CN114032335A

CN114032335A - ERA method, composition and kit for rapidly detecting GII norovirus

Info

Publication number: CN114032335A
Application number: CN202111462004.8A
Authority: CN
Inventors: 杨艳歌; 袁飞; 李涛; 吴占文; 李红娜; 王帅; 王迎春
Original assignee: Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2021-12-02
Filing date: 2021-12-02
Publication date: 2022-02-11

Abstract

The invention relates to a method for rapidly detecting basic type and fluorescent type ERA of GII norovirus. The invention also relates to oligonucleotide primer probe compositions for use in the methods. The invention also relates to an ERA detection kit comprising the composition. The composition of the invention can be used for carrying out basic or fluorescent ERA detection, and can simply, quickly, specifically and sensitively detect the GII norovirus component in samples such as food, excrement and the like.

Description

ERA method, composition and kit for rapidly detecting GII norovirus

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a rapid detection technology for basic type and fluorescent type ERA of GII norovirus, an oligonucleotide primer probe composition used for the method, and a kit containing the composition.

Background

Norovirus is an enterovirus, is an RNA virus of norovirus in human Caliciviridae, mainly affects the intestinal tract of human body to cause acute gastroenteritis, is clinically manifested by nausea, vomiting and diarrhea, and is one of the common food-borne viruses at present. Norovirus infection is mainly among adults and school-age children, 60% -90% of all outbreaks of nonbacterial diarrhea in the united states are caused by norovirus every year, and the incidence of norovirus infection is around 15% in children with diarrhea under 5 years of age in china.

Norovirus can be divided into five gene groups of GI to GV (genoroup), with the GI and gii groups being the major contributors to human infection. The distribution and prevalence of GII-type strains is relatively more severe, accounting for over 90% of the total number of cases. The GII gene group is represented by Snow Mountain Virus (Snow Mountain Virus), and includes Hawaii Virus (Hawaii Virus), Toronto Virus (Mexico Virus), Lordsdale Virus, and the like. Among them, genotype 4 gii.4 is the most common, and as a statistical result, gii.4 has been dominant in worldwide epidemics since the first time norovirus caused worldwide pandemics in 1995-1996, and gii.4 caused pandemics almost every two or three years, and a new variant appeared. The epidemic genotypes of norovirus in different regions of China are mainly GII.4, accounting for about 68-75%, and a small amount of GII.2, GII.3, GII.5, GII.6, GII.7 and GII.8 exist at the same time. Annual outbreaks of norovirus cause great medical and economic burden to the country, but because of the characteristics of norovirus, no in vitro multiplication culture can be carried out, so that no special vaccines and medicines exist so far, and how to efficiently and quickly detect norovirus becomes a problem which needs to be solved by modern researchers urgently.

With the rapid development of molecular biology technology, various molecular biology technologies for tracing biological components by identifying nucleic acid have the advantages of strong specificity, high sensitivity, difficult interference of environmental conditions, stable result and the like, and are more and more widely applied to the detection of food-borne pathogenic microorganisms. However, the current popular PCR nucleic acid Amplification technology cannot meet the requirement of rapid detection, because the detection time of these PCR technologies is usually over 2 h, and a professional PCR nucleic acid Amplification instrument is required, which limits the popularization and application of the PCR nucleic acid Amplification technology, therefore, a nucleic acid detection method with fast, efficient and simple steps is required, and the Enzymatic recombinant isothermal Amplification technology (ERA) meets the requirement. In the technology, a recombinase is tightly combined with a primer under the environment of normal temperature to form a recombinase and primer polymer. When the recombinase and primer aggregate searches for a perfectly matched complementary sequence on the template DNA, the double-stranded structure of the template DNA is opened with the aid of the single-stranded DNA binding protein. Then, under the action of DNA polymerase, the primer is extended in the 5 '→ 3' direction to form a new complementary strand of DNA, and exponential growth of the amplified product is completed. Therefore, under the reaction condition of 37-40 ℃, the micro DNA and RNA specific fragments can be efficiently and rapidly amplified, and can be amplified by billions of times within a few minutes. The low-temperature adaptability, the sensitivity and the like of the high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity low-sensitivity high-sensitivity. The technology is an isothermal nucleic acid amplification technology with global autonomous intellectual property rights developed by China, and can get rid of foreign patent barriers. The technology is convenient, accurate and rapid, and becomes a hotspot of research in recent years.

Disclosure of Invention

The invention aims to detect the G II group norovirus components in samples such as food, excrement and the like quickly, efficiently, simply, intuitively, accurately and sensitively, has important significance for the field quick screening and risk detection of the G II group norovirus, and can effectively prevent the morbidity of norovirus infection.

The inventor designs a target sequence of a primer and a probe according to a gene sequence of a GII type norovirus, Lordsdale virus (GenBank: X86557.1) in international standard ISO 15216-2-2013 and national standard GB 4789.42-2016, and simultaneously searches a common enterovirus whole genome sequence in an NCBI database, such as rotavirus, hepatitis A virus, adenovirus and the like. Common sequences are compared by utilizing Clustal X software, and specific ERA primers and probes capable of efficiently detecting the GII group norovirus are designed and screened in interspecies difference regions according to the ERA primer design principle. Meanwhile, a basic group and a fluorescent group ERA two GII group norovirus field rapid detection technology is established.

In one aspect of the invention, there is provided a method for detecting genomic dna of a gaii type norovirus by chromogenic ERA comprising the steps of: 5'-TGAGATTCTCAGATCTGAGCACGTGGGA-3' (SEQ ID No. 1), and downstream GIIR: 5'-ATTATTGACCTCTGGGACGAGGTTGGCT-3' (SEQ ID No. 2). The primer can specifically recognize the sequence of the G II type norovirus, and the length of the amplified fragment is 134 bp.

In another aspect of the invention, there is also provided a probe giip for detecting gii type norovirus by fluorimetry ERA: 5'-GGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGAAT-3' (SEQ ID No. 3), the 3 ' end base of the probe is blocked by c3-spacer, the 29 th T base is modified with FAM fluorescent reporter group, the 31 st A base is replaced by THF, and the 33 rd T base is modified with quencher group to modify BHQ 1. The probe is combined with SEQ ID No.3 and SEQ ID No.4 to carry out ERA amplification by a fluorescence method, thereby specifically recognizing the G II type norovirus. The reaction program was set in the qPCR instrument as: 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; the FAM fluorescence signal was collected in the second reaction stage.

In a further aspect of the invention, there is provided a composition comprising the above oligonucleotide sequence. The composition comprises one or more sets of primer and probe sequences selected from any one of the following (1) to (2):

(1) g II group norovirus basic type ERA detection oligonucleotide primer pairs SEQ ID No. 1-SEQ ID No. 2;

(2) g II group norovirus fluorescent ERA detection oligonucleotide primer pairs of SEQ ID No. 1-SEQ ID No.2 and probe SEQ ID No.3 sequence;

in one embodiment, the GII group norovirus basic ERA amplification conditions are 37 ℃ for 10 min, and an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) reagent, shaking, mixing, centrifuging, and performing electrophoresis identification on the upper solution by using 2% agarose gel.

In one embodiment, the group GII norovirus fluorescent ERA amplification conditions are 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; the FAM fluorescence signal was collected in the second reaction stage. And analyzing the detection result through a fluorescence curve, wherein if a good amplification curve is obtained, the detection result is positive, and the detection result is negative if no amplification is obtained.

In one aspect of the invention, there is provided a fluorescent ERA detection kit for group gii norovirus, and a fluorescent ERA detection kit, respectively, comprising said oligonucleotide sequence or said composition.

The kit provided by the invention comprises the specific primer pair respectively used for basic ERA to detect the components of the GII group norovirus, the specific primer probe composition used for fluorescent ERA to detect the components of the GII group norovirus, and an instruction book.

In one embodiment, the cDNA sequence of the G II type norovirus Lordsdale virus (GenBank: X86557.1) of the present invention is the base sequence, and specific primers are designed at the nucleic acid sequences of ORF1 and ORF2 open reading frames, respectively. In one embodiment, the kit comprises a G II type norovirus specific amplification target sequence of TGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGAATGACGCCAACCCATCTGATGGGTCCGCAGCCAACCTCGTCCCAGAGGTCAATAATGA (SEQ No.4), and in a preferred embodiment, the instructions for use of the kit include descriptions of specific primers and amplification conditions for chromogenic detection of G II type norovirus. In a specific embodiment, the kit for detecting a component of a type gii norovirus according to the invention further comprises a control. Preferably, the control comprises a positive control and a negative control. In one embodiment, the negative control is sterile double distilled water.

In one embodiment, the sensitivity of both the basal and fluorescent ERA detection methods to group GII norovirus detection is 0.01 ng/. mu.L.

In still another aspect, the invention provides the use of the composition or the kit for detecting group gii norovirus in samples such as food, feces and the like.

The design of amplification primers and probes is the key to the development of sensitive and rapid ERA detection method, and the design and screening of primers are necessary because primers with different sequences have different performances in ERA reaction, which will affect the amplification efficiency and the amplification speed.

Because the ERA amplification technology has unique reaction conditions of 37-42 ℃, the ERA detection has strict requirements on the design of primers, however, the primer and probe design of the ERA is not mature as that of the traditional PCR, and no design software can be used at present. Primers for general PCR are not suitable because the ERA primers are longer than the general PCR primers, usually 28-35 nt is desirable. Too short primers can reduce the recombination rate and affect the amplification rate and detection sensitivity. The primer is too long, and other secondary structures such as primer dimer or hairpin structure may be generated in the amplification process, thereby affecting the yield of nucleic acid amplification. And in designing ERA primers, the denaturation temperature is no longer a key factor affecting the amplification primers. Although these screened primers are known, the selection of the final primer also requires self-screening and optimization.

Based on the characteristics of ERA technology, the target sequences must be compared and selected sufficiently to ensure the specificity, sensitivity and speed of detection. For this purpose, the inventors have analytically selected a relative equilibrium of the base distribution in the sequence; GC content between 30% and 60% and no continuous G and C; no complex secondary structures such as forward/reverse repeat and palindrome of more than 12 bp exist; ERA primer and probe design was performed avoiding regions of repetitive sequences within the genome.

On one hand, the invention artificially establishes an efficient GII group norovirus basic type ERA detection method, and designs 3 groups of candidate primer pairs for screening, wherein the 3 groups of candidate primer pairs are respectively as follows: the amplification effect was first analyzed for GIII F1/GIII R1, GIII F2/GIII R2, GIII F3/GIII R3, the sequence information and the length of the target fragment as shown in Table 1 (FIG. 1). Further, to obtain primers with optimal sensitivity, rate, and stability, we performed two rounds of screening: the primers from the first round of screening were further analyzed for sensitivity of detection by comparing the detection limit (FIG. 2) with specificity (FIG. 3), and integrating factors such as amplification efficiency and negative control. Finally, the best detection effect of the oligonucleotide primer pair GII 1/GII R1 on the GII group norovirus is determined, namely SEQ ID No. 1-SEQ ID No. 2.

On the other hand, in order to establish a fluorescent ERA rapid detection method of the GII group norovirus, the inventor further designs a detection probe. The design of the probe requires the design at the middle position of the primer, the probe is completely complementary with the template, and the length of the probe is 46-52 nt; wherein the THF site is at least 30 nt 5 'and at least 15 nt 3'. The fluorophore and the quencher can only be labeled on thymine (T), and the fluorophore and the quencher are separated from each other by 1-5 nt, because the larger separation results in higher substrate value and lower signal-to-noise ratio, thereby reducing quenching efficiency. One nucleotide in the middle of the two was substituted with Tetrahydrofuran (THF), and the dT-fluorophore or dT-quencher was separated from the THF base by 0, 1 or 2. The 3' end of the probe needs to be modified and blocked by adding a blocking group, such as a C3-spacer, phosphate, amine, biotin or tetraethylene glycol. Under the action of exonuclease II, two groups are separated, and fluorescent signals are synchronously accumulated while amplification products are increased, so that a fluorescent curve can be synchronously detected.

The inventors designed 3 sets of probes GIIP1/2/3, GIIP2 and GIIP2/3, the detailed information of the modifying groups and sequences are shown in Table 1, and the probes and the 3 designed basic ERA primer pairs are combined in 6 ways, respectively: GIIF1/GIIR1/GIIP1/2/3, GIIF2/GIIR2/GIIP1/2/3, GIIF3/GIIR3/GIIP1/2/3, GIIF2/GIIR2/GIIP2, GIIF2/GIIR2/GIIP2/3, and GIIF3/GIIR3/GIIP2/3, and comparative analysis was performed on the fluorescent type amplification effect. By comparing the factors such as amplification efficiency (figure 4), specificity (figure 5), detection limit (figure 6), negative control and the like, the combination of the oligonucleotide primer probe for detecting the GII group norovirus by the fluorescent ERA provided by the invention, GII 1/GIII R1/GIIP1/2/3, namely SEQ ID No. 1-SEQ ID No.3, is finally determined.

GII type norovirus ERA detection primer probe sequence information designed in Table 1

Finally, the applicant analyzed the sequence conservation among 28 gene subtypes of the GII norovirus in the screened optimal primer probe combination, the reference sequences used by the 28 gene subtypes are shown in the following table 2, and the analysis result shows that the oligonucleotide sequence composition provided by the application has high sequence conservation in the rest 27 GII noroviruses except the GII.15 subtypes (figure 7), which indicates that the detection coverage of the GII norovirus is good.

TABLE 29 GII norovirus reference sequence information and analysis of match rates to target sequences

The method skillfully utilizes the specificity of the ERA technology to DNA high-efficiency amplification and nucleic acid hybridization and the rapidness, sensitivity and macroscopic visibility of the basic type and fluorescent ERA detection technology, and establishes 2 field visual rapid detection methods which are simple in operation, time-saving, labor-saving, reliable in result, accurate and sensitive. The basic type and fluorescence type ERA detection technology can be used for qualitative detection of the GII group norovirus in food, excrement and the like simply, quickly, specifically and sensitively, and establishment of the method can provide good technical support for on-site quick risk screening of the norovirus.

Drawings

FIG. 1 shows the results of screening 3 groups of GII norovirus basic ERA detection primers. In the figure, M represents DL2000 DNA ladder, 1-5 represent the amplification results of GIII F1/GIII R1, GIII F2/GIII R2, and GIII F3/GIII R3, respectively, and CK represents ddH₂O blank control.

FIG. 2 shows the results of sensitivity tests on group GI noroviruses using the above preferred two primer sets GIIF1/GIIR R1 and GIIF2/GIIR R2. In the figure, M represents DL2000 DNA ladder, and 1-5 represent DNA template concentrations of 10, 1, 10^-1、10^-2、10^-3Amplification result at ng/. mu.L, CK represents ddH₂O blank control.

FIG. 3 shows the results of specific detection of group GI norovirus using the preferred primer pair GIIF1/GIIR R1 described above. In the figure, M represents DL2000 DNA ladder; 1-8 are respectively: GII norovirus cDNA, GII norovirus standard nucleic acid samples, rotavirus cDNA, hepatitis A virus cDNA, 2 replicates per sample; CK represents ddH₂O blank control.

FIG. 4 shows the results of analysis of the amplification efficiency of 3 sets of designed fluorescent ERA detection probes. In the figure, A1-A6 respectively represent the amplification results of primer probe combinations GIIF1/GIIR1/GIIP1/2/3, GIIF2/GIIR2/GIIP1/2/3, GIIF3/GIIR3/GIIP1/2/3, GIIF2/GIIR2/GIIP2, GIIF2/GIIR2/GIIP2/3, GIIF3/GIIR3/GIIP2/3, and CK represents ddH2O blank control.

FIG. 5 shows the results of the above preferred primer probe combination GIIF1/GIIR1/GIIP1/2/3 specific analysis of the fluorescent ERA method of group GII norovirus, and the control samples are: group GI norovirus cDNA, rotavirus cDNA, hepatitis A virus cDNA, 2 replicates per sample; CK denotes ddH2O blank.

FIG. 6 shows the results of the sensitivity analysis of the above preferred primer probe combination GIIF1/GIIR1/GIIP1/2/3 to the GII group norovirus fluorescent ERA method. The template concentration is respectively 10, 1 and 10^-1、10^-2、10^-3 ng/μL。

FIG. 7 shows the results of sequence conservation analysis of the above preferred primers and probes among 27 gene subtypes.

Detailed Description

The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.

Example 1

This example screens the basis type ERA primers for group GII norovirus detection by the following assay.

3 groups of GII group norovirus basic type ERA detection candidate primers are designed: GIIF1/GIIR1, GIIF2/GIIR2, and GIIF3/GIIR3 (Table 1), were analyzed for amplification efficiency, sensitivity, and specificity, respectively.

The detection comprises the following main steps:

1) viral RNA extraction and reverse transcription: RNA extraction was performed on the virus using RNeasy Mini Kit, and the extracted RNA was reverse-transcribed into cDNA using Fast Kit RT Kit (With gDase) and diluted to 2 ng/. mu.L for assay.

2) Detection system and procedure: configured according to instructions of a basic nucleic acid amplification kit (ERA method), each sample premix liquid is: 20 μ L of lysis reagent, 2.5 μ L of forward primer, 2.5 μ L of reverse primer, 1 μ L of template, and 22 μ L of ddH2O 22. Transfer 48. mu.l of the premix to an amplification PCR tube, shake, mix and centrifuge briefly. Adding 2 mu L of activator to the tube cap, carefully covering the tube cap, centrifuging for a short time to enable the activator to enter the premix, shaking for a short time to mix uniformly, centrifuging rapidly again, placing the mixture into a PCR instrument, reacting for 10 min at 37 ℃, and taking sterile ddH2O as a blank control.

3) And (3) electrophoresis detection: after the reaction is finished, adding equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) reagent, shaking, mixing, centrifuging, 2% agarose gel electrophoresis identification of the upper solution,

4) and (4) judging a result: the blank control has no band at about 134 bp, and the result can be judged to be effective, otherwise, the result is invalid according to the experimental result. If the detected sample has an electrophoresis band about 134 bp, the amplification result is positive, otherwise, the detected sample is negative.

As shown in FIG. 1, the designed 3 groups of GIII group norovirus basic ERA detection candidate primers are compared in amplification efficiency, and the results show that the amplification bands of GIIF1/GIIR1 and GIIF2/GIIR2 are bright and single, and the effect is obviously better than that of GIIF3/GIIR 3.

As shown in FIG. 2, the results of the detection sensitivity analysis of the screened primer pairs GIIF1/GIIR1 and GIIF2/GIIR2 showed that the amplification effect of the oligonucleotide primer pair GIII F1/GIII R1 was the best, and the lowest content of the detected GIII group norovirus was 0.01 ng/. mu.L.

As shown in FIG. 3, the screened primer pair GIIF1/GIIR1 was further subjected to specificity analysis, and as a result, only 2 parallel samples of GII group norovirus were found to be amplified, the GII norovirus standard nucleic acid sample, rotavirus cDNA, hepatitis A Virus cDNA and ddH₂No amplification occurred in 2 parallel samples of the O blank, which fully indicates that the specific oligonucleotide primers screened in this experiment exhibit excellent specificity to the G II group norovirus samples.

Example 2

This example screens fluorescent ERA primer probe combinations for group GII norovirus detection by the following assay.

3 sets of probes (Table 1) were designed, and 6 combinations of the 3 sets of basic ERA primer pairs were performed, respectively: GIIF1/GIIR1/GIIP1/2/3, GIIF2/GIIR2/GIIP1/2/3, GIIF3/GIIR3/GIIP1/2/3, GIIF2/GIIR2/GIIP2, GIIF2/GIIR2/GIIP2/3 and GIIF3/GIIR3/GIIP2/3, and finally the fluorescent ERA primer probes for the detection of the GIII group norovirus are determined by carrying out amplification efficiency, sensitivity and specificity analysis.

The detection comprises the following main steps:

1) the conditions for viral RNA extraction and reverse transcription experimental work were as described in example 1.

2) A detection system: a premix of each sample was prepared with reference to a fluorescent nucleic acid amplification kit (ERA method) using instructions: 20 μ L of lytic reagent, 2.1 μ L of forward primer, 2.1 μ L of reverse primer, 0.6 μ L of probe, 1 μ L of template, ddH₂O22.2. mu.L. And transferring the premixed solution into a PCR tube with a fluorescent amplification reagent, uniformly mixing by oscillation, and centrifuging for a short time. Add 2. mu.L of activator to the tube cap, carefully cover the tube cap, centrifuge briefly to get the activator into the premix, shake briefly and mix well and centrifuge rapidly again, place into the mini qPCR instrument.

3) Reaction procedure: 1 s at 37 ℃; 5 s at 37 ℃ for 40 cycles; FAM was selected for the fluorescence channel in the second reaction phase and the threshold was set as default. While sterile water was used as a blank, 2 replicates were set up for each reaction.

4) And (4) judging a result: the result of the blank control without the amplification curve can be judged to be effective, otherwise, the result is invalid according to the experimental result. If the amplification curve is obvious, the result is judged to be positive. If there is no fluorescence curve, the result is judged to be negative.

As shown in FIG. 4, comparison of the amplification efficiencies of the candidate primer probes for the GIII group norovirus fluorescent ERA detection of 6 combinations revealed that the amplification efficiency of the GIIF1/GIIR1/GIIP1/2/3 primer probe combination was the best.

As shown in FIG. 5, when the screened primer probe combination GIIF1/GIIR1/GIIP1/2/3 was specifically analyzed, only 2 parallel samples of GII norovirus were amplified, and the GII norovirus standard nucleic acid sample, rotavirus cDNA, hepatitis A virus cDNA and ddH were found to be amplified₂No amplification was observed in 2 replicates of the O blank, which fully illustrates the specificity of the screening in this experimentThe oligonucleotide primers showed excellent specificity for the group gii norovirus samples.

As shown in FIG. 6, the detection sensitivity analysis was further performed on the screened primer-probe combination GIIF1/GIIR1/GIIP1/2/3, and the result showed that the oligonucleotide-primer combination had the highest sensitivity and the lowest content of norovirus in the GII group was 0.01 ng/. mu.L.

While particular embodiments of the present invention have been described, those skilled in the art will recognize that many changes and modifications may be made thereto without departing from the scope or spirit of the invention. Accordingly, it is intended to embrace all such changes and modifications that fall within the scope of the appended claims and equivalents thereof.

Claims

1. A composition for detecting a group gii norovirus by a basal ERA method, said composition comprising a group gii norovirus-specific oligonucleotide primer pair: 5'-TGAGATTCTCAGATCTGAGCACGTGGGA-3', and 5'-ATTATTGACCTCTGGGACGAGGTTGGCT-3'.

2. A composition for detecting gii group norovirus by a fluorescent ERA method, the composition comprising a gii group norovirus-specific oligonucleotide primer pair according to claim 1, and a probe 5'-GGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGAAT-3', wherein the base at the 3 ' end of the probe is blocked with c3-spacer, the FAM fluorescent reporter is modified at the T base at position 29, the a base at position 31 is replaced with Tetrahydrofuran (THF), and the quencher BHQ1 is modified at the T base at position 33.

A method of detecting basal ERA of group gii norovirus, said method comprising using the composition of claim 1.

A method of fluorescent ERA detection of group gii norovirus, said method comprising using the composition of claim 2.

5. A kit for identifying group gii norovirus for use in a basal ERA detection method, said kit comprising the composition of claim 1.

6. A kit for identifying group gii norovirus using a fluorescent ERA detection method, said kit comprising the composition of claim 2.

7. The composition according to claims 1 and 2, the method according to claims 3 and 4, and the use of the kit according to claims 5 and 6 for the detection of group gii norovirus.