PCR side
Method is compared with LAMP method, increases the specificity of detection method；
(6) method testing result of the invention is true and reliable：Degree of conformity with existing real-time fluorescence PCR standard method is
100%.
Description of the drawings
By the following drawings, the present invention will be described：
Fig. 1 dual real-time fluorescence RPA testing results：Porcine circovirus 2 type and the double positive DNA of porcine pseudorabies virus are made
For template, reaction system according to the invention, 40 DEG C of reaction temperature carries out reaction 20min on isothermal duplication instrument T16.This figure
It can be seen that the present invention can detect porcine circovirus 2 type and porcine pseudorabies virus simultaneously.
Fig. 2 dual real-time fluorescence RPA sensitivity tests results：(A) it is that the pMD-PCV-1 standard items plasmids that will be synthesized carry out
Doubling dilution, dilution range 106-101Copy/reaction, the real-time fluorescence RPA methods then established with the present invention carry out sensitivity
Property experiment.The each reaction of the present invention as seen from the figure can detect 106-102A porcine circovirus 2 type.Wherein NC represents negative right
According to.(B) it is that the pMD-PRV-2 standard items plasmids that will be synthesized carry out doubling dilution, dilution range 106-101Copy/reaction, with
The real-time fluorescence RPA methods established afterwards with the present invention carry out sensitivity tests.The each reaction of the present invention as seen from the figure can be examined
Survey 106-102A porcine pseudorabies virus.
Fig. 3 dual real-time fluorescence RPA specific test results：The viral RNAs such as FMDV, PRRSV, CSFV by extraction, instead
Transcription synthesis cDNA, saves backup.With the dual real-time fluorescence RPA detection methods of foundation to the cDNA of FMDV, PRRSV, CSFV
And the DNA sample of PCV1, PPV, PCV2 and PRV are detected, and examine the specificity of dual real-time fluorescence RPA detection methods.
As a result as shown, showing that amplification curve can occur in PCV2 and PRV, other viruses do not occur amplification curve, illustrate to detect
With good specificity.
Specific implementation mode
Recombinase polymeric enzymatic amplification (RPA) technology according to the present invention is a kind of nucleic acid constant-temperature amplification technology, Neng Gou
The detection of nucleic acids of (37 DEG C -42 DEG C) under room temperature is carried out in 15 to 20 minutes.Its basic principle is that recombinase is combined to be formed with primer
Protein-DNA mixtures are combined with the homologous sequence on nucleic acid-templated, while under single-stranded DNA binding protein (SSB) assistance,
Archaeal dna polymerase guiding generates unwinding and DNA synthesis, ultimately forms new DNA double chain, to realize amplification.With real-time fluorescence PCR
It compares, RPA technologies do not need cumbersome thermal cycle, and without denaturation, nucleic acid amplification can be completed in 10~15min under constant temperature,
Detection speed is very fast, high sensitivity, does not need complicated sample process, can really realize portable Rapid nucleic acid inspection
It surveys.
The present invention provides it is a kind of be used for and meanwhile detect porcine circovirus 2 type and the real-time fluorescence RPA of porcine pseudorabies virus
Detection kit, includes four primers and two probes,
Wherein, the sequence of four primers and two probes is as follows：
PCV-F:CTACTGTTCC AGTTGCTTGT AGTCGTAGCC (SEQ ID NO.1),
PCV-R:CATACTCCAG CCCTCTTCCT ACCATGCCCG C (SEQ ID NO.2),
PCV-P:TGATTGCCTT TGTCGTCTGG TTGGACTTAA TCAATGTTGG AACCGAGGAC(SEQ ID
NO.3),
Wherein, the PCV-P probe modifications are as follows：(1) the 31st bit base modifies BHQ1-dT；(2) the 35th bit bases are modified
6-FAM-dT；(3) the 33rd bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'；
PRV-F：CTCTCTAAGG AGAATCTCGC CCCGTCCAAG (SEQ ID NO.4),
PRV-R：TCCGCTAAGC GGTCCTTGAT GGCCATGTAC G (SEQ ID NO.5),
PRV-P：CAAGAGCCAC ATCTCATACA AGAATGTCAT CGTCGTGACC GCATGGT(SEQ ID
NO.6),
Wherein, the PCV-P probe modifications are as follows：(1) the 27th bit base modifies BHQ1-dT；(2) the 30th bit bases are modified
6-HEX-dT；(3) the 28th bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'.
Further include lysis buffer in real-time fluorescence RPA detection kits of the present invention, magnesium acetate and
ddH2O。
Porcine circovirus 2 type detects simultaneously using real-time fluorescence RPA detection kits of the present invention in institute and pig puppet is mad
Dog disease poison, reaction system are as follows：The lysis buffer of 29.5 μ L, sequentially add 1.05 μ L 10uM primers PCV-F, PCV-R,
PRV-F and PRV-R, sequentially adds 10uM the probes PCV-P and PRV-P of 0.3L, the viral DNA template of 2 μ L, 11.2 μ L's
ddH2The 280mM magnesium acetates of O and 2.5 μ L.
Preferably, amplified reaction carries out in isothermal duplication instrument T16-ISO, and amplification temperature is set as 40 DEG C, reacts 5min,
Subsequent rapid centrifugation mixing, the reaction was continued 15min, and the fluorescence in the channels monitoring FAM and HEX in real time, after pass through T16-ISO
Desktop analysis results.
All primer and probes used in the embodiment of the present invention are all synthesized by biological (Shanghai) company of raw work.
1, strain：
Porcine circovirus 2 type (PCV 2), porcine pseudorabies virus (PRV), 1 type of pig circular ring virus (PCV1), pig parvoviral
(PPV), the inactivation antigens such as foot and mouth disease virus (FMDV), porcine reproductive and respiratory syndrome virus (PRRSV), swine fever virus (CSFV)
It is provided by Animal ＆. Plant Inspection and Quarantine Techn Center, Shenzhen Bureau of Impor and is preserved.
2, RPA primers and probe design synthesis and screening：
It guides with reference to the screening guide design of TwistDx companies RPA design of primers, respectively to be announced in NCBI GenBank
Pig genome sequence and the relevant virus gene sequence of pig, the pig correlated virus especially porcine circovirus 2 type (PCV
2), porcine pseudorabies virus (PRV), 1 type of pig circular ring virus (PCV1), pig parvoviral (PPV), foot and mouth disease virus (FMDV), pig
Reproductive and respiratory syndrome virus (PRRSV), swine fever virus (CSFV), design a plurality of specific primer and probe, wherein
The fluorophor of PCV2 probes is to screen two sets of best primer and probes for detecting PCV2 and PRV respectively respectively by cross matching
Combination.Two sets of primers amplify the segment of SEQ ID NO.7 and SEQ ID NO.8 respectively.
SEQ ID NO.7:
ATGACGTATCCACGAAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGCCATCTTGGCCAGATCCTCCGCCGCCG
CCCCTGGCTCGTCCACCCCCGCCACCGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAACACCCGCCTCTCCCGCA
CCTTCGGATATACTGTCAAGCGAACCACAGTCAAAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAAT
GACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATTAGAAAGGTTAAGGT
TGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTGGGCTCCAGTGCTGTTATTCTAGATGATAACT
TTGTAACAAAGGCCACAGCCCTCACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACCATACTCCAGCCCTCT
TCCTACCATGCCCGCTACTTTACCCCCAAACCTGTCCTCGGTTCCAACATTGATTAAGTCCAACCAGACGACAAAGG
CAATCAGCTGTGGCTACGACTACAAGCAACTGGAACAGTAGACCACGTAGGCCTCGGCACTGCGTTCGAAAACAGTA
TATACGACCAGGAATACAATATCCGTGTAACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCACTT
CACCCTTAA。
SEQ ID NO.8:
GTGCTCTCTAAGGAGAATCTCGCCCCGTCCAAGTTCAAGAGCCACATCTCATACAAGAATGTCATCGTCGTGACCGC
ATGGTCCGGGAGCATCCGCTAAGCGGTCCTTGATGGCCATGTACGCCGCGTGCCCGTCCCCGTGCAGGAGATCACGG
ACGTTATCGACCGCCGCGGCAAGTGCGTCTCCAAGGCCGAGTACGTGCGCAACAACCACAAGGTGACCGCCTTCG。
The best primer of 1 dual real-time fluorescence RPA methods of table and probe nucleotide sequence
Wherein PCV-P probe modifications are as follows：(1) the 31st bit base modifies BHQ1-dT, and (2) the 35th bit bases modify 6-
FAM-dT；(3) the 33rd bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'；
PRV-P probe modifications are as follows：(1) the 27th bit base modifies BHQ1-dT, and (2) the 30th bit bases modify 6-HEX-dT；
(3) the 28th bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'.
