CN115948618A - ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination - Google Patents
ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination Download PDFInfo
- Publication number
- CN115948618A CN115948618A CN202211692135.XA CN202211692135A CN115948618A CN 115948618 A CN115948618 A CN 115948618A CN 202211692135 A CN202211692135 A CN 202211692135A CN 115948618 A CN115948618 A CN 115948618A
- Authority
- CN
- China
- Prior art keywords
- era
- syndrome virus
- taura syndrome
- primer
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 59
- 241001265687 Taura syndrome virus Species 0.000 title claims abstract description 57
- 241000238557 Decapoda Species 0.000 title claims abstract description 53
- 238000005516 engineering process Methods 0.000 title claims abstract description 13
- 238000001514 detection method Methods 0.000 title abstract description 43
- 238000000034 method Methods 0.000 claims abstract description 22
- 230000003321 amplification Effects 0.000 claims description 33
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 33
- 238000006243 chemical reaction Methods 0.000 claims description 27
- 210000001519 tissue Anatomy 0.000 claims description 9
- 239000002299 complementary DNA Substances 0.000 claims description 7
- 238000001917 fluorescence detection Methods 0.000 claims description 7
- WYURNTSHIVDZCO-UHFFFAOYSA-N tetrahydrofuran Substances C1CCOC1 WYURNTSHIVDZCO-UHFFFAOYSA-N 0.000 claims description 6
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 230000002441 reversible effect Effects 0.000 claims description 4
- 210000000087 hemolymph Anatomy 0.000 claims description 3
- 238000010839 reverse transcription Methods 0.000 claims description 3
- 210000000514 hepatopancreas Anatomy 0.000 claims description 2
- 230000002401 inhibitory effect Effects 0.000 claims description 2
- 238000010791 quenching Methods 0.000 claims description 2
- 230000000171 quenching effect Effects 0.000 claims description 2
- 230000035484 reaction time Effects 0.000 claims description 2
- YLQBMQCUIZJEEH-UHFFFAOYSA-N tetrahydrofuran Natural products C=1C=COC=1 YLQBMQCUIZJEEH-UHFFFAOYSA-N 0.000 claims description 2
- 241001135989 Porcine reproductive and respiratory syndrome virus Species 0.000 claims 1
- 230000035945 sensitivity Effects 0.000 abstract description 10
- 108090000623 proteins and genes Proteins 0.000 abstract description 9
- 238000013461 design Methods 0.000 abstract description 4
- 101800000593 Capsid protein 2 Proteins 0.000 abstract description 3
- 241000238553 Litopenaeus vannamei Species 0.000 description 11
- 241000696962 White spot syndrome virus Species 0.000 description 10
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 10
- 241000439574 Decapod penstyldensovirus 1 Species 0.000 description 9
- 201000010099 disease Diseases 0.000 description 6
- 102000039446 nucleic acids Human genes 0.000 description 6
- 108020004707 nucleic acids Proteins 0.000 description 6
- 150000007523 nucleic acids Chemical class 0.000 description 6
- 238000005457 optimization Methods 0.000 description 6
- 244000052769 pathogen Species 0.000 description 5
- 206010028851 Necrosis Diseases 0.000 description 4
- 239000012190 activator Substances 0.000 description 4
- 230000001154 acute effect Effects 0.000 description 4
- 230000017074 necrotic cell death Effects 0.000 description 4
- 239000013642 negative control Substances 0.000 description 4
- 230000001717 pathogenic effect Effects 0.000 description 4
- 238000003753 real-time PCR Methods 0.000 description 4
- 239000008223 sterile water Substances 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 241001126836 Enterocytozoon Species 0.000 description 3
- 241000700605 Viruses Species 0.000 description 3
- 239000007850 fluorescent dye Substances 0.000 description 3
- 239000008176 lyophilized powder Substances 0.000 description 3
- 238000003752 polymerase chain reaction Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 241000250967 Branchia Species 0.000 description 2
- 241000238552 Penaeus monodon Species 0.000 description 2
- 238000012197 amplification kit Methods 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 244000052616 bacterial pathogen Species 0.000 description 2
- 238000005119 centrifugation Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000002458 infectious effect Effects 0.000 description 2
- 238000011901 isothermal amplification Methods 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 229920000832 Cutin Polymers 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 241000238562 Farfantepenaeus aztecus Species 0.000 description 1
- 108010014594 Heterogeneous Nuclear Ribonucleoprotein A1 Proteins 0.000 description 1
- 241001157775 Litopenaeus stylirostris Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241000238367 Mya arenaria Species 0.000 description 1
- 241001282110 Pagrus major Species 0.000 description 1
- 241000709664 Picornaviridae Species 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 102000018120 Recombinases Human genes 0.000 description 1
- 108010091086 Recombinases Proteins 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 210000000805 cytoplasm Anatomy 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000006073 displacement reaction Methods 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 230000002255 enzymatic effect Effects 0.000 description 1
- 210000000981 epithelium Anatomy 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000003394 haemopoietic effect Effects 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 230000000670 limiting effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 210000004185 liver Anatomy 0.000 description 1
- 230000002101 lytic effect Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 230000036961 partial effect Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000013535 sea water Substances 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rapid detection method of a taura syndrome virus based on an ERA technology, and a primer and probe combination. The invention takes the taura syndrome virus capsid protein 2 gene as a target gene for detection, designs and synthesizes a primer and a probe special for ERA detection aiming at the target gene, and establishes an ERA detection method of the taura syndrome virus. The method has the advantages of simple operation steps, short time consumption, high speed, accuracy and reliability, and high detection sensitivity (the sensitivity can reach 10) 1 copies/mu L) can meet the requirement of field detection of the prawn taura syndrome virus in a farm.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to a rapid detection method of a shrimp taura syndrome virus based on an ERA technology and a primer and probe combination.
Background
The taura syndrome is commonly called as red tail disease and is a serious infectious prawn disease, and the acute stage is characterized by red and soft shell of prawn body and the transitional stage is characterized by irregular blackening of cutin epithelium. The disease was classified as two types of animal epidemic diseases in 2008 "the public Bureau of agriculture of the people's republic of China". OIE classifies it as a disease that must be declared. The pathogenic pathogen is Taura Syndrome Virus (TSV), belongs to single-stranded RNA virus, is temporarily classified in picornaviridae, can proliferate in cytoplasm, mainly infects 14-40-day-old young shrimps, and is susceptible to partial young shrimps or adult shrimps. The mortality rate of the infected prawns with the viruses reaches 60 to 95 percent, and the infected prawns with the White Spot Syndrome Virus (WSSV) and the Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) are called as three diseases affecting the world prawn culture by FAO. TSV primarily infects Penaeus vannamei (Penaeus vannamei), penaeus monodon (Penaeus monodon), penaeus vannamei (Penaeus aztecus), penaeus vannamei (Litopenaeus Stylirostris), of which Penaeus vannamei is the most sensitive because the virus rapidly proliferates and is released outside in the host. In recent years, since the penaeus vannamei boone is successfully introduced in China, the yield of the penaeus vannamei boone accounts for more than 50% of the total yield of the penaeus vannamei boone in China, and if the penaeus vannamei boone is epidemic and spread in China, the penaeus vannamei boone will cause heavy attack to the penaeus vannamei boone breeding industry in China. TSV has been reported to occur in coastal seawater prawn culture dense areas in Guangdong, guangxi, hainan, fujian and other provinces in China. Because no effective method for treating TSV exists at present, the epidemic and spread of pathogens can be avoided only by instant detection and comprehensive prevention and control.
At present, various methods are used for TSV detection at home and abroad, such as histological section pathological observation, common PCR, qRT-PCR, LAMP, liquid chip technology and the like, but the methods are complex to operate, long in time consumption, expensive in detection instrument, difficult to apply in a farm and not suitable for on-site rapid screening. Therefore, a rapid and simple detection method needs to be developed, which has important significance for prevention and control of TSV. The method for ERA constant-temperature fluorescence detection of TSV is established, is rapid, convenient, accurate and reliable, and can meet the field detection requirements of farms.
Enzymatic recombinant isothermal Amplification (ERA) is a constant temperature Amplification technique, in which 3 proteins (DNA Recombinase, single-strand binding protein, and DNA polymerase with a strand displacement function) are added to a reaction system containing a template, and specific primers and probes are added, so that nucleic acid Amplification can be completed within a certain time at constant temperature. Compared with other constant temperature amplification technologies, ERA can perform amplification reaction at 25-45 ℃, does not need thermal denaturation, has low requirements on hardware equipment, has higher nucleic acid amplification speed, can obtain a target amplification product within 20min, can quickly give a report in field detection, and greatly shortens the detection time.
Disclosure of Invention
The invention provides a constant-temperature fluorescence detection method for the taura syndrome virus of prawns and a combination of a primer and a probe, which aims to solve the problems in the prior art and can obviously shorten the detection time of TSV of prawns; meanwhile, the method is simple to operate, high in sensitivity and strong in specificity, meets the requirement of rapid detection, and provides an effective means for monitoring TSV in prawn culture.
In order to achieve the purpose, the invention adopts the following technical scheme:
one of the purposes of the invention is to provide a special primer and probe combination for constant-temperature fluorescence detection of prawns taura syndrome virus ERA, which comprises the following components: the nucleotide sequence of the prawns taura syndrome virus forward primer is shown as SEQ ID No. 1-2, the nucleotide sequence of the specific fluorescent probe is shown as SEQ ID No.3, wherein 33-bit base T of the probe marks a fluorescent group (6 FAM-dT), 34-bit base G of the probe is replaced by a tetrahydrofuran linker (THF), 35-bit base T marks a fluorescence quenching group (BHQ 1-dT), and the 3' end of the probe marks a modifying group (C3-SPACER) for inhibiting extension or amplification of polymerase. The introduction of a probe with a fluorescent label in an ERA system and the matching of a corresponding amplification primer can effectively improve the specificity of ERA detection.
On the other hand, the invention further provides a rapid detection method of the taura syndrome virus of the prawns based on the ERA technology, which comprises the following steps:
1) Extracting RNA of a sample to be detected, and carrying out reverse transcription to obtain cDNA;
2) Using the cDNA as a template, adopting the primer and the probe to carry out ERA amplification, and detecting the change of a fluorescent signal in an amplification system;
3) And (6) judging the result.
Preferably, the sample is selected from prawn branchia tissue, hemolymph or prawn hepatopancreas tissue in case of adult prawn, and sub-shell tissue in case of young prawn.
Preferably, the temperature for ERA amplification is 36-42 ℃.
Preferably, the temperature of ERA amplification is 42 deg.C, the reaction time is 20min, and the total number of cycles is 40.
Preferably, the concentration of the primer in the ERA reaction system is 500nM and the concentration of the probe is 120nM.
Preferably, the result of step 3) is judged as:
analyzing the sample to be detected according to the final fluorescence amplification curve, wherein the fluorescence curve is S-shaped, the CT value is less than or equal to 35, and the result is judged to be the positive result of the taura syndrome virus; and when the curve of the sample to be detected is not S-shaped or the CT value is more than 35, judging the curve as a negative result of the taura syndrome virus.
Compared with the prior art, the beneficial results of the invention are as follows:
the operation is simple. The detection method provided by the invention can get rid of dependence on large-scale instruments and professional detection laboratories, does not need professional operators, can be used for field detection, and has practical use requirements.
High efficiency and high speed. The whole process of the detection method can be completed within half an hour, and the detection efficiency of the taura syndrome virus of the prawns is improved.
High specificity and sensitivity. The detection method related by the invention is the genome DNA of common pathogen of prawnThe method comprises the steps of selecting a Taura Syndrome Virus (TSV), a liver Enterocytozoon (EHP), an acute hepatopancreaticosis necrosis disease (AHPND) pathogenic bacterium, an infectious epidermic and hematopoietic necrosis disease virus (IHHNV), a White Spot Syndrome Virus (WSSV) and a healthy prawn sample, and not generating nonspecific amplification; the detection sensitivity was 10 1 copies/μL。
The cost is low. The equipment used by the invention has simple structure and low detection cost, is suitable for the customers of aquatic products sensitive to the cost and is suitable for popularization and use.
Drawings
FIG. 1 is the result of temperature optimization of ERA amplification conditions for TSV. Wherein the temperature gradient is: 30 ℃, 33 ℃, 36 ℃, 39 ℃, 42 ℃ and 45 ℃.
FIG. 2 shows the result of optimizing primer concentration in ERA reaction system for TSV. Wherein the addition amount of the primers in the reaction system is 1.5. Mu.L, 2.0. Mu.L, 2.5. Mu.L and 3.0. Mu.L respectively.
FIG. 3 shows the result of probe concentration optimization of ERA reaction system for TSV. Wherein the addition amount of the probe in the reaction system is 0.6. Mu.L, 0.8. Mu.L and 1.0. Mu.L respectively.
FIG. 4 shows the results of the sensitivity test of the present invention. Wherein the template concentration is 10 respectively 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL、10 0 copies/. Mu.L; NTC was a negative control.
FIG. 5 shows the result of the specificity test of the present invention. Wherein the DNA of Taura Syndrome Virus (TSV), prawn Enterocytozoon (EHP), white Spot Syndrome Virus (WSSV), infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV), acute hepatopancreatic necrosis disease (AHPND) pathogen and healthy prawn are included; NTC was a negative control.
Detailed Description
For a better understanding of the technical content of the present invention, the present invention will be further described with reference to the following embodiments and accompanying drawings.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the quantitative experiments in the following examples, three replicates were set up and the results averaged.
The ERA fluorescent nucleic acid amplification kit of the following examples is a product of Suzhou Xianda Gene technology, inc., product number KS103.
Example 1: primer Probe design
The invention takes the capsid protein 2 gene of the taura syndrome virus of prawns as a target detection gene (the accession number in a Genebank database is AY 826052), and designs a group of primers and probes, and the sequences of the primers and the probes are shown in a table 1. The primers and probes were synthesized by Biotechnology (Shanghai) Inc.
TABLE 1 primer and Probe sequences
Example 2: ERA amplification condition temperature optimization
To determine the optimal temperature of the primer probe combination in example 1 for the ERA amplification reaction, a reaction assay was performed using the ERA fluorescent nucleic acid amplification kit, as follows.
The operation steps are as follows: the reaction system is 50. Mu.L, which contains 2.1. Mu.L (10. Mu.M) of each of the forward and reverse primers, 0.6. Mu.L (10. Mu.M) of the probe, 20. Mu.L of the lytic reagent, 2. Mu.L of the positive standard, and 48. Mu.L of sterile water. After mixing, transferring 48 μ L of the premix to each tube of lyophilized powder, shaking for mixing and centrifuging for a short time to dissolve the lyophilized powder sufficiently. For each sample, 2 μ L of activator was added to the reaction tube cap, the activator was added to the premix by brief centrifugation, vortexed briefly and again centrifuged rapidly. The reaction tube is rapidly placed into a real-time fluorescence quantitative PCR instrument, amplification is carried out under the conditions of 30 ℃, 33 ℃, 36 ℃, 39 ℃, 42 ℃ and 45 ℃, and the fluorescence value of the FAM channel is collected once every 30 seconds.
The positive standard substance involved in the system is recombinant plasmid containing TSV detection target gene, the plasmid is subjected to gradient dilution by 10 times, and the concentration is selected to be 10 5 copies/. Mu.L was used as template for the reaction.
The temperature optimization results are shown in fig. 1. And determining the optimal temperature in the amplification reaction according to the comparison of the Ct value and the fluorescence intensity. The result shows that the ERA reaction system can perform better amplification at 36-42 ℃, and the recommended temperature is 42 ℃.
Example 3: optimization of primer probe concentration in ERA reaction system
To determine the optimal concentration of primer probes in the ERA amplification reaction, we tested different primer concentrations (1.5. Mu.L, 2.0. Mu.L, 2.5. Mu.L, 3.0. Mu.L) and probe concentrations (0.6. Mu.L, 0.8. Mu.L, 1.0. Mu.L) and the procedure was as in example 2, the reaction was performed at 42 ℃.
The results of the primer probe concentration optimization are shown in FIG. 2 and FIG. 3, respectively. The result shows that the optimal concentration of the primer in the ERA reaction system is 500nM, and the optimal concentration of the probe is 120nM.
Example 4: ERA detection sensitivity test
To determine the sensitivity of the amplification reaction of the prawns taura syndrome virus ERA, a positive standard is used as a template and the positive standard is diluted by 10 times in a gradient way (1 multiplied by 10) 5 ～1×10 0 copies/. Mu.L) were run at these 6 concentration gradients.
The results of the detection are shown in FIG. 4. The results show that: the sensitivity of the method for detecting the taura syndrome virus ERA of the prawn is 10 1 copies/μL。
Example 5: ERA detection specificity assay
In order to determine the specificity of the amplification reaction of the prawns taura syndrome virus ERA, the DNA of Taura Syndrome Virus (TSV), prawn Enterocytozoon (EHP), white Spot Syndrome Virus (WSSV), infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV), acute hepatopancreatic necrosis disease (AHPND) pathogenic bacteria and healthy prawns are respectively used for detection.
The results of the detection are shown in FIG. 5. The results show that: the method for detecting the taura syndrome virus ERA only normally amplifies TSV genes, and does not amplify EHP, WSSV, IHHNV, AHPND, healthy prawn samples and negative control (sterile water). The results show that the designed primer and the probe do not have cross reaction with other pathogens, false negative does not occur, and the specificity is strong.
Example 6: ERA constant temperature fluorescence detection method for taura syndrome virus
1) Extracting RNA of the prawn to be detected, and carrying out reverse transcription to obtain cDNA;
1.1 sample selection: taking prawn branchia tissue, hemolymph or prawn hepatopancreatic tissue if adult prawn, and taking crustal tissue if prawn.
1.2 sample cDNA acquisition: the nucleic acid is obtained by adopting a nucleic acid rapid extraction kit and a traditional method.
2) The cDNA is taken as a template, the primer pair and the fluorescent probe in the embodiment 1 are adopted for ERA amplification, and a fluorescent detection device is used for detecting the change of a fluorescent signal in an amplification system;
2.1 premix for each sample was prepared as follows:
TABLE 2 reaction System
| ERA reaction system components | Sample addition/μ L per |
| Dissolving agent | |
| 20 | |
| Forward primer (10. Mu.M) | 2.5 |
| Reverse primer (10. Mu.M) | 2.5 |
| Probe (10 μ M) | 0.6 |
| |
2 |
| Sterile water | 20.4 |
| Volume of | 48 |
The premix was shaken well and centrifuged briefly.
2.2 for each sample, 48 μ L of premix was transferred to each vial of lyophilized powder. Mix well with shaking and centrifuge briefly.
2.3 for each sample, 2. Mu.L of activator was added to the reaction tube cap, the tube cap was carefully closed, and the activator was added to the premix by brief centrifugation. Mixing by brief shaking and fast centrifuging again
2.4 the reaction tube is placed into a fluorescence detection device and reacts for 20min at 42 ℃, and the fluorescence value of the FAM channel is collected every 30 seconds. ( The detection device comprises: any fluorescent detector that can excite and detect the selected fluorophore and stabilize the temperature at 36-42 deg.C is suitable, such as GS8 fluorescent isothermal amplification instrument, ABI 7500, lightCycler480, CFX 96 fluorescent quantitative PCR instrument, etc. )
2.5 after the reaction is complete, the data is saved and the sample tube is discarded.
3) And (6) judging the result. And qualitatively detecting the taura syndrome virus in the prawns according to the comparative Ct value and the fluorescence intensity.
Analyzing the sample to be detected according to the final fluorescence amplification curve, wherein the fluorescence curve is S-shaped, the CT value is less than or equal to 35, and the result is judged as a positive result of the taura syndrome virus; and when the curve of the sample to be detected is not S-shaped or the CT value is more than 35, judging the curve as a negative result of the taura syndrome virus.
The invention selects the taura syndrome virus capsid protein 2 gene as a target gene for detection, designs a special primer and a probe for ERA detection aiming at the target gene sequence, and establishes an ERA detection method of the taura syndrome virus. Experiments prove that: the method for detecting the ERA of the taura syndrome virus can finish detection within 30min at 36-42 ℃, the optimal temperature is 42 ℃, and the sensitivity is 10 1 The copies/mu L is equivalent to the detection level of one PCR (polymerase chain reaction) and qPCR (quantitative polymerase chain reaction) recommended by OIE, has no nonspecific amplification with EHP, WSSV, IHHNV, AHPND, healthy prawn samples and negative control (sterile water), is quick, convenient, accurate and reliable, and can meet the field detection requirement of a farm.
The above description is only exemplary of the present invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (8)
1. A special primer and probe combination for constant temperature fluorescence detection of prawns taura syndrome virus ERA comprises: the kit comprises a forward primer, a reverse primer and a probe, and is characterized in that the nucleotide sequence of the forward primer is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2; the 33 th base T of the probe is marked with a fluorescent group, the 34 th base G of the probe is replaced by a tetrahydrofuran linker, the 35 th base T is marked with a fluorescent quenching group, and the 3' end is marked with a modifying group for inhibiting extension or amplification of polymerase.
2. The special primer and probe combination for constant-temperature fluorescence detection of the taura syndrome virus ERA of the prawn as claimed in claim 1,
the probe sequence comprises in order: CAAGGAGCATGTGTGGCTGTGGAATAAGATGATGAA, i6FAM-dT, THF, iBHQ1-dT, AAGCAGACATCATA, C3-SPACER.
3. The method for rapidly detecting the taura syndrome virus of the prawns based on the ERA technology is characterized by comprising the following steps of:
1) Extracting RNA of a sample to be detected, and carrying out reverse transcription to obtain cDNA;
2) Performing ERA amplification by using the cDNA as a template and the primer and the probe as claimed in claim 1 or claim 2, and detecting the change of a fluorescent signal in an amplification system;
3) And (6) judging the result.
4. The method for rapidly detecting taura syndrome virus (PRRSV) according to claim 3, wherein the gill tissue, hemolymph or hepatopancreas tissue of prawn is selected from prawn if the sample is adult prawn, and the sub-crustal tissue is selected from prawn if the sample is young prawn.
5. The method for rapidly detecting the taura syndrome virus of prawns based on the ERA technology as claimed in claim 3, characterized in that the temperature for ERA amplification is 36-42 ℃.
6. The method for rapidly detecting the taura syndrome virus of prawns based on the ERA technology of claim 3, characterized in that the ERA amplification temperature is 42 ℃, the reaction time is 20min, and 40 cycles are total.
7. The method for rapidly detecting taura syndrome virus of prawns based on ERA technology as claimed in claim 3, characterized in that primer concentration in ERA reaction system is 500nM, and probe concentration is 120nM.
8. The method for rapidly detecting taura syndrome virus of prawns based on ERA technology as claimed in claim 3, characterized in that, the result of step 3) is judged as:
analyzing the sample to be detected according to the final fluorescence amplification curve, wherein the fluorescence curve is S-shaped, the CT value is less than or equal to 35, and the result is judged to be the positive result of the taura syndrome virus; and when the curve of the sample to be detected is not S-shaped or the CT value is more than 35, judging the curve as a negative result of the taura syndrome virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211692135.XA CN115948618A (en) | 2022-12-28 | 2022-12-28 | ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211692135.XA CN115948618A (en) | 2022-12-28 | 2022-12-28 | ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115948618A true CN115948618A (en) | 2023-04-11 |
Family
ID=87288716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211692135.XA Pending CN115948618A (en) | 2022-12-28 | 2022-12-28 | ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115948618A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102912041A (en) * | 2012-11-06 | 2013-02-06 | 厦门出入境检验检疫局检验检疫技术中心 | Primers and liquid-phase chip for detecting five viruses of prawns and application thereof |
| CN107988426A (en) * | 2017-11-10 | 2018-05-04 | 杭州众测生物科技有限公司 | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent |
| US20190175518A1 (en) * | 2016-04-26 | 2019-06-13 | Viaqua Therapeutics Ltd. | Compositions and methods for treating viral infections in shrimps |
| CN113604607A (en) * | 2021-07-28 | 2021-11-05 | 江苏奈尔森生物技术有限公司 | ERA nucleic acid test strip amplification kit for rapidly detecting feline herpesvirus, preparation method and detection method |
| CN114015809A (en) * | 2021-12-02 | 2022-02-08 | 中国检验检疫科学研究院 | ERA method, composition and kit for rapidly detecting GI group norovirus |
-
2022
- 2022-12-28 CN CN202211692135.XA patent/CN115948618A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102912041A (en) * | 2012-11-06 | 2013-02-06 | 厦门出入境检验检疫局检验检疫技术中心 | Primers and liquid-phase chip for detecting five viruses of prawns and application thereof |
| US20190175518A1 (en) * | 2016-04-26 | 2019-06-13 | Viaqua Therapeutics Ltd. | Compositions and methods for treating viral infections in shrimps |
| CN107988426A (en) * | 2017-11-10 | 2018-05-04 | 杭州众测生物科技有限公司 | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent |
| CN113604607A (en) * | 2021-07-28 | 2021-11-05 | 江苏奈尔森生物技术有限公司 | ERA nucleic acid test strip amplification kit for rapidly detecting feline herpesvirus, preparation method and detection method |
| CN114015809A (en) * | 2021-12-02 | 2022-02-08 | 中国检验检疫科学研究院 | ERA method, composition and kit for rapidly detecting GI group norovirus |
Non-Patent Citations (3)
| Title |
|---|
| ARUN K. DHAR ET AL.: "Quantitative assay for measuring the Taura syndrome virus and yellow head virus load in shrimp by real-time RT-PCR using SYBR Green chemistry", JOURNAL OF VIROLOGICAL METHODS, vol. 104, pages 69 - 82, XP002461526, DOI: 10.1016/S0166-0934(02)00042-3 * |
| 李伟哲 等: "桃拉综合征病毒的环介导等温扩增联合横向流动试纸条（LAMP-LFD）检测方法的建立", 河北农业大学学报, vol. 43, no. 3, pages 81 * |
| 王帅 等: "RPA、RAA及ERA技术在食源性致病菌快速检测中的研究进展", 食品科学, pages 1 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110777220B (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN112094944B (en) | Kit for quantitatively detecting novel coronavirus copy number | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| CN113913543B (en) | EHP real-time fluorescence quantitative PCR detection primer probe combination, kit and method | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| CN117660702A (en) | Fluorescent quantitative PCR primer group and method for detecting Liquorice pangolin virus | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| KR20140022971A (en) | Diagnostic primer for the heatitis b virus, probe, kit including same, and method for diagnosing the hepatitis b virus using the kit | |
| CN116411141A (en) | RPA-CRISPR/Cas12 a-based visualized detection kit for porcine group A rotavirus and application | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN115948618A (en) | ERA technology-based rapid detection method for taura syndrome virus of prawns, and primer and probe combination | |
| CN111334613B (en) | RPA primer pair, probe, kit and detection method for detecting canine adenovirus | |
| CN110684862B (en) | Microdroplet digital PCR kit for quantitatively detecting hepatitis B virus and detection method | |
| CN109576394B (en) | SYBR Green fluorescent quantitative RT-PCR primer for detecting Nebovirus and application | |
| CN112266978A (en) | Primer-probe combination, detection kit and application thereof | |
| CN111961757A (en) | Double-gene probe method real-time fluorescence quantitative PCR kit for detecting duck tembusu virus and application | |
| CN111500773A (en) | Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus | |
| CN115852006A (en) | rAN _ SNid detection method of prawn enterocytocele based on ERA technology, and primer and probe combination | |
| CN117344061B (en) | Method, kit, primer and probe for simultaneously detecting five human viruses EBV, HBV, HCV, HIV, HPV and application of method | |
| CN113444841B (en) | Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application | |
| CN111961758B (en) | N-DMV and N-DHCLV dual real-time fluorescent quantitative PCR identification and detection primer and kit | |
| CN116411132A (en) | Method for rapidly detecting porcine pseudorabies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20240218 Address after: 572024 7th floor, building 1, UFIDA Industrial Park, Yazhou Bay science and Technology City, Yazhou District, Sanya City, Hainan Province Applicant after: Sanya Institute of Oceanography Ocean University of China Country or region after: China Applicant after: HEIBEI XINHAI AQUATIC BIOTECHNOLOGY Co.,Ltd. Address before: 572024 Building 10, Yonyou Industrial Park, Yazhou Bay Science and Technology City, Yazhou District, Sanya City, Hainan Province Applicant before: Sanya Institute of Oceanography Ocean University of China Country or region before: China |