CN114015809A

CN114015809A - ERA method, composition and kit for rapidly detecting GI group norovirus

Info

Publication number: CN114015809A
Application number: CN202111458101.XA
Authority: CN
Inventors: 袁飞; 杨艳歌; 吴占文; 李红娜; 李涛; 王迎春; 王帅
Original assignee: Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2022-02-08

Abstract

The invention relates to two rapid detection methods of an Enzymatic recombinant isothermal Amplification (ERA) basic type and a fluorescence type of GI group norovirus. The invention also relates to oligonucleotide primer and probe compositions for use in the methods. The invention also relates to an ERA detection kit comprising the composition. The composition of the present invention can be used for basic or fluorescent ERA detection, and can simply, rapidly, specifically and sensitively detect GI group norovirus components in samples such as food and feces.

Description

ERA method, composition and kit for rapidly detecting GI group norovirus

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a technology for rapidly detecting basic type and fluorescent ERA of GI group norovirus, an oligonucleotide primer probe composition used for the method, and a kit containing the composition.

Background

Norovirus, also known as Norwalk Viruses (NOV), is a non-enveloped single-stranded positive-stranded RNA virus of the genus Norovirus (NOV) in the Human Calicivirus family (Human Calicivirus, HuCV). The NOV is mainly carried by food and water, can cause viral gastroenteritis of various mammals mainly including emesis and diarrhea, and is one of common food-borne viruses at present. Infectious diarrhea caused by NOV is prevalent worldwide, infections occur all year round, and mainly occur in adults and school-age children, wherein 10 months per year to 3 months in the next year are high-incidence stages. In the united states, 60% to 90% of all outbreaks of nonbacterial diarrhea are caused by norovirus each year. Similar results are seen in developed countries such as the Netherlands, British, Japan, Australia, etc. In China, children with diarrhea under 5 years old, the incidence rate of norovirus infection is about 15%.

The genome of the norovirus has the full length of 7.65 kb and mainly has three Open Reading Frames (ORFs), namely ORF1, ORF2 and ORF3 which respectively encode nonstructural proteins, VP1 structural proteins and VP2 structural proteins related to virus replication. Norovirus can be divided into 5 distinct groups (gi to gv) based on the amino acid diversity of the complete VP1 gene and the nucleotide diversity of the region on ORF1 encoding RNA-dependent RNA polymerase (RdRp). Of these, only GI, GII and GIV can infect humans. The GI type gene group comprises 9 gene subtypes which are respectively named as GI.1-GI.9, and representative strains are Norwalk viruses including south campton virus. At present, the most common norovirus infection in China mainly comprises a group GI and a group GII, and each year of NOV outbreak causes great medical and economic burden to the country, but because of the self-characteristics of NOV, the NOV cannot be subjected to in vitro multiplication culture, so that no specific vaccine or medicament exists so far, and how to efficiently and rapidly detect the NOV becomes a problem which needs to be solved by modern researchers urgently.

The genetic material of organisms is mainly determined by nucleic acid, and along with the rapid development of molecular biology technology, various molecular biology technologies for tracing biological components by identifying nucleic acid have the advantages of strong specificity, high sensitivity, difficult interference by environmental conditions, stable result and the like, and are more and more widely applied to food-borne pathogenic microorganism detection. And for the evolution of microorganisms with very simple morphological structures, reliable results can only be obtained with methods of molecular biology. However, the current widely popular PCR nucleic acid Amplification technology cannot meet the requirement of rapid detection, because the detection time of these PCR technologies is usually over 2 h and a professional PCR nucleic acid Amplification instrument is required, which limits the popularization and application of the PCR nucleic acid Amplification technology, and therefore, a nucleic acid detection method with rapid, efficient and simple steps is required, and the Enzymatic recombinant isothermal Amplification technology (ERA) meets the requirement. The technical principle is as follows: under the environment of normal temperature, the recombinase is tightly combined with the primer to form a recombinase and primer polymer. When the recombinase and primer aggregate searches for a perfectly matched complementary sequence on the template DNA, the double-stranded structure of the template DNA is opened with the aid of the single-stranded DNA binding protein. Then, under the action of DNA polymerase, the primer is extended in the 5 '→ 3' direction to form a new complementary strand of DNA, and exponential growth of the amplified product is completed. Therefore, under the reaction condition of 37-40 ℃, the micro DNA and RNA specific fragments can be efficiently and rapidly amplified, and can be amplified by billions of times within a few minutes. The low-temperature adaptability, the sensitivity and the like of the high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity. The technology is an isothermal nucleic acid amplification technology with global autonomous intellectual property rights developed by China, and can get rid of foreign patent barriers. The technology is convenient, accurate and rapid, and becomes a hotspot of research in recent years.

Disclosure of Invention

The invention aims to detect GI norovirus components in samples such as food, excrement and the like quickly, efficiently, simply, intuitively, accurately and sensitively, has important significance for on-site quick screening and risk detection of GI norovirus, and can effectively prevent the morbidity of norovirus infection.

The inventor of the invention takes Norwalk virus (Norwalk virus) (GenBank: M87661.2), which is a reference gene of GI group norovirus in international standard ISO TS 15216-2-2013 and national standard GB 4789.42-2016, as a target sequence for designing a primer and a probe, and simultaneously searches for a common enterovirus whole genome sequence in an NCBI database, such as rotavirus, hepatitis A virus, adenovirus and the like. Common sequences are compared by utilizing Clustal X software, and specific ERA primers and probes capable of efficiently detecting GI group norovirus are designed and screened in interspecies difference regions according to the ERA primer design principle. Meanwhile, a field rapid detection technology for the basic type and fluorescent type ERA GI group norovirus is established.

In one aspect of the invention, there is provided an oligonucleotide primer upstream of grif for basal ERA detection of group gi norovirus: 5'-ATGTATGTCCCAGGATGGCAGGCCATGT-3' (SEQ ID No. 1), and the downstream GI: 5'-TCCGGTACCAACTGACCAGCGCCACTAG-3' (SEQ ID No. 2). The primer can specifically recognize the sequence of the GI group norovirus, the length of an amplification fragment is 168 bp, and the amplification conditions are as follows: amplification was carried out at 37 ℃ for 10 min.

In another aspect of the invention, there is provided a probe gip for fluorescent ERA detection of group gii norovirus: 5'-GACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGT-3' (SEQ ID No. 3), the base at the 3 ' end of the probe is blocked by C3-spacer, the FAM fluorescent reporter group is modified on the T base at the 30 th position, the C base at the 31 st position is replaced by Tetrahydrofuran (THF), and the quenching group BHQ1 is modified on the T base at the 32 nd position. The probe is combined with SEQ ID No.1 and SEQ ID No.2 to carry out fluorescence type ERA amplification, thereby specifically recognizing the GI group norovirus. The reaction program was set in the qPCR instrument as: 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; the FAM fluorescence signal was collected in the second reaction stage.

In a further aspect of the invention, there is provided a composition comprising the above oligonucleotide sequence. The composition comprises one or more sets of primer and probe sequences selected from any one of the following (1) to (2):

(1) g I group norovirus basic type ERA detection oligonucleotide primer pairs SEQ ID No. 1-SEQ ID No. 2;

(2) g I group norovirus fluorescent ERA detection oligonucleotide primer pairs of SEQ ID No. 1-SEQ ID No.2 and probe SEQ ID No.3 sequence;

in one embodiment, the GI group norovirus basic ERA amplification conditions are 37 ℃ for 10 min, and an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) reagent, shaking, mixing, centrifuging, and performing electrophoresis identification on the upper solution by using 2% agarose gel.

In one embodiment, the GI group norovirus fluorescent ERA amplification conditions are 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; the FAM fluorescence signal was collected in the second reaction stage. And analyzing the detection result through a fluorescence curve, wherein if a good amplification curve is obtained, the detection result is positive, and if no amplification exists, the detection result is negative.

In one aspect of the invention, there is provided a fluorescent ERA detection kit for group gi norovirus, and a fluorescent ERA detection kit, respectively, comprising said oligonucleotide sequence or said composition.

The kit provided by the invention comprises the specific primer pair respectively used for detecting the GI group norovirus component by the basic ERA, the specific primer probe composition used for detecting the GI group norovirus component by the fluorescent ERA and an instruction book.

In one embodiment, the GI group norovirus of the invention is based on the cDNA sequence of Norwalk virus (GenBank: M87661.2) and specific primers are designed at the nucleic acid sequences of ORF1 and ORF2 open reading frames, respectively. In one embodiment, the kit comprises a GI group norovirus-specific amplification target sequence of ATGTATGTCCCAGGATGGCAGGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGACGCTACATCAAGCGTGGATGGCGCTAGTGGCGCTGGTCAGTTGGTACCGGA (SEQ No.4), and in a preferred embodiment, the instructions for use of the kit include descriptions of specific primers and amplification conditions for use in the genotypic detection of GI group norovirus. In a specific embodiment, the kit for detecting norovirus components of the GI group of the invention further comprises a control. Preferably, the control comprises a positive control and a negative control. In one embodiment, the negative control is sterile double distilled water.

In one embodiment, the basal and fluorescent ERA detection methods are both 0.01 ng/. mu.L sensitive to detection of GI population norovirus.

In still another aspect, the invention provides the use of the composition or the kit for detecting GI group norovirus in samples such as food, feces and the like.

The design of amplification primers and probes is the key to the development of sensitive and rapid ERA detection method, and the design and screening of primers are necessary because primers with different sequences have different performances in ERA reaction, which will affect the amplification efficiency and the amplification speed.

Because the ERA amplification technology has unique reaction conditions of 37-42 ℃, the ERA detection has strict requirements on the design of primers, however, the primer and probe design of the ERA is not mature as that of the traditional PCR, and no design software can be used at present. Primers for general PCR are not suitable because the ERA primers are longer than the general PCR primers, usually 28-35 nt is desirable. Too short primers can reduce the recombination rate and affect the amplification rate and detection sensitivity. The primer is too long, and other secondary structures such as primer dimer or hairpin structure may be generated in the amplification process, thereby affecting the yield of nucleic acid amplification. And in designing ERA primers, the denaturation temperature is no longer a key factor affecting the amplification primers. Although these screened primers are known, the selection of the final primer also requires self-screening and optimization.

Based on the characteristics of ERA technology, the target sequences must be compared and selected sufficiently to ensure the specificity, sensitivity and speed of detection. For this purpose, the inventors have analytically selected a relative equilibrium of the base distribution in the sequence; GC content between 30% and 60% and no continuous G and C; no complex secondary structures such as forward/reverse repeat and palindrome of more than 12 bp exist; ERA primer and probe design was performed avoiding regions of repetitive sequences within the genome.

On one hand, the invention artificially establishes an efficient GI group norovirus basic type ERA detection method, and designs 5 groups of candidate primers which are respectively named as: GIF1/GIR 1-GIF 5/GIR5, sequence information and length of the fragment of interest are detailed in Table 1. The amplification effect was analyzed, and it was preliminarily determined that the amplification effect of the 2 sets of primers GIF2/GIR2 and GIF4/GIR4 was good (FIG. 1). Further, to obtain primers with optimal sensitivity, rate, and stability, we performed two rounds of screening: the primers from the first round of screening were further analyzed for sensitivity of detection by comparing the detection limit (FIG. 2) with specificity (FIG. 3), and integrating factors such as amplification efficiency and negative control. Finally, the best detection effect of the oligonucleotide primer pair GIF2/GIR2 on the GI group norovirus is determined, namely SEQ ID No. 1-SEQ ID No. 2.

On the other hand, in order to establish a fluorescent ERA rapid detection method of GI group norovirus, the inventors further designed the detection probes, modification groups and sequence information detailed in Table 1. The design of the probe requires the design at the middle position of the primer, the probe is completely complementary with the template, and the length of the probe is 46-52 nt; wherein the THF site is at least 30 nt 5 'and at least 15 nt 3'. The fluorophore and the quencher can only be labeled on thymine (T), and the fluorophore and the quencher are separated from each other by 1-5 nt, because the larger separation results in higher substrate value and lower signal-to-noise ratio, thereby reducing quenching efficiency. One nucleotide in the middle of the two was substituted with Tetrahydrofuran (THF), and the dT-fluorophore or dT-quencher was separated from the THF base by 0, 1 or 2. The 3' end of the probe needs to be modified and blocked by adding a blocking group, such as a C3-spacer, phosphate, amine, biotin or tetraethylene glycol. Under the action of exonuclease II, two groups are separated, and fluorescent signals are synchronously accumulated while amplification products are increased, so that a fluorescent curve can be synchronously detected.

The inventors designed 3 sets of probes: GIP2-1, GIP2-2 and GIP2-3 were combined with the above preferred basic ERA primer pair GIF2/GIR2, and the fluorescent type amplification effect was comparatively analyzed. By comparing the factors such as amplification efficiency (figure 4), specificity (figure 5), detection limit (/ 6), negative control and the like, the oligonucleotide primer probe combination GIF2/GIR2/GIP2-2 for detecting the GI group norovirus by the fluorescent ERA provided by the invention, namely SEQ ID No. 1-SEQ ID No.3, is finally determined.

Primer and probe sequence information for detecting G I type norovirus ERA designed in table 1

For further analysis of the coverage of the screened optimal primer probe combination in the group GI norovirus, reference sequences of 9 gene subtypes of the group GI norovirus were searched in the NCBI database, and the results of sequence alignment (FIG. 7) with the target sequence (SEQ No.4) showed that the remaining 6 group GI noroviruses, except for the group GI.2, the group GI.7 and the group GI.8, had high sequence conservation with the target sequence of SEQ No.4, and the sequence matching rate was 84% or more (Table 2). Thus, the selected primer probes showed good coverage for detection of 6 GI group norovirus.

TABLE 29 information of reference sequences of G I group norovirus and analysis of their match rates to target sequences

The method skillfully utilizes the specificity of the ERA technology to DNA high-efficiency amplification and nucleic acid hybridization and the rapidness, sensitivity and macroscopic visibility of the basic type and fluorescent ERA detection technology, and establishes 2 field visual rapid detection methods which are simple in operation, time-saving, labor-saving, reliable in result, accurate and sensitive. The basic type and fluorescence type ERA detection technology can be used for qualitative detection of GI group norovirus in food, excrement and the like simply, quickly, specifically and sensitively, and establishment of the method can provide good technical support for on-site quick risk screening of norovirus.

Drawings

FIG. 1 shows the results of screening primers designed to detect the basic group 5 GI norovirus ERA. In the figure, M represents DL2000 DNA ladder, 1 to 5 represent amplification results of GIF1/GIR1, GIF2/GIR2, GIF3/GIR3, GIF4/GIR4, GIF5/GIR5, respectively, and CK represents ddH₂O blank control.

FIG. 2 shows the results of sensitive detection of group GI norovirus using the preferred primer combinations GIF2/GIR2, GIF4/GIR 4. Drawing (A)Wherein M represents DL2000 DNA ladder, 1-5 represent DNA template concentrations of 10, 1, 10^-1、10^-2、10^-3Amplification result at ng/. mu.L, CK represents ddH₂O blank control.

FIG. 3 shows the results of specific detection of GI group norovirus using the above preferred primer combination GIF2/GIR 2. In the figure, M represents DL2000 DNA ladder; 1-8 are respectively: GI norovirus standard nucleic acid samples, GII group norovirus cDNA, rotavirus cDNA, hepatitis A virus cDNA, 2 replicates per sample; CK represents ddH₂O blank control.

FIG. 4 shows the results of analysis of the amplification efficiency of 3 sets of designed fluorescent ERA detection probes. FIGS. 1 to 3 show the results of amplification of the above preferred primer pair GIF2/GIR2 in combination with 3 probes GIP2-1, GIP2-2 and GIP2-3, respectively, and CK shows ddH₂O blank control.

FIG. 5 shows the results of the above preferred primer probe combination GIF2/GIR2/GIP2-2 for specific detection of GI group norovirus, and the control samples are: GII group norovirus cDNA, rotavirus cDNA, hepatitis a virus cDNA, 2 replicates per sample; CK represents ddH₂O blank control.

FIG. 6 shows the results of the analysis of the sensitivity of the above preferred primer probe combination GIF2/GIR2/GIP2-2 to the GI population norovirus fluorescent ERA method. The template concentration is respectively 10, 1 and 10^-1、10^-2、10^-3 ng/μL。

FIG. 7 shows the sequence alignment of the target sequences amplified by the designed primer probe combinations in 6 GI group norovirus.

Detailed Description

The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.

Example 1

This example screens for the basic ERA primers for detection of group GI norovirus by the following assay.

5 groups of G I group norovirus basic type ERA detection candidate primers are designed: GIF1/GIR1, GIF2/GIR2, GIF3/GIR3, GIF4/GIR4 and GIF5/GIR5 were subjected to amplification efficiency, sensitivity and specificity analysis, respectively.

The detection comprises the following main steps:

1) viral RNA extraction and reverse transcription: RNA extraction was performed on the virus using RNeasy Mini Kit, and the extracted RNA was reverse-transcribed into cDNA using Fast Kit RT Kit (With gDase) and diluted to 2 ng/. mu.L for assay.

2) Detection system and procedure: configured according to instructions of a basic nucleic acid amplification kit (ERA method), each sample premix liquid is: 20 μ L of lytic reagent, 2.5 μ L of forward primer, 2.5 μ L of reverse primer, 1 μ L of template, ddH₂O22. mu.L. Transfer 48. mu.l of the premix to an amplification PCR tube, shake, mix and centrifuge briefly. Adding 2 μ L of activator to the tube cap, carefully covering the tube cap, centrifuging for a short time to make the activator enter the premix, shaking for a short time, mixing, centrifuging rapidly again, reacting in a PCR instrument at 37 deg.C for 10 min, and adding sterile ddH₂O is blank control.

3) And (3) electrophoresis detection: after the reaction is finished, adding equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) reagent, shaking, mixing, centrifuging, 2% agarose gel electrophoresis identification of the upper solution,

4) and (4) judging a result: the blank control has no band at about 168 bp, and the result can be judged to be effective, otherwise, the result is invalid according to the experiment result. If the detected sample has an electrophoresis band about 1684 bp, the amplification result is positive, otherwise, the detected sample is negative.

As shown in FIG. 1, the designed candidate primers for detecting the basal type ERA of the 5G I group norovirus are compared in amplification efficiency, and the results show that the amplification bands of GIF2/GIR2 and GIF4/GIR4 are bright and single, and the effect is obviously better than that of the other 3 groups.

As shown in FIG. 2, the results of the detection sensitivity analysis of the screened primer pairs GIF2/GIR2 and GIF4/GIR4 showed that the amplification effect of the oligonucleotide primer pair GIF2/GIR2 on group GI norovirus was the best, with the lowest detection limit of 0.01 ng/. mu.L.

As shown in FIG. 3, the screened primer pair GIF2/GIR2 was further subjected to specificity analysis, and as a result, only 2 parallel samples of the GI group norovirus were found to be amplified, and GII group norovirus was found to be amplifiedViral standard nucleic acid sample, rotavirus cDNA, hepatitis A Virus cDNA and ddH₂No amplification occurred in 2 parallel samples of the O blank, which fully demonstrated that the specific oligonucleotide primers screened in this experiment exhibited excellent specificity for the group GI norovirus samples.

Example 2

This example screens fluorescent ERA primer probe combinations for detection of group GI norovirus by the following assay.

3 fluorescent ERA primer probe combinations are carried out on the designed GIP2-1, GIP2-2 and GIP2-3 and the optimized basic ERA primer pair GIF2/GIR2, and the fluorescent ERA primer probes for the detection of the GI group norovirus are finally determined by carrying out amplification efficiency, sensitivity and specificity analysis.

The detection comprises the following main steps:

1) the conditions for viral RNA extraction and reverse transcription experimental work were as described in example 1.

2) A detection system: a premix of each sample was prepared with reference to a fluorescent nucleic acid amplification kit (ERA method) using instructions: 20 μ L of lytic reagent, 2.1 μ L of forward primer, 2.1 μ L of reverse primer, 0.6 μ L of probe, 1 μ L of template, ddH₂O22.2. mu.L. And transferring the premixed solution into a PCR tube with a fluorescent amplification reagent, uniformly mixing by oscillation, and centrifuging for a short time. Add 2. mu.L of activator to the tube cap, carefully cover the tube cap, centrifuge briefly to get the activator into the premix, shake briefly and mix well and centrifuge rapidly again, place into the mini qPCR instrument.

3) Reaction procedure: 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; FAM was selected for the fluorescence channel in the second reaction phase and the threshold was set as default. While sterile water was used as a blank, 2 replicates were set up for each reaction.

4) And (4) judging a result: the result of the blank control without the amplification curve can be judged to be effective, otherwise, the result is invalid according to the experimental result. If the amplification curve is obvious, the result is judged to be positive. If there is no fluorescence curve, the result is judged to be negative.

As shown in FIG. 4, comparison of the amplification efficiencies of the candidate primer probes for the 3 combinations of group GI norovirus fluorescent ERA assays revealed that the amplification efficiencies of GIF2/GIR2/GIP2-2 were the best.

As shown in FIG. 5, when the screened primer-probe combination GIF2/GIR2/GIP2-2 was specifically analyzed, only 2 parallel samples of the GII norovirus were found to be amplified, and the GII norovirus standard nucleic acid sample, the rotavirus cDNA, the hepatitis A virus cDNA and the ddH were found to be amplified₂No amplification occurred in 2 parallel samples of the O blank, which fully demonstrated that the specific oligonucleotide primers screened in this experiment exhibited excellent specificity for the group GI norovirus samples.

As shown in FIG. 6, the screened primer-probe combination GIF2/GIR2/GIP2-2 was further analyzed for detection sensitivity, and the result showed that the oligonucleotide-primer combination had the highest sensitivity and the lowest content of 0.01 ng/. mu.L, which was capable of detecting group GI norovirus.

While particular embodiments of the present invention have been described, those skilled in the art will recognize that many changes and modifications may be made thereto without departing from the scope or spirit of the invention. Accordingly, it is intended to embrace all such changes and modifications that fall within the scope of the appended claims and equivalents thereof.

Claims

1. A composition for detecting a GI group norovirus by a basal-type ERA method, the composition comprising a GI group norovirus-specific oligonucleotide primer pair: 5'-ATGTATGTCCCAGGATGGCAGGCCATGT-3', and 5'-TCCGGTACCAACTGACCAGCGCCACTAG-3'.

2. A composition for detecting GI group norovirus by a fluorescent ERA method, the composition comprising a GI group norovirus-specific oligonucleotide primer pair according to claim 1, and a probe 5'-GACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGT-3', wherein the base at the 3 ' end of the probe is blocked with C3-spacer, the FAM fluorescent reporter is modified at the T base at position 30, the C base at position 31 is replaced with Tetrahydrofuran (THF), and the quencher BHQ1 is modified at the T base at position 32.

A method of basal ERA detection of norovirus of the GI group comprising using the composition of claim 1.

A method of fluorescent ERA detection of norovirus in the GI group comprising using the composition of claim 2.

5. A kit for identifying a GI group norovirus for use in a basal ERA detection method, said kit comprising the composition of claim 1.

6. A kit for identifying GI group norovirus using a fluorescent ERA detection method, said kit comprising the composition of claim 2.

7. The composition according to claims 1 and 2, the method according to claims 3 and 4, and the kit according to claims 5 and 6 for use in detection of GI group norovirus.