DSpacer, that is, tetrahydrofuran, as endonuclease recognition site.Arm (C3spacer) is blocking groups between C3,
For preventing amplification of the probe from after connecting.Arm is mainly used for imitating three carbon intervals between 3' the and 5' hydroxyls of ribose between C3, or " replaces
Unknown base in sequence of generation ".Arm prevents the ends 3' excision enzyme and the ends 3' poly- for arm between one 3' of introduction between 3'-C3
Synthase plays a role, and by sequent synthesis, company provides.BHQ1-dT (tertiary butyl pair the third diphenol 1- deoxythymidine) is that a kind of fluorescence is quenched
Go out group.6-FAM-dT (6- Fluoresceincarboxylic acids-deoxythymidine) is fluorescent reporter group, fluoresced green；6-HEX-dT (six
Chloro- 6- methylfluoresceins-deoxythymidine) it is fluorescent reporter group, hair powder color fluorescence.
3, viral genome is extracted：
Using Thermo viral nucleic acids extraction agent box (MagMAXTM-96Viral RNA Isolation Kit,
AM1836 porcine circovirus 2 type (PCV 2), porcine pseudorabies virus (PRV), pig) are extracted respectively in magnetic bead extraction purification system
1 type of circovirus (PCV1), pig parvoviral (PPV), foot and mouth disease virus (FMDV), porcine reproductive and respiratory syndrome virus
(PRRSV), the viral nucleic acids such as swine fever virus (CSFV).And the various of extraction are measured by ultramicron nucleic acid-protein concentration analyzer
The concentration of viral nucleic acid.
4, Plasmid DNA standard items：
Raw work biology (Shanghai) company synthetic gene segment SEQ ID NO.7 (702bp) and genetic fragment SEQ ID NO.8
(229bp), and it is cloned into pMD carriers respectively, it is respectively designated as pMD-PCV-1 and pMD-PRV-2.It is carried with the small extraction reagent kit of plasmid
Take pMD-PCV-1 and pMD-PRV-2 plasmids.The plasmid concentration of extraction is measured with ultramicron nucleic acid-protein concentration analyzer, is calculated
Go out plasmid copy number.It is respectively 10 that plasmid, which is diluted to copy Particle density,6copy/μL、105copy/μL、104copy/μL、
103copy/μL、102copy/μL、101Copy/ μ L, as standard plasmid.
The foundation of 1 porcine circovirus 2 type of embodiment and the dual RPA detection methods of porcine pseudorabies virus.
It is mixed into template with the double positive viral DNAs of the porcine circovirus 2 type and porcine pseudorabies virus that extract in above-mentioned 3,
Carry out dual real-time fluorescence RPA detections.It is as follows：
Dual real-time fluorescence RPA reaction systems are 50 μ L, by 29.5 μ L of Rehydration Buffer, four primers
(PCV-F, PCV-R, PRV-F and PRV-R) (10uM) each 1.05 μ L, two each 0.3 μ L of probe (PCV-P and PRV-P) (10uM),
DEPC water 11.2 μ L, nucleic acid-templated 2 μ L are added to after mixing in RPA freeze-drying enzyme powder reaction tubes, and mixing centrifugation is eventually adding
MgAc solution (2.5 μ L), mixes well.Reaction condition：Isothermal duplication instrument T16-ISO, 40 DEG C are reacted 5 minutes, and mixing is taken out, then
The reaction was continued 15 minutes, detects FAM (Fluoresceincarboxylic acid) and the fluorescence letter in HEX (methylfluorescein) channel in reaction process in real time
Number.
