CN112301155B - RDA method and kit for rapidly detecting rotavirus - Google Patents

RDA method and kit for rapidly detecting rotavirus Download PDF

Info

Publication number
CN112301155B
CN112301155B CN202010081193.3A CN202010081193A CN112301155B CN 112301155 B CN112301155 B CN 112301155B CN 202010081193 A CN202010081193 A CN 202010081193A CN 112301155 B CN112301155 B CN 112301155B
Authority
CN
China
Prior art keywords
rda
rotavirus
seq
kit
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010081193.3A
Other languages
Chinese (zh)
Other versions
CN112301155A (en
Inventor
谢婵芳
刘华勇
黄嘉恩
陈翀
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Universal Junan Biotechnology Co ltd
Original Assignee
Guangzhou Universal Junan Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Universal Junan Biotechnology Co ltd filed Critical Guangzhou Universal Junan Biotechnology Co ltd
Priority to CN202010081193.3A priority Critical patent/CN112301155B/en
Publication of CN112301155A publication Critical patent/CN112301155A/en
Application granted granted Critical
Publication of CN112301155B publication Critical patent/CN112301155B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an RDA method and a kit for rapidly detecting rotavirus, which comprise a specific primer pair and an RDA fluorescent labeling probe so as to realize safe, specific, sensitive and simple detection of Rotavirus (RV) and make up for the defects of the traditional detection technology. The kit provided by the method can omit the nucleic acid extraction step, realizes rotavirus detection within 20min at the constant temperature of 37-42 ℃, has the specificity of 100 percent, and is very suitable for on-site rapid detection. Compared with the common PCR method, the RDA fluorescence method is to react at constant temperature without changing temperature or complex instrument, and has short reaction time. Therefore, the method and the kit thereof have the characteristics of simple and quick operation, good specificity, high sensitivity, low cost and the like, provide an effective technical means for on-site quick detection and screening of rotaviruses, and have wide application prospects.

Description

RDA method and kit for rapidly detecting rotavirus
Technical Field
The invention belongs to the technical field of molecular biology. More particularly, it relates to a primer pair, a probe and a related kit for detecting rotavirus nucleic acid based on RDA fluorescence detection technology.
Background
Rotavirus (RV) is a double-stranded ribonucleic acid virus belonging to the reoviridae family. There are seven rotaviruses in total, numbered A, B, C, D, E, F and G in english. Among them, the Rotavirus (RV) capable of causing diarrhea in humans is only A, B, C group, group a being the most common one. Group a rotavirus is one of the major pathogens causing diarrhea in infants and young children, which primarily infects small intestine epithelial cells, causing cell damage, causing diarrhea. Rotavirus is prevalent in summer, autumn and winter each year, the infection route is faecal-oral route, rotavirus infection goes from asymptomatic, slight onset to serious onset, and fatal gastroenteritis, dehydration and electrolyte balance occur in serious cases. Wherein the clinical manifestations of acute gastroenteritis include fever, vomiting, abdominal pain and bloodless watery diarrhea, and the symptoms can last for 3-9 days. Almost every child about five years old in the world has been infected with rotavirus at least once.
At present, classical detection methods of rotavirus diseases in China are electron microscope technology, enzyme-linked immunosorbent assay (ELISA), colloidal gold method and the like. The methods such as electron microscope technology, enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR) and the like require special equipment and special technical talents, however, the conditions are often difficult to obtain in basic community diagnosis and treatment institutions, and the early discovery and prevention of rotaviruses are affected. At present, a simple, cheap and high-automation rotavirus detection kit suitable for basic layer detection is still lacking.
With the silent rise of in vitro isothermal amplification of nucleic acids, limitations of conventional amplification techniques have changed, and in the last decade, isothermal nucleic acid amplification techniques, such as LAMP (loop-mediated nucleic acid amplification technique), HDA (helicase-dependent isothermal nucleic acid amplification technique) and the like, have been rapidly developed to amplify viral nucleic acids under isothermal conditions. The techniques can achieve efficient nucleic acid amplification by only maintaining a constant reaction temperature with a temperature control device, thereby eliminating the dependence on a PCR instrument for precisely controlling temperature changes. If nucleic acid amplification can be realized under normal temperature conditions, the nucleic acid amplification technology is further simplified, and the application of the technology in a wider range is facilitated. The timely and accurate discovery of epidemic situation of infectious disease has important significance for disease prevention and control and epidemic situation control, so that a kit capable of being used in basic diagnosis and treatment institutions and rapidly detecting nucleic acid at normal temperature is very necessary to research and develop.
Disclosure of Invention
The invention aims to overcome the defects and the shortcomings of the existing rotavirus detection technology. The research shows that the Rotavirus (RV) RDA fluorescence method detection kit realizes the rapid detection of the rotavirus, and only needs 20-30min from sample treatment to result completion in the whole RV detection process, thereby greatly shortening the conventional detection time and improving the detection efficiency.
The object of the present invention is to provide a probe and a primer pair for detecting rotavirus after optimization.
The nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2.
Preferably, two schemes are used to design the RDA fluorescent-labeled probe, the first scheme being: the conserved sequence of 25-35bp is selected as a probe sequence, a luminous group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF). The second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. Through series experimental comparison, the two probe designs are suitable for RDA fluorescence detection methods, and have no obvious difference in detection sensitivity and specificity.
The probe with the nucleotide sequence of SEQ ID NO.1 is characterized in that a luminous group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), wherein the specific information is as follows:
RV-P1(SEQ ID NO.1)：
5’-FAM-CAACC[THF]CAGCTCTTGAGAATATGGGAATAG-BHQ1-3′
the nucleotide sequence of the probe is SEQ ID NO.2, the 30 th base T of the 5 'end of the probe marks FAM or other luminescent groups, the 32 nd base is replaced by tetrahydrofuran residue (THF), the 33 rd base marks BHQ1 or other quenching groups, and the 3' end of the probe is subjected to C3-spacer blocking modification, wherein the specific information is as follows:
RV-P2(SEQ ID NO.2)：
5-GAAGCTGCAGTTGTAGCTGCAACCTCAGC[FAM-dT]C[THF][BHQ1-dT]GAGA ATATGGGAATAG[C3-spacer]-3’
the nucleotide sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4, the target sequence is shown as SEQ ID NO.5, and the specific information is as follows:
RV-F1(SEQ ID NO.3)：5’-TGGAGTCTACGCAACAGATGGCCGTC-3’；
RV-R1(SEQ ID NO.4)：5’-ACTCTAGAATATATATCCTGATAATCA-3’。
the invention also aims to provide a kit for detecting rotavirus based on isothermal amplification technology.
The kit comprises a nucleic acid extraction reagent, a isothermal amplification reaction module, positive control and negative control, and the probe and the primer.
Preferably, the isothermal amplification reaction module is a freeze-dried powder reagent of isothermal amplification reaction mixed reagent.
Preferably, the isothermal amplification reaction mixture is an RPA or Recombinase-dependent amplification technique (RDA) isothermal amplification reaction mixture.
It is another object of the present invention to provide a kit for detecting rotavirus based on Recombinase-dependent amplification technology (RDA) (Recombinase-dependent amplification).
The Recombinase-dependent amplification technique (Recombinase-dependent amplification, RDA) is realized by the following technical scheme:
according to the invention, a biological informatics method is utilized to carry out analysis simulation and high-throughput virtual screening on a batch of protein structures, and a large number of biological experiments prove that a new recombinase combination with high stability is finally found. Specifically, the invention develops a novel recombinase composition which is a recombinase KX and an auxiliary protein KY, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, the amino acid sequence of the recombinase KX is shown as SEQ ID NO.7, the nucleotide sequence of the auxiliary protein KY is shown as SEQ ID NO.8, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 9.
The recombinase KX can be used for replacing the recombinase UvsX or RecA in the RPA reaction, and the KY protein can be used for replacing the UvsY protein in the RPA reaction.
The sequence homology of the recombinase KX with the T4UvsX protein is 50% (201/395). Based on the recombinase combination, the team develops a novel detection method and detection system of a recombinase-dependent amplification (RDA) technology with high stability and high specificity. The preparation process of the recombinase KX is simple, the yield and the stability are greatly improved, and the mass production cost is low. And the amplification technology based on the recombinase combination development has the advantages of short required primer (18-30 bp), low requirement on the length of a target sequence and wide applicability. Furthermore, the technology has good detection specificity and high sensitivity on the nucleic acid target sequence, can realize high-sensitivity and high-precision rapid molecular detection under the constant temperature condition of 25-42 ℃, has low detection cost, is convenient and quick to operate, and has wide application prospect.
The recombinant enzyme KX and protein KY are derived from Escherichia phage phT A phage, escherichia phage phT A belongs to the genus Slopekvirus in the subfamily of Tevenvirinae belonging to the family Myoviridae.
The recombinant enzymes KX and protein KY can realize a large amount of soluble expression in escherichia coli.
In particular as an alternative, the preparation method comprises the following steps:
s1, introducing a target gene expression fragment into an expression vector to obtain a recombinant expression vector;
s2, transferring the recombinant expression vector into an expression bacterium to obtain a recombinant engineering bacterium;
s3, carrying out induction culture on the recombinant engineering bacteria, enriching the engineering bacteria, carrying out ultrasonic crushing, and centrifuging to obtain unpurified recombinant enzyme;
s4, purifying the unpurified recombinase through chromatography to obtain the recombinase KX. The purified recombinant enzyme KX does not have the phenomenon of coagulation or precipitation at low temperature.
The target gene expression fragment in the step S1 contains a nucleic acid sequence shown as SEQ ID NO.6, the 5 'end of the target gene expression fragment is provided with a BamHI enzyme cutting site adhesive end, and the 3' end of the target gene expression fragment is provided with a Sall enzyme cutting site adhesive end.
Preferably, the expression vector in step S1 is a pET-28a vector.
Preferably, the expressing bacterium in step S2 is escherichia coli.
The preparation process is simple, the yield and the stability are greatly improved, and the mass production cost is low.
Preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: recombinant enzymes KX, KY protein, gp32 protein, strand displacement DNA polymerase, reverse transcriptase, exonuclease, creatine kinase, creatine phosphate, tris-buffer, potassium acetate or sodium acetate, PEG20000 or PEG35000, DTT, dNTPs, dATP, probes, primer pairs, magnesium acetate. Preferably, the reaction system further comprises a detection template, such as a sample DNA or RNA to be detected.
Preferably, the reaction conditions of the reaction system are 25-42 ℃ for 10-60min.
More preferably, the reaction conditions of the reaction system are 39 ℃ for 30min.
The reaction principle of the recombinase-dependent amplification (RDA) reaction system is as follows: (1) reverse transcription of RNA into DNA; (2) A recombinase-primer complex formed by combining recombinase with a specific primer of 18-30bp, and searching a target site in the double-stranded DNA template; (3) After the recombinase-primer complex recognizes the template specific sequence, localization occurs and strand exchange is initiated, and the single-stranded binding protein is then bound to the D-Loop structure formed by the displaced DNA strand; (4) The dATP conformation in a recombinase-primer complex hydrolysis system is changed, the 3 'end of a primer is exposed after the recombinase is dissociated and is recognized by DNA polymerase, and the DNA polymerase starts DNA synthesis at the 3' end of the primer according to a template sequence; (5) The DNA polymerase has a strand displacement function, and the double-helix DNA structure of the template is continuously unwound while the primer is extended, and the DNA synthesis process is continuously carried out; (6) The two primers are amplified to form a complete amplicon; (7) In the reaction system, dATP is hydrolyzed into recombinase to be changed into dATP, and phosphocreatine can transfer the phosphate group of the phosphocreatine into dATP molecules under the catalysis of creatine kinase to form dATP, so that the level of the dATP in the reaction system is recovered. The above process is repeated continuously, and finally, the efficient amplification of the nucleic acid is realized.
A kit for detecting Rotavirus (RV) based on a recombinase-dependent amplification (RDA) technology is constructed based on the reaction system and comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, positive control and negative control, and the probe and the primer.
Preferably, the RDA isothermal amplification reaction module is freeze-dried powder of RDA isothermal amplification reaction mixed reagent.
Preferably, the RDA isothermal amplification reaction module comprises recombinant enzyme KX 60-600 ng/. Mu. L, KY protein 16-192 ng/. Mu.L, single-stranded binding protein gp32100-1000 ng/. Mu.L, strand displacement DNA polymerase 3-100 ng/. Mu.L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, reverse transcriptase 200U, tris buffer 20-100mM, PEG2.5% -10%, potassium acetate or sodium acetate 0-150mM, dATP 1-5mM, dNTPs 150-600nM each, DTT 1-12mM, probe 150nM-600nM, and primer pair 150-600nM.
Preferably, the Tris-buffer is Tris-tricine.
Preferably, the concentration of Tris-tricine is 100mM.
The nucleic acid extraction reagent comprises Buffer A and Buffer B. Buffer A is sample lysate and contains Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton; buffer B contains Tris Buffer system, potassium chloride and magnesium chloride; the positive control is a target gene plasmid containing Rotavirus (RV), and the negative control is an empty vector pUC57 plasmid.
Still another object of the present invention is to provide a method for detecting rotavirus based on the recombinase-dependent amplification technique.
The detection method comprises the following steps: extracting nucleic acid of a sample to be detected, carrying out real-time fluorescence RDA reaction in the presence of a rotavirus primer pair, a probe, an RDA freeze-dried powder reagent, a Buffer A and a Buffer B by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2; wherein the reaction temperature is 25-42 ℃ and the reaction time is more than 10 minutes.
Preferably, the method comprises the following steps:
1) Sample processing
Shaking and mixing 20 μL of Buffer A and 5 μL of positive control/negative control/fecal sample to be detected, and standing at room temperature for 10-15min;
2) System preparation and detection
Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the fluorescent signal is collected every minute after 1 minute and 30 cycles at 39 ℃ and the detection is completed after 30 minutes;
3) Result determination
The result is interpreted based on the Time (Tt) at which the fluorescence value generated by the reaction system reaches the Threshold value.
(1) Positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The invention has the following beneficial effects:
1. the kit provided by the invention is used for detecting rotavirus RNA in a fecal sample, has the characteristics of simplicity in operation, rapidness and sensitivity, provides an effective technical means for on-site rapid detection and screening of rotavirus, and has important significance in clinical detection of rotavirus.
2. The kit provided by the invention adopts an RDA isothermal amplification detection method, can realize effective amplification of target genes at 37-42 ℃, does not need temperature change, and does not need complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 10 copies/. Mu.l.
3. In the RDA method, the recombinase KX protein and KY protein have high specificity to the target sequence in the amplification process, and only the primer sequence and the template sequence are completely complementary to start the amplification, so that the specificity of the amplification is greatly improved, and the high-efficiency constant-temperature nucleic acid amplification without background is realized.
Drawings
FIG. 1 is a graph showing the results of ATP hydrolysis activities of 4 proteins in the recombinase screening of example 1 of the present invention.
FIG. 2 is an agarose gel diagram of a isothermal amplification reaction of 4 proteins in the recombinase screen of example 1 of the invention.
FIG. 3 is a three-dimensional structure of KX protein in example 1 of the present invention.
FIG. 4 is a three-dimensional block diagram of the KY protein heptamer in example 1 of the present invention.
FIG. 5 is a graph showing the results of the RDA fluorescence assay kit according to example 1 of the present invention.
FIG. 6 is a graph showing the sensitivity test results of the RDA fluorescence assay kit according to example 2 of the present invention.
FIG. 7 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 8 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 9 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
FIG. 10 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
Detailed Description
The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. It will be apparent to those skilled in the art that various changes, modifications, substitutions, combinations, and simplifications can be made without departing from the spirit and principles of the invention and these are intended to be equivalent arrangements.
Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art. Reagents and materials used in the following examples are commercially available unless otherwise specified.
Unless otherwise indicated, the immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA, etc., employed by this invention are within the skill of the art. See Sambrook (Sambrook), friech (Fritsch) and manitis (Maniatis), molecular cloning: laboratory Manual (MOLEC. Mu.M LAR CLONING: A LABORATORY MANUAL), edit 2 (1989); the handbook of contemporary molecular BIOLOGY (CURRENT PROTOCOLS IN MOLEC μm LAR BIOLOGY) (edit by f.m. ausubel et al, (1987)); series (academic publishing company) of methods in enzymology (METHODS IN ENZYMOLOGY): PCR2 practical methods (PCR 2:A PRARVICAL APPROACH) (M.J. MaxFrisson (M.J. MacPherson), B.D. Black (B.D. Hames) and G.R. Taylor (G.R. Taylor) editions (1995)), harlow and Lane editions (1988) antibodies: laboratory Manual (ANTIBODIES, A LABORATORY MANUAL), animal cell culture (ANIMAL CELL C. Mu.M LTURE) (R.I. French Lei Xieni (R.I. Freshney) edit (1987)).
Example 1 Rotavirus (RV) RDA fluorescence detection kit
(1) Acquisition of recombinant enzyme KX and KY proteins
The reported recombinase UvsX has poor stability, is difficult to produce in mass production and store for a long time, and in order to solve the problem, the research and development team finally finds a new recombinase KX and auxiliary protein KY thereof by analyzing and simulating a large quantity of protein structures by using a bioinformatics method.
In this embodiment, the research and development team maps the information of key functional sites in the recombinase structure, such as DNA binding sites, ATP hydrolysis sites, etc., to the three-dimensional protein structure to obtain the information of secondary structure and information of tertiary structure, and constructs a data model for screening the recombinase protein structure by integrating the functional residues, the secondary structure features and the space distance of tertiary structure of the primary structure sequence. Through searching templates matched with the recombinase protein in the primary structure from SwissProt, PDB data, 312 protein sequences are primarily screened out, secondary structure and tertiary structure comparison are respectively carried out, similarity scores are calculated, ranking is carried out according to the similarity scores, and 15 proteins suspected to have the recombinase activity are simulated and screened out.
The 15 proteins are respectively constructed into recombinant protein expression vectors, and after being respectively expressed and purified, the ability of the recombinant protein expression vectors to hydrolyze ATP is detected, wherein 4 proteins have ATP hydrolysis activity and are KX, X-1, X-2 and X-3 proteins respectively. In the experiment, firefly luciferase ATP bioluminescence detection kit is used, and the experiment is carried out strictly according to the operation of the specification, and the result is shown in FIG. 1.
The 4 proteins with ATP hydrolyzing activity are prepared into a constant temperature amplification system for amplification reaction, the result is shown in figure 2, N is negative control, P is positive control amplified by adding T4UvsX, and 1-4 proteins are KX, X-1, X-2 and X-3 respectively, wherein only KX protein has amplification activity. The KX protein is derived from Escherichia phage phT A phage, and the three-dimensional structure diagram is shown in FIG. 3.
In the same way we screened the helper protein KY derived from the Escherichia phage phT a phage for the recombinase KX, the three-dimensional structure of which is shown in figure 4. Wherein the auxiliary protein KY needs to play an active role in the form of heptamers.
Finally obtaining the recombinase KX for RDA amplification, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 7; the nucleotide sequence of the recombinase KY is shown as SEQ ID NO.8, and the amino acid sequence is shown as SEQ ID NO. 9.
(2) Rotavirus detection primer and probe design and screening
The rotavirus complete gene sequence was searched through NCBI (www.ncbi.nlm.nih.gov), homology alignment and sequence analysis were performed using Clone manager software and BLAST, and sequences conserved within the species of the pathogen and having interspecies variation were selected as target regions. After complete genome sequence comparison and homology analysis of various rotaviruses, the conserved NSP3 gene is finally selected as a target gene (reference sequence GenBank accession number: MH 769716.1), and RDA detection primers and probe design are carried out on the target fragment. The DNA plasmid, primer and probe sequence of target gene are synthesized by Shanghai JieRui bioengineering Co.Ltd. Screening rotavirus NSP3 gene highly conserved sequence as follows:
SEQ ID NO.5：
ATGCTCAAGATGGAGTCTACGCAACAGATGGCCGTCTCAATTATTAACTCTTC TTTTGAAGCTGCAGTTGTAGCTGCAACCTCAGCTCTTGAGAATATGGGAATAGAAT ATGATTATCAGGATATATATTCTAGAGTAAAGAATAAATTTGATTTTGTGATGGACGA TTCTGGTGTTAAAAATAATCTGATTGGTAAAGCAATAACTATTGATCAAGCTTTGAA TAATAAATTTGGATCTGCTATAAGAAATAGAAACTGGCTTGCTGATACTTCTAGAGC AGCTAAATTGGATGAGGATGTAAACAAACTAAGAATGATGTTATCATCAAAAGGAA TTGATCAAAAAATGAGAGTTTTAAACGCATGCTTCAGTGTAAAAAGAATACCTGG AAAATCATCATCTATTATTAAATGCACAAAATTGATGCGTGATAAATTGGAACGTGG TGAAGTTGAAGTGGATGATTCATTTGTGGATGAAAAAATGGAAGTGGATACCATTG ACTGGAAATCGCGCTATGAGCAATTGGAGCAAAGGTTTGAATCATTGAAATCCAG GGTAAATGAAAAATATAATAATTG
in the embodiment, the design is carried out by adopting the RDA technology primer design principle, the lengths of the upstream primer and the downstream primer are 18-30bp, 3 primers are respectively designed according to the conserved sequence of the NSP3 gene of the rotavirus, and the sequences of the primers are as follows:
the upstream primer RV-F1:5'-TGGAGTCTACGCAACAGATGGCCGTC-3'
The upstream primer RV-F2:5'-ATGCTCAAGATGGAGTCTACGCAACAGA-3'
The upstream primer RV-F3:5'-CTACGCAACAGATGGCCGTCTCAATTA-3'
Downstream primer RV-R1:5'-ACTCTAGAATATATATCCTGATAATCA-3'
Downstream primer RV-R2:5'-TCATTCTTAGTTTGTTTACATCCTCATCC-3'
Downstream primer RV-R3:5'-GATCAATAGTTATTGCTTTACCAATCAG-3'
The 3 pairs of primers were paired pairwise to form 9 combinations for optimal primer combination screening.
Combination 1: RV-F1 and RV-R1; combination 2: RV-F1 and RV-R2 combination 3: RV-F1 and RV-R3
Combination 4: RV-F2 and RV-R1; combination 5: RV-F2 and RV-R2 combination 6: RV-F2 and RV-R3
Combination 7: RV-F3 and RV-R1; combination 8: RV-F3 and RV-R2 combination 9: RV-F3 and RV-R3
Through a series of experimental screening and evaluation, combination 1 (RV-F1 and RV-R1) is determined as the optimal primer group, and specifically:
RV-F1(SEQ ID NO.3)：5’-TGGAGTCTACGCAACAGATGGCCGTC-3’；
RV-R1(SEQ ID NO.4)：5’-ACTCTAGAATATATATCCTGATAATCA-3’。
in the RDA fluorescence detection technique, two schemes are used to design the RDA fluorescence labeling probe, the first scheme is as follows: the target region is selected to be a 25-35bp conserved sequence, a 5 '-end is marked with a luminescent group, a 3' -end is marked with a quenching group, any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), the nucleotide sequence in the embodiment is a probe of SEQ ID NO.1, the 5 '-end is marked with the luminescent group, the 3' -end is marked with the quenching group, any position of 5-position bases is replaced by tetrahydrofuran residue (THF), and specific information is as follows:
RV-P1(SEQ ID NO.1)：
5’-FAM-CAACC[THF]CAGCTCTTGAGAATATGGGAATAG-BHQ1-3′
the second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. In the probe with the nucleotide sequence of SEQ ID NO.2, the 30 th base T of the 5 'end is marked with FAM or other luminescent groups, the 32 nd base is replaced by tetrahydrofuran residue (THF), the 33 rd base is marked with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, which has the following specific information:
RV-P2(SEQ ID NO.2)：
5-GAAGCTGCAGTTGTAGCTGCAACCTCAGC[FAM-dT]C[THF][BHQ1-dT]GAGA ATATGGGAATAG[C3-spacer]-3’
through series experimental comparison, the two probe designs are both suitable for RDA fluorescence detection methods, and have no obvious difference in detection sensitivity and specificity, wherein the target conserved sequence required by the first probe design is shorter, the requirement on the nucleic acid sequence is low, and in the subsequent examples of the patent, the first probe RV-P1 (SEQ ID NO. 1) is used as a detection probe to prepare an RDA isothermal amplification reaction system.
(3) Establishment of Rotavirus (RV) RDA detection method
The patent constructs a kit for detecting Rotavirus (RV) based on a recombinase dependent amplification technology (RDA), which comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, a positive control and a negative control, wherein the nucleic acid extraction reagent comprises Buffer A and Buffer B, the Buffer A is sample lysate and contains a Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton, and the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; optimal allocation ratio of a reaction system in the RDA isothermal amplification reaction module is shown in table 1, and the optimal allocation ratio comprises the fluorescent labeled probe and the primer; the positive control is a target gene plasmid containing Rotavirus (RV), and the negative control is an empty vector pUC57 plasmid.
TABLE 1 RDA isothermal amplification reaction module reaction system ratios
Sequence number Component (A) Concentration of content
1 Tris-tricine(PH 7.9) 100mM
2 Potassium acetate 50mM
3 PEG20000 or PEG35000 5％
4 Dithiothreitol (DTT) 2mM
5 dNTPs 200nM each
6 dATP 2mM
7 Creatine kinase (Creatine kinase) 0.2mg/ml
8 Creatine phosphate (Creatine phosphate) 50mM
9 Reverse transcriptase 200U
10 Strand-displacing DNA polymerase 50ng/ul
11 gp32 protein 300ng/ul
12 Recombinant enzyme KX 120ng/ul
13 Helper protein KY 60ng/ul
14 Exonuclease 50U
15 Upstream primer 500nM
16 Downstream primer 500nM
17 Fluorescent-labeled probe 300nM
18 Magnesium acetate 14mM
The reaction conditions of the reaction system are as follows: reacting at 25-42 deg.C for 10-60min.
The optimal reaction conditions are as follows: the reaction was carried out at 37℃for 30min.
In this example, 3 collected stool samples positive for rotavirus RNA were verified by fluorescent quantitative PCR, and tested using the RDA fluorescence detection kit of this patent.
The specific operation is as follows:
step one, sample processing. Shaking and mixing 20 mu L of Buffer A and 5 mu L of positive control/negative control/sample to be detected uniformly, and standing at room temperature for 10-15min;
and step two, preparing and detecting the system. Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the fluorescent signal is collected every minute after 1 minute and 30 cycles at 39 ℃ and the detection can be completed after 30 minutes;
and step three, judging the result.
(1) Positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The detection results are shown in table 2 and fig. 5, and the positive control and the negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, and is the content of effective result', and Tt value of each sample is less than 25min, and positive is judged.
The result shows that the detection method of the RDA fluorescence detection kit established in the embodiment can detect rotavirus RNA in feces.
Table 2 establishment of the method for detecting the kit
Negative control Positive control Sample 1 Sample 2 Sample 3
Tt value - 09:57 10:22 13:46 10:57
Example 2RDA fluorescence detection reagent sensitivity test
The positive control was pUC57-NSP3 plasmid containing NSP3 gene of Rotavirus (RV), and the negative control was pUC57 plasmid of empty vector.
The specific operation is as follows:
firstly, diluting positive control plasmids to 10-4 c, and then diluting the positive control plasmids by 10-time gradient to 10-3 c, 10-2 c and 10-1 c respectively.
And step two, sample processing. Taking 5 mu L of plasmids with each concentration in the step one into an EP tube, simultaneously taking 5 mu L of negative control into another EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: collecting fluorescence signals every minute after 1 minute and 30 cycles at 39 ℃;
and step four, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 3 and FIG. 6. The negative control Tt value is NA, and accords with the content that no amplification curve appears in the judging standard or the Tt value is more than or equal to 25 min. 10-4 c, 10-3 c, 10-2 c, 10-1 c have Tt values of <25min, and according to the result determination criteria, 10-4 c, 10-3 c, 10-2 c, 10-1 c are positive.
That is, the sensitivity of the RDA fluorescence detection kit reaches 10 copies.
TABLE 3 sensitivity test results
Negative control 10^4 10^3 10^2 10^1
Tt value - 09:39 12:11 12:15 14:54
Example 3RDA fluorescence assay reagent specificity test
Samples of 2 cases of Rotavirus (RV), 1 case of Norovirus (NV) and 1 case of Adenovirus (AV) 3 cases were collected clinically and tested as positive for the corresponding viruses by fluorescent quantitative PCR, and the specificity of the kit was checked.
The specific operation is as follows:
step one, sample processing. Taking 5 mu L of each positive sample in an EP tube, simultaneously taking 5 mu L of each positive control and negative control of the kit in a new EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: collecting fluorescence signals every minute after 1 minute and 30 cycles at 39 ℃;
and step four, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 4. Positive control and negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25mn, which is the content of effective result. Tt values of the RV samples are smaller than 25min, and positive judgment is made; NV and AV were negative, as judged by no amplification curve.
That is, RDA fluorescence is positive only when the target pathogen is rotavirus, and negative for other viruses.
TABLE 4 specificity test results
Negative control Positive control RV-1 RV-2 NV AV
Tt value - 08:36 08:57 10:24 - -
Example 4 stability test of RDA fluorescence detection kit
The liquid reagent needs to be stored at low temperature and can not be repeatedly frozen and thawed. The kit is characterized in that the RDA fluorescence reaction module is dried into a powdery reagent in vacuum, the freeze-dried powdery reagent can be stored at normal temperature, the cost of cold chain transportation and low-temperature storage is saved, and the operation is simpler. The stability of the RDA fluorescence detection kit was verified in this example.
The specific operation is as follows:
eight-tube containing lyophilized reagents were sealed in aluminum foil bags containing a desiccant and stored in a 37 ℃ incubator. 2 reaction wells were taken for testing at 0 day, 30 day, 90 day, 180 day, respectively.
Step one, sample processing. Taking 5 mu L of positive control and negative control of the kit respectively in an EP tube, adding 20 mu L of Buffer A respectively, shaking and mixing uniformly, and standing at room temperature for 10-15min;
and step two, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: collecting fluorescence signals every minute after 1 minute and 30 cycles at 39 ℃;
and step three, judging the result. Determination criteria:
(1) positive control: typical amplification curves appear, tt values <25min, as effective results;
(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;
(3) the sample to be tested:
a. if Tt value is less than 25min, judging positive;
b. if the Tt value is more than or equal to 30min, judging negative;
c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.
The results are shown in Table 5 and FIG. 7, FIG. 8, FIG. 9, and FIG. 10. The freeze-dried powder of the reagent of the RDA fluorescence reaction module stored for 0 day, 30 day, 90 day and 180 day is tested, each Tt value is smaller than 25min, and the detection results of the reagent in the kit in the patent after freeze-drying are positive in 0 day, 30 day, 90 day and 180 day according to the result judgment standard. The reagent in the kit can be stably stored for at least 3 months at 37 ℃ after being freeze-dried.
TABLE 5 preservation stability at 37℃
Day 0 For 30 days 90 days 180 days
Negative control - - - -
Positive control 09:46 10:23 10:57 11:34
Sequence listing
<110> Guangzhou Pushijunan biotechnology Co., ltd
<120> RDA method and kit for rapid detection of rotavirus
<160> 9
<170> SIPOSequenceListing 1.0
<210> 2
<211> 30
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 1)
<400> 2
caacctcagc tcttgagaat atgggaatag 30
<210> 2
<211> 49
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 2)
<400> 2
gaagctgcag ttgtagctgc aacctcagct cttgagaata tgggaatag 49
<210> 3
<211> 26
<212> DNA
<213> primer sequence (SEQ ID NO. 3)
<400> 3
tggagtctac gcaacagatg gccgtc 26
<210> 4
<211> 27
<212> DNA
<213> primer sequence (SEQ ID NO. 4)
<400> 4
actctagaat atatatcctg ataatca 27
<210> 5
<211> 584
<212> DNA
<213> target sequence (SEQ ID NO. 5)
<400> 5
atgctcaaga tggagtctac gcaacagatg gccgtctcaa ttattaactc ttcttttgaa 60
gctgcagttg tagctgcaac ctcagctctt gagaatatgg gaatagaata tgattatcag 120
gatatatatt ctagagtaaa gaataaattt gattttgtga tggacgattc tggtgttaaa 180
aataatctga ttggtaaagc aataactatt gatcaagctt tgaataataa atttggatct 240
gctataagaa atagaaactg gcttgctgat acttctagag cagctaaatt ggatgaggat 300
gtaaacaaac taagaatgat gttatcatca aaaggaattg atcaaaaaat gagagtttta 360
aacgcatgct tcagtgtaaa aagaatacct ggaaaatcat catctattat taaatgcaca 420
aaattgatgc gtgataaatt ggaacgtggt gaagttgaag tggatgattc atttgtggat 480
gaaaaaatgg aagtggatac cattgactgg aaatcgcgct atgagcaatt ggagcaaagg 540
tttgaatcat tgaaatccag ggtaaatgaa aaatataata attg 584
<210> 6
<211> 1158
<212> DNA
<213> recombinase KX nucleotide sequence (SEQ ID NO. 6)
<400> 6
atgtcaaaca aagcactact aaaaaaactg atcaaaaact cgaatagcca aactgcatct 60
gtactttctg aaagcgacgt attcaacaat attaccatca cgcgaacccg tgtgccgatt 120
ctgaatctgg cgttgtccgg tgcgtttaac ggtggcctaa cttctggtct tacccttttc 180
gctggcccgt ccaaacactt caaatccaac ttaggtttgc ttactgtagc ggcgtatctc 240
aaaacgtatg aagatgctgt gtgcctgttc tacgattcag aaaaaggtgt tactaaatcc 300
tatctgaaat caatgggtgt tgatccggat cgtgttgtgt atactcgtat cacgacggtc 360
gagcagttgc gtaatgacgt tgtaagccag cttaacgcgc ttgaacgcgg tgataaggtg 420
attgtattcg ttgactcagt aggcaacacg gcaagtaaaa aagaacttgc tgacgcgctt 480
tctgataacg ataaacagga tatgacgcga gcaaaagcat taaaaggtat gttccgtatg 540
gttacgcctt atctggctga cctggatatc ccgatggttt gtatctgtca tacctatgac 600
acacaagaaa tgtacagcaa gaaagttatt tctggtggta ctggtttaat gtattccgct 660
gatactgcga tcatcctggg taaacaacag gtgaaagaag gtactgaggt ggtaggttat 720
gatttcatca tgaatatcga aaaatctcga ttcgtgaaag agaaatcaaa attcccgctg 780
catgttacct atgaaggcgg tattagtatg tattctggcc ttttggatct ggcaatggaa 840
atgaactttg tacagaccgt aaccaaaggc tggcgcaacc gcgctttcct gaataccgag 900
actggcgaac tcgaagttga agaaaagaaa tggcgtgagt cagaaacaaa tagcgttgaa 960
ttctggcgtc ctctgtttac tcatcaacca ttcttgaaag ctatcgaaga aaagtataag 1020
atcccagatc gtgaaatcag tgatggttcc gcgctggaag atttatacag cactgatagc 1080
atcccagatc ctgatctgga tgatgacgat atcccagaat catttgatga tatcgaagaa 1140
aacgacgaaa ttttataa 1158
<210> 7
<211> 385
<212> PRT
<213> recombinase KX amino acid sequence (SEQ ID NO. 7)
<400> 7
Met Ser Asn Lys Ala Leu Leu Lys Lys Leu Ile Lys Asn Ser Asn Ser
1 5 10 15
Gln Thr Ala Ser Val Leu Ser Glu Ser Asp Val Phe Asn Asn Ile Thr
20 25 30
Ile Thr Arg Thr Arg Val Pro Ile Leu Asn Leu Ala Leu Ser Gly Ala
35 40 45
Phe Asn Gly Gly Leu Thr Ser Gly Leu Thr Leu Phe Ala Gly Pro Ser
50 55 60
Lys His Phe Lys Ser Asn Leu Gly Leu Leu Thr Val Ala Ala Tyr Leu
65 70 75 80
Lys Thr Tyr Glu Asp Ala Val Cys Leu Phe Tyr Asp Ser Glu Lys Gly
85 90 95
Val Thr Lys Ser Tyr Leu Lys Ser Met Gly Val Asp Pro Asp Arg Val
100 105 110
Val Tyr Thr Arg Ile Thr Thr Val Glu Gln Leu Arg Asn Asp Val Val
115 120 125
Ser Gln Leu Asn Ala Leu Glu Arg Gly Asp Lys Val Ile Val Phe Val
130 135 140
Asp Ser Val Gly Asn Thr Ala Ser Lys Lys Glu Leu Ala Asp Ala Leu
145 150 155 160
Ser Asp Asn Asp Lys Gln Asp Met Thr Arg Ala Lys Ala Leu Lys Gly
165 170 175
Met Phe Arg Met Val Thr Pro Tyr Leu Ala Asp Leu Asp Ile Pro Met
180 185 190
Val Cys Ile Cys His Thr Tyr Asp Thr Gln Glu Met Tyr Ser Lys Lys
195 200 205
Val Ile Ser Gly Gly Thr Gly Leu Met Tyr Ser Ala Asp Thr Ala Ile
210 215 220
Ile Leu Gly Lys Gln Gln Val Lys Glu Gly Thr Glu Val Val Gly Tyr
225 230 235 240
Asp Phe Ile Met Asn Ile Glu Lys Ser Arg Phe Val Lys Glu Lys Ser
245 250 255
Lys Phe Pro Leu His Val Thr Tyr Glu Gly Gly Ile Ser Met Tyr Ser
260 265 270
Gly Leu Leu Asp Leu Ala Met Glu Met Asn Phe Val Gln Thr Val Thr
275 280 285
Lys Gly Trp Arg Asn Arg Ala Phe Leu Asn Thr Glu Thr Gly Glu Leu
290 295 300
Glu Val Glu Glu Lys Lys Trp Arg Glu Ser Glu Thr Asn Ser Val Glu
305 310 315 320
Phe Trp Arg Pro Leu Phe Thr His Gln Pro Phe Leu Lys Ala Ile Glu
325 330 335
Glu Lys Tyr Lys Ile Pro Asp Arg Glu Ile Ser Asp Gly Ser Ala Leu
340 345 350
Glu Asp Leu Tyr Ser Thr Asp Ser Ile Pro Asp Pro Asp Leu Asp Asp
355 360 365
Asp Asp Ile Pro Glu Ser Phe Asp Asp Ile Glu Glu Asn Asp Glu Ile
370 375 380
Leu
385
<210> 8
<211> 420
<212> DNA
<213> KY protein nucleotide sequence (SEQ ID NO. 8)
<400> 8
atgagtttga aattagaaga tctacaaaat gaacttgaaa aggatatgct gatagatccc 60
ctcaagttgc aatcagaatc agcggatatc ccgaagattt gggctaaatg gcttcgatac 120
cattcaaacg ctaagaaaaa attgatccaa cttcatgcga aaaaagaagc tgatgtgaag 180
gatcgtatgt tgtactacac cggaaggcat gacaaagaaa tgtgcgaagt ggtgtatact 240
gggactactg aaattaaaat cgcgatcgct ggggatccga aaattgtaga aaccaacaag 300
ctgatccagt attatgacat ggtggtagat ttcaccagca aagcactgga tatcgtcaaa 360
aacaaaggat actctatcaa aaacatgtta gagatccgta aattagaaag tggtgcataa 420
<210> 9
<211> 139
<212> PRT
<213> KY protein amino acid sequence (SEQ ID NO. 9)
<400> 9
Met Ser Leu Lys Leu Glu Asp Leu Gln Asn Glu Leu Glu Lys Asp Met
1 5 10 15
Leu Ile Asp Pro Leu Lys Leu Gln Ser Glu Ser Ala Asp Ile Pro Lys
20 25 30
Ile Trp Ala Lys Trp Leu Arg Tyr His Ser Asn Ala Lys Lys Lys Leu
35 40 45
Ile Gln Leu His Ala Lys Lys Glu Ala Asp Val Lys Asp Arg Met Leu
50 55 60
Tyr Tyr Thr Gly Arg His Asp Lys Glu Met Cys Glu Val Val Tyr Thr
65 70 75 80
Gly Thr Thr Glu Ile Lys Ile Ala Ile Ala Gly Asp Pro Lys Ile Val
85 90 95
Glu Thr Asn Lys Leu Ile Gln Tyr Tyr Asp Met Val Val Asp Phe Thr
100 105 110
Ser Lys Ala Leu Asp Ile Val Lys Asn Lys Gly Tyr Ser Ile Lys Asn
115 120 125
Met Leu Glu Ile Arg Lys Leu Glu Ser Gly Ala
130 135

Claims (6)

1. The kit for detecting rotavirus is characterized by comprising a nucleic acid extraction reagent, a isothermal amplification reaction module, a positive control, a negative control, a probe, a target sequence and a primer pair, wherein the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO.2, the nucleotide sequence of the primer pair is shown as SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of the target is shown as SEQ ID NO. 5; the isothermal amplification reaction module is a freeze-dried powder reagent of RDA isothermal amplification reaction mixed reagent; the freeze-dried powder reagent of the RDA isothermal amplification reaction mixed reagent comprises recombinase KX with a nucleotide sequence shown as SEQ ID NO.6 and auxiliary protein KY with an amino acid sequence shown as SEQ ID NO. 9.
2. The kit for detecting rotavirus of claim 1 wherein the probe is 5'-FAM-CAACC [ THF ] CAGCTCTTGAGAATATGGGAATAG-BHQ1-3' or 5'-GAAGCTGCAGTTGTAGCTGCAACCTCAGC [ FAM-d T ] C [ THF ] [ BHQ1-dT ] GAGAATATGGGAATAG [ C3-spacer ] -3'.
3. The rotavirus detection kit as claimed in claim 1, wherein the freeze-dried powder reagent of the RDA isothermal amplification reaction mixed reagent comprises recombinant enzyme KX 60-600 ng/. Mu. L, KY protein 16-192 ng/. Mu.L, single-stranded binding protein gp32100-1000 ng/. Mu.L, strand displacement DNA polymerase 3-100 ng/. Mu.L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, reverse transcriptase 200-U, tris buffer 20-100mM, PEG2.5% -10%, potassium acetate or sodium acetate 0-150mM, dATP 1-5mM, dNTPs 150-600nM, DTT 1-12mM, probe 150nM-600nM, and primer pair 150-600nM.
4. The kit for detecting rotavirus according to claim 1, wherein the nucleic acid extraction reagent is Buffer a or Buffer b; the BufferA is sample lysate and comprises a Tris-HCL buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton; the BufferB is a Tris buffer system, potassium chloride and magnesium chloride; the positive control is a plasmid containing rotavirus target genes, and the negative control is an empty vector pUC57 plasmid.
5. Use of the kit according to claim 4 for the preparation of a product for detecting rotavirus comprising the steps of:
extracting nucleic acid of a sample to be detected, carrying out real-time fluorescence RDA reaction in the presence of a rotavirus primer pair, a probe, an RDA freeze-dried powder reagent, buffer A and Buffer B by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2; wherein the reaction temperature is 25-42 ℃ and the reaction time is more than 10 minutes.
6. The use of the kit according to claim 5 for the preparation of a rotavirus product, wherein the reaction temperature is 39 ℃ and the reaction time is 30 minutes.
CN202010081193.3A 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting rotavirus Active CN112301155B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010081193.3A CN112301155B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting rotavirus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010081193.3A CN112301155B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting rotavirus

Publications (2)

Publication Number Publication Date
CN112301155A CN112301155A (en) 2021-02-02
CN112301155B true CN112301155B (en) 2023-10-20

Family

ID=74336368

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010081193.3A Active CN112301155B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting rotavirus

Country Status (1)

Country Link
CN (1) CN112301155B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101660001A (en) * 2008-08-27 2010-03-03 中山大学达安基因股份有限公司 Reagent kit for detecting rotavirus nucleic acid
CN107502681A (en) * 2017-10-12 2017-12-22 中华人民共和国南通出入境检验检疫局 A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus
CN110305987A (en) * 2019-08-06 2019-10-08 张鹏 Detect the kit of norovirus I type, norovirus II type and rotavirus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101660001A (en) * 2008-08-27 2010-03-03 中山大学达安基因股份有限公司 Reagent kit for detecting rotavirus nucleic acid
CN107502681A (en) * 2017-10-12 2017-12-22 中华人民共和国南通出入境检验检疫局 A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus
CN110305987A (en) * 2019-08-06 2019-10-08 张鹏 Detect the kit of norovirus I type, norovirus II type and rotavirus

Also Published As

Publication number Publication date
CN112301155A (en) 2021-02-02

Similar Documents

Publication Publication Date Title
CN112301154B (en) RDA method and kit for rapidly detecting respiratory syncytial virus
CN111500771B (en) Primer group and kit for detecting novel coronavirus SARS-CoV-2
CN111088404B (en) RDA method and kit for rapidly detecting coxsackievirus A16 and enterovirus 71
CN111549182B (en) Probe and kit for detecting SARS-CoV-2
CN111057783B (en) Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme constant-temperature rapid amplification technology and application thereof
CN111187855B (en) RDA method and kit for rapidly detecting Feline Herpesvirus (FHV)
CN111118219B (en) RDA method and kit for rapidly detecting influenza A virus
CN113046475B (en) Primer composition and kit for rapidly detecting mutant novel coronavirus
CN110527730B (en) Echinococcus shikoensis detection kit based on RPA technology and application thereof
CN111154739B (en) Novel recombinase-dependent amplification method and kit
CN112301159B (en) RDA method and kit for rapidly detecting influenza B virus
CN112301152B (en) Multiplex fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus
CN112301157B (en) RDA method and kit for rapidly detecting cat parvovirus (FPV)
CN112301156B (en) RDA method and kit for rapidly detecting human adenovirus
CN113718045A (en) DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application
CN112301153B (en) RDA method and kit for rapidly detecting Canine Coronavirus (CCV)
CN112301155B (en) RDA method and kit for rapidly detecting rotavirus
CN112301105B (en) RDA method and kit for rapidly detecting neisseria gonorrhoeae
CN112301151B (en) RDA method and kit for rapidly detecting Canine Distemper Virus (CDV)
CN112301104B (en) RDA method and kit for rapidly detecting chlamydia trachomatis
CN112301137B (en) RDA method and kit for rapidly detecting ureaplasma urealyticum
CN112301158B (en) RDA method and kit for rapidly detecting Classical Swine Fever Virus (CSFV)
CN111334613B (en) RPA primer pair, probe, kit and detection method for detecting canine adenovirus
CN114015809A (en) ERA method, composition and kit for rapidly detecting GI group norovirus
CN112795701A (en) Primer probe set, kit and detection method for multiple detection of norovirus and rotavirus based on fluorescent RMA method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant