CN111118219B

CN111118219B - RDA method and kit for rapidly detecting influenza A virus

Info

Publication number: CN111118219B
Application number: CN202010081189.7A
Authority: CN
Inventors: 刘华勇; 谢婵芳; 季宇; 陈翀
Original assignee: Guangzhou Pushi Lihua Technology Co ltd
Current assignee: Guangzhou Pushi Lihua Technology Co ltd
Priority date: 2020-02-06
Filing date: 2020-02-06
Publication date: 2023-07-25
Anticipated expiration: 2040-02-06
Also published as: CN111118219A

Abstract

The invention discloses an RDA method and a kit for rapidly detecting influenza A virus, which comprise a specific primer group and an RDA fluorescent labeling probe so as to realize safe, specific, sensitive and simple detection of influenza A virus (FluA), thereby overcoming the defects of the traditional detection technology. The kit provided by the method can omit the nucleic acid extraction step, realizes the detection of the influenza A virus within 20min at the constant temperature of 37-42 ℃, has the specificity of 100 percent, and is very suitable for on-site rapid detection. Compared with the common PCR method, the RDA fluorescence method is to react at constant temperature without changing temperature or complex instrument, and has short reaction time. Therefore, the method and the kit thereof have the characteristics of simple and quick operation, good specificity, high sensitivity, low cost and the like, provide an effective technical means for on-site quick detection and screening of influenza A virus, and have wide application prospects.

Description

RDA method and kit for rapidly detecting influenza A virus

Technical Field

The invention belongs to the technical field of molecular biology. More particularly, the invention relates to a primer, a probe and a related kit for detecting influenza A virus nucleic acid based on RDA fluorescence detection technology.

Background

Influenza viruses (influenza viruses), which belong to the orthomyxoviridae family, are the single-stranded RNA membrane viruses, and are the most common respiratory viruses, and are classified into three types, a (a), B (B), and C (C). Influenza a and b, the most common influenza virus types, are pandemic almost once every year, with influenza a being the most susceptible to mutation, highly pathogenic to humans, and once more causing a worldwide pandemic. Influenza a virus structure can be divided into three parts, namely an envelope, a matrix protein and a core from outside to inside, the outer membrane of the particle has two types of surface glycoproteins, one type is hemagglutinin (H) and 17 subtypes (H1-H17), one type is neuraminidase (N) and 10 subtypes (N1-N10), wherein only H1N1, H2N2 and H3N2 mainly infect humans. The acute respiratory infectious disease caused by the influenza A virus has the characteristics of sudden burst, rapid spread and wide spread, the main symptoms after infection are high fever, cough, nasal discharge, myalgia and the like, most of the acute respiratory infectious disease is accompanied by severe pneumonia, and the serious patients suffer from death due to various organ failure such as heart, kidney and the like, so that the death rate is high, and the pneumonia is the most common complication. It is transmitted mainly by air droplets generated by coughing and sneezing, or indirectly transmitted and closely transmitted by virus-contaminated tea sets, tableware, towels and the like.

The early symptoms of influenza A infection are similar to common cold, and patients often choose a basic community diagnosis and treatment institution to diagnose. The community can clinically have a certain window period by using an antigen-antibody-based detection means, and the window period can be effectively shortened and the detection sensitivity can be improved by using a nucleic acid amplification means to detect the influenza B. Most of the conventional influenza nucleic acid detection methods are based on PCR, and the detection needs to rely on a PCR instrument or an expensive real-time quantitative PCR instrument, and multiple operation processes including virus splitting, virus RNA extraction and molecular detection are needed, and the whole process is usually concentrated in a laboratory, and requires precise instruments and skilled operators. However, these conditions are often difficult to obtain in the basic community diagnosis and treatment institution, which seriously hampers the rapid qualitative detection of influenza. There is still a lack of simple inexpensive high-automation influenza a detection kits suitable for basic level testing.

With the silent rise of in vitro isothermal amplification of nucleic acids, limitations of conventional amplification techniques have changed, and in the last decade, isothermal nucleic acid amplification techniques, such as LAMP (loop-mediated nucleic acid amplification technique), HDA (helicase-dependent isothermal nucleic acid amplification technique) and the like, have been rapidly developed to amplify nucleic acid molecules under isothermal conditions. The techniques can achieve efficient nucleic acid amplification by only maintaining a constant reaction temperature with a temperature control device, thereby eliminating the dependence on a PCR instrument for precisely controlling temperature changes. If nucleic acid amplification can be realized under normal temperature conditions, the nucleic acid amplification technology is further simplified, and the application of the technology in a wider range is facilitated.

Disclosure of Invention

The invention aims to overcome the defects and the shortcomings of the existing influenza A virus detection technology. The research shows that the kit for detecting the influenza A virus (FluA) by adopting the RDA fluorescence method realizes the rapid detection of the influenza A virus, and only needs 20-30min from sample treatment to result completion in the whole process of detecting the FluA, thereby greatly shortening the conventional detection time and improving the detection efficiency.

The invention aims to provide probes and primers for detecting influenza A virus after optimization.

The nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Preferably, two schemes are used to design the RDA fluorescent-labeled probe, the first scheme being: the conserved sequence of 25-35bp is selected as a probe sequence, a luminous group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF). The second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. Through series experimental comparison, the two probe designs are suitable for RDA fluorescence