Software Desktop included isothermal duplication instrument T16-ISO analyzes amplification, in amplification starting 3min
Fluorescence signal intensity average value plus 3.5 times standard variance (SD) be used as detection threshold value, as a result judge it is as follows：
(1) if in the 15min of RPA amplifications, FAM channel fluorescence signal values are more than threshold value and inflection point occur, and the channels HEX
Fluorescence signal is less than threshold value or does not occur inflection point, then shows that amplification is that porcine circovirus 2 type is positive, porcine pseudorabies virus
It is negative；
(2) if in the 15min of RPA amplifications, HEX channel fluorescence signal values are more than threshold value and inflection point occur, and the channels FAM
Fluorescence signal value is less than threshold value or does not occur inflection point, then shows that amplification is that porcine pseudorabies virus is positive, 2 porcine circovirus
Type is negative；
(3) if in the 15min of RPA amplifications, the channels FAM and HEX channel fluorescences signal value are more than threshold value and turn
Point then shows that amplification is that porcine circovirus 2 type and porcine pseudorabies virus are double positive；
(4) if in the 15min of RPA amplifications, the channels FAM and HEX channel fluorescences signal value are less than threshold value or do not go out
Existing inflection point then shows that amplification is that porcine circovirus 2 type and porcine pseudorabies virus are double-negative.
2 dual real-time fluorescence RPA kits of embodiment and the sensitivity of real-time fluorescence PCR compare.
1, dual real-time fluorescence RPA kits detect porcine circovirus 2 type compared with the sensitivity of real-time fluorescence PCR.With
The standard plasmid pMD-PCV-1 for preparing doubling dilution before is that (template quantity is respectively 10 to template6Copy/ reactions, 105Copy/ is anti-
Answer, 104Copy/ reactions, 103Copy/ reactions, 102Copy/ reactions, 101Copy/ reacts), according to the dual real-time of embodiment 1
Fluorescence RPA methods carry out sensitivity experiment.Simultaneously using the standard plasmid of same doubling dilution as template, 2 porcine circovirus is sampled
Type real-time fluorescence PCR standard method (being disclosed in SN/T2708-2010 Porcine circovirus deseases quarantine specification) carries out sensitivity comparison.
Wherein PCV2 real time fluorescent PCR methods：Sense primer：5’–CGCTGGAGAAGGAAAAATGG-3’(SEQ ID NO.9)；Downstream
Primer：5 '-CTTGACAGTATATCCGAAGGT-3 ' (SEQ ID NO.10) probe：FAM-5’-
(FAM is 6- Fluoresceincarboxylic acids to TTCAACACCCGCCTCTCCCG-3 '-TAMRA (SEQ ID NO.11), as fluorescence report base
Group；TAMRA is fluorescent quenching group).Reaction system：Each 0.5 μ L, Real-time PCR Premix of upstream and downstream primer (10uM)
The aseptic deionized water of 10 μ L, mixing is added in 12.5 μ L, 0.5 μ L of probe, 1 μ L of DNA profiling.Reaction system is placed in fluorescent PCR
(ABI7500Fast) is reacted in instrument.Reaction condition：94 DEG C/30s of pre-degeneration；Expand 94 DEG C/30s, 60 DEG C/30s, 40
Cycle.Real-time fluorescence PCR basis for estimation is：Under the premise of negative control and positive control are set up, the CP of sample to be tested≤
35 can be judged to the positive.
Dual real-time fluorescence RPA sensitivity test results are as shown in Figure 2 A.The sensitivity comparison result of two kinds of detection methods
As shown in table 2.It can be seen that sensitivity and the real-time fluorescence of dual real-time fluorescence RPA kits detection porcine circovirus 2 type
PCR is suitable, is 102Copy/ reacts.
The comparison knot of 2 dual real-time fluorescence RPA of table and real-time fluorescence PCR to porcine circovirus 2 type nucleic acid detecting sensitivity
Fruit
2, dual real-time fluorescence RPA kits detect porcine pseudorabies virus compared with the sensitivity of real-time fluorescence PCR.With it
The preceding standard plasmid pMD-PRV-2 for preparing doubling dilution is that (template quantity is respectively 10 to template6Copy/ reactions, 105Copy/ reactions,
104Copy/ reactions, 103Copy/ reactions, 102Copy/ reactions, 101Copy/ reacts), according to the dual real-time fluorescence of embodiment 1
RPA methods carry out sensitivity experiment.Simultaneously using the standard plasmid of same doubling dilution as template, using porcine pseudorabies virus SYBR
(the reference of GreenI real time fluorescence quantifying PCR methods：The pigs such as Gao Jiacong source pseudorabies virus gB gene SYBR GreenI are real-time
Foundation [J] the China veterinary science of fluorescent quantitative PCR detection method, 2015,45 (11)：1166-1170) carry out sensitivity ratio
Compared with.Wherein PRVSYBR GreenI real time fluorescent PCR methods：
Sense primer：5’-GTCACCTTGTGGTTGTTG-3’(SEQ ID NO.12)；
Downstream primer：5 '-CCACATCTACTACAAGAACG-3 ' (SEQ ID NO.13),
Reaction system：Upstream and downstream primer (10uM) each 0.5 μ L, SYBR GreenI dyestuffs, 12.5 μ L, 1 μ L of DNA profiling add
Enter the aseptic deionized water of 10.5 μ L, mixing.Reaction system is placed in fluorescent PCR instrument (ABI7500Fast) to react.Instead
Answer condition：95 DEG C/30s of pre-degeneration；95 DEG C/10s is expanded, 60 DEG C/20s, 40 recycle.
Dual real-time fluorescence RPA sensitivity test results are as shown in Figure 2 B.The sensitivity comparison result of two kinds of detection methods
As shown in table 2.It can be seen that sensitivity and the real-time fluorescence PCR of dual real-time fluorescence RPA kits detection porcine pseudorabies virus
Quite, it is 102Copy/ reacts.
The comparison result of 3 dual real-time fluorescence RPA of table and real-time fluorescence PCR to porcine pseudorabies virus nucleic acid detecting sensitivity
The specific test of 3 dual real-time fluorescence RPA kits of embodiment.
The viral RNAs such as FMDV, PRRSV, CSFV by extraction, reverse transcription synthesize cDNA, save backup.With pair of the present invention
Weight real-time fluorescence RPA kits carry out the cDNA of FMDV, PRRSV, CSFV and the DNA sample of PCV1, PPV, PCV2 and PRV
The specificity of dual real-time fluorescence RPA kits is examined in detection.
The results are shown in Figure 3.Test result shows that the present invention can detect porcine circovirus 2 type and porcine pseudorabies simultaneously
Poison, other viral nucleic acids illustrate that the dual real-time fluorescence RPA kits of the present invention have specificity well without amplification curve.
The clinical application of the kit of 4 present invention of embodiment.
28 parts of the clinical sample that doubtful porcine circovirus 2 type and porcine pseudorabies virus are detected with the kit of the present invention (is compiled
Number it is 1~28) and negative control sample 2 parts (29,30), clinical sample is the oropharynx nose liquid of pig, lymphoid tissue etc., negative right
Product are the oropharynx nose liquid that health is uninfected by pig in the same old way.Use Thermo viral nucleic acid extraction agent boxes (MagMAXTM-96Viral
RNA Isolation Kit, AM1836) in magnetic bead extraction purification system DNA is extracted respectively.With the present invention it is dual in real time it is glimmering
Light RPA kits are detected the DNA sample, and result is compared with the testing result of real-time fluorescence PCR, the results are shown in Table
4.The result shows that：In 28 parts of clinical samples, porcine circovirus 2 type and porcine pseudorabies virus are double 9 parts positive, individual pig circular ring virus 2
Malicious 2 types are 13 parts positive, 4 parts of individual porcine pseudorabies virus, double-negative 1 part of two kinds of viruses；Negative control testing result is the moon
Property.It can be seen that the coincidence rate of dual real-time fluorescence RPA kits and real-time fluorescence PCR that the present invention establishes is 100%.
4 PCV2, PRV dual real-time fluorescence RPA of table and real-time fluorescence PCR clinical detection results contrast
The detection sensitivity and specificity of the real-time fluorescence RPA kits of the present invention are tested.Sensitivity test
The result shows that can detect porcine circovirus 2 type and porcine pseudorabies virus simultaneously using the kit, the sensitivity of the two is
102Copy/reaction, and detection range is wider, each reaction detectable 106-102The viral sample of copy.Specific test knot
Fruit shows that the kit has specificity well, can detect porcine circovirus 2 type and porcine pseudorabies virus simultaneously, other
Virus such as pig parvoviral, porcine circovirus 2 type, porcine reproductive and respiratory syndrome virus, swine fever virus and foot and mouth disease virus
It is not in amplification curve.The doubtful porcine circovirus 2 type that the real-time fluorescence RPA methods detection that the present inventor establishes is collected
With the clinical sample (28 parts) of porcine pseudorabies virus, and testing result and the detection of real-time fluorescence PCR standard method were added into phase
Compare, the results showed that testing result of the invention and real-time fluorescence PCR are completely the same, i.e., with 100% degree of conformity.
Sequence table
<110>Animal ＆. Plant Inspection and Quarantine Techn Center, Shenzhen Bureau of Impor
<120>Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application
<130> CF180123S
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 1
ctactgttcc agttgcttgt agtcgtagcc 30
<210> 2
<211> 31
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 2
catactccag ccctcttcct accatgcccg c 31
<210> 3
<211> 50
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 3
tgattgcctt tgtcgtctgg ttggacttaa tcaatgttgg aaccgaggac 50
<210> 4
<211> 30
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 4
ctctctaagg agaatctcgc cccgtccaag 30
<210> 5
<211> 31
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 5
tccgctaagc ggtccttgat ggccatgtac g 31
<210> 6
<211> 47
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 6
caagagccac atctcataca agaatgtcat cgtcgtgacc gcatggt 47
<210> 7
<211> 702
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 7
atgacgtatc cacgaaggcg ttaccggaga agaagacacc gcccccgcag ccatcttggc 60
cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120
aaaaatggca tcttcaacac ccgcctctcc cgcaccttcg gatatactgt caagcgaacc 180
acagtcaaaa cgccctcctg ggcggtggac atgatgagat tcaatattaa tgactttctt 240
cccccaggag ggggctcaaa cccccgctct gtgccctttg aatactacag aattagaaag 300
gttaaggttg aattctggcc ctgctccccg atcacccagg gtgacagggg agtgggctcc 360
agtgctgtta ttctagatga taactttgta acaaaggcca cagccctcac ctatgacccc 420
tatgtaaact actcctcccg ccataccata ctccagccct cttcctacca tgcccgctac 480
tttaccccca aacctgtcct cggttccaac attgattaag tccaaccaga cgacaaaggc 540
aatcagctgt ggctacgact acaagcaact ggaacagtag accacgtagg cctcggcact 600
gcgttcgaaa acagtatata cgaccaggaa tacaatatcc gtgtaaccat gtatgtacaa 660
ttcagagaat ttaatcttaa agacccccca cttcaccctt aa 702
<210> 8
<211> 229
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 8
gtgctctcta aggagaatct cgccccgtcc aagttcaaga gccacatctc atacaagaat 60
gtcatcgtcg tgaccgcatg gtccgggagc atccgctaag cggtccttga tggccatgta 120
cgccgcgtgc ccgtccccgt gcaggagatc acggacgtta tcgaccgccg cggcaagtgc 180
gtctccaagg ccgagtacgt gcgcaacaac cacaaggtga ccgccttcg 229
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 9
cgctggagaa ggaaaaatgg 20
<210> 10
<211> 21
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 10
cttgacagta tatccgaagg t 21
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 11
ttcaacaccc gcctctcccg 20
<210> 12
<211> 18
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 12
gtcaccttgt ggttgttg 18
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 13
ccacatctac tacaagaacg 20
Claims (9)
1. a kind of primer and probe being used for while detecting porcine circovirus 2 type and porcine pseudorabies virus, the primer and probe
Including：
Sequence the first primer as shown in SEQ ID NO.1,
Sequence second primer as shown in SEQ ID NO.2,
Sequence first probe as shown in SEQ ID NO.3,
Wherein, the first primer and second primer form primer pair；
Sequence third primer as shown in SEQ ID NO.4,
Sequence the 4th primer as shown in SEQ ID NO.5,
Sequence second probe as shown in SEQ ID NO.6,
Wherein, the third primer and the 4th primer form primer pair.
2. the modification of primer and probe according to claim 1, first probe is as follows：(1) the 31st bit base is modified
BHQ1-dT；(2) the 35th bit bases modify 6-FAM-dT；(3) the 33rd bit bases replace with dSpacer；(4) 3' is terminal modified
C3Spacer；Second probe modification is as follows：(1) the 27th bit base modifies BHQ1-dT；(2) the 30th bit bases modify 6-
HEX-dT；(3) the 28th bit bases replace with dSpacer；(4) the terminal modified C3Spacer of 3'.
3. a kind of real-time fluorescence RPA detection kits being used for while detecting porcine circovirus 2 type and porcine pseudorabies virus, described
Kit includes primer and probe as described in claim 1.
4. kit according to claim 3, the kit further includes lysis buffer, magnesium acetate and ddH2O。
5. kit according to claim 3 or 4, the kit further includes isothermal duplication instrument.
6. a kind of side that can quickly detect porcine circovirus 2 type and porcine pseudorabies virus simultaneously for non-disease diagnostic purpose
Method, the method includes
(1) DNA of sample to be tested is extracted；
(2) using the DNA as template, using primer and probe as claimed in claim 1 or 2 or using such as claim 3-
Kit described in 5 carries out dual real-time fluorescence RPA detections：
The fluorescence signal of FAM and HEX are detected in reaction process in real time；
Amplification is analyzed, 3-4 times is added with the average value of the fluorescence signal intensity in amplification starting 2.5-3.5min
Standard variance (SD) be used as detection threshold value, as a result judge it is as follows：
If (a) in the 15min of RPA amplifications, FAM fluorescence signal values are more than threshold value and inflection point occur, and HEX fluorescence signals do not surpass
It crosses threshold value or does not occur inflection point, then show that amplification is that porcine circovirus 2 type is positive, porcine pseudorabies virus is negative；
If (b) in the 15min of RPA amplifications, HEX fluorescence signal values are more than threshold value and inflection point occur, and FAM fluorescence signals value is not
There is not more than threshold value or inflection point, then shows that amplification is that porcine pseudorabies virus is positive, porcine circovirus 2 type is negative；
If (c) in the 15min of RPA amplifications, FAM and HEX fluorescence signals value is more than threshold value and inflection point occurs, then shows to expand
As a result it is that porcine circovirus 2 type and porcine pseudorabies virus are double positive；
If (d) in the 15min of RPA amplifications, FAM and HEX fluorescence signals value is less than threshold value or does not occur inflection point, then shows
Amplification is that porcine circovirus 2 type and porcine pseudorabies virus are double-negative.
7. method according to claim 6 extracts DNA using Thermo viral nucleic acids extraction agent box to the sample to be tested.
8. the method for according to claim 6 or 7, the software Desktop amplifications that are carried using isothermal duplication instrument T16-ISO into
Row analysis.
9. primer and probe according to claim 1 or claim 2 and according to kit described in claim 3-5 prepare and meanwhile examine
Survey the purposes in porcine circovirus 2 type and porcine pseudorabies virus reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810357649.7A CN108504778B (en) | 2018-04-20 | 2018-04-20 | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810357649.7A CN108504778B (en) | 2018-04-20 | 2018-04-20 | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108504778A true CN108504778A (en) | 2018-09-07 |
| CN108504778B CN108504778B (en) | 2019-06-11 |
Family
ID=63383102
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810357649.7A Active CN108504778B (en) | 2018-04-20 | 2018-04-20 | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108504778B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355428A (en) * | 2018-10-30 | 2019-02-19 | 宁波匠神生物科技有限公司 | Room temperature constant temperature quickly detects primer, probe, reagent and the kit of pseudorabies virus |
| CN111560465A (en) * | 2019-12-25 | 2020-08-21 | 龙岩学院 | qPCR (quantitative polymerase chain reaction) kit and method for pseudorabies wild virus and swine hepatitis E virus |
| CN112301152A (en) * | 2020-02-06 | 2021-02-02 | 广州普世利华科技有限公司 | Multiple fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus |
| CN113322350A (en) * | 2021-05-06 | 2021-08-31 | 深圳海关动植物检验检疫技术中心 | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application |
| CN113322349A (en) * | 2021-04-23 | 2021-08-31 | 华南农业大学 | Primer and kit for detecting porcine circovirus type 2 by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106957925A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate Pseudorabies virus, pig parvoviral and pig circular ring virus |
-
2018
- 2018-04-20 CN CN201810357649.7A patent/CN108504778B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106957925A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate Pseudorabies virus, pig parvoviral and pig circular ring virus |
Non-Patent Citations (1)
| Title |
|---|
| 刘立兵等: "伪狂犬病病毒野毒和疫苗毒双重RPA鉴别检测方法的建立和应用", 《中国预防兽医学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355428A (en) * | 2018-10-30 | 2019-02-19 | 宁波匠神生物科技有限公司 | Room temperature constant temperature quickly detects primer, probe, reagent and the kit of pseudorabies virus |
| CN111560465A (en) * | 2019-12-25 | 2020-08-21 | 龙岩学院 | qPCR (quantitative polymerase chain reaction) kit and method for pseudorabies wild virus and swine hepatitis E virus |
| CN112301152A (en) * | 2020-02-06 | 2021-02-02 | 广州普世利华科技有限公司 | Multiple fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus |
| CN112301152B (en) * | 2020-02-06 | 2024-03-22 | 广州普世利华科技有限公司 | Multiplex fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus |
| CN113322349A (en) * | 2021-04-23 | 2021-08-31 | 华南农业大学 | Primer and kit for detecting porcine circovirus type 2 by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology |
| CN113322350A (en) * | 2021-05-06 | 2021-08-31 | 深圳海关动植物检验检疫技术中心 | Kit for simultaneously detecting porcine circovirus type 2 and porcine circovirus type 3 viruses and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108504778B (en) | 2019-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110373500B (en) | Double-gene-based double-fluorescence PCR detection kit and application thereof | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN110551853A (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN105567871A (en) | RT-RPA (reverse transcription recombinase polymerase amplification) detection kit for fast detecting high-pathogenicity porcine reproductive and respiratory syndrome virus and application thereof | |
| CN112831598B (en) | Real-time fluorescent PCR amplification primer pair and probe primer for African swine fever virus identification and detection and prepared kit | |
| CN110229932B (en) | African swine fever virus nucleic acid extraction-free fluorescent isothermal amplification detection kit | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| CN108866243B (en) | Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit | |
| WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
| CN107653348A (en) | For detecting the primer and probe of the type of pig circular ring virus 3, PCR kit for fluorescence quantitative and method, application | |
| CN112094953A (en) | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN109593883B (en) | Porcine circovirus multiplex real-time fluorescent PCR detection primer pair, probe and prepared kit | |
| CN113684309A (en) | 7 primer probe and kit for detecting viruses related to porcine reproductive disorder diseases based on liquid chip technology and application of primer probe and kit | |
| CN104774953B (en) | Fluorescence PCR detection reagent of African swine fever virus CP530R genes and preparation method thereof and purposes | |
| CN112746134A (en) | Kit for rapidly detecting nucleic acid of African swine fever virus and application | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods | |
| CN111926110B (en) | African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 7-12 / F, Shenzhen entry exit inspection and Quarantine Bureau comprehensive laboratory building, 1011 Fuqiang Road, Futian District, Shenzhen, Guangdong 518000 Patentee after: Shenzhen Customs Animal and Plant Inspection and Quarantine Technology Center Address before: 518000 No. 1011 Fu Qiang Road, Shenzhen, Guangdong, Futian District Patentee before: THE ANIMAL AND PLANT INSPECTION AND QUARANTINE TECHNIQUE CENTER, SHENZHEN ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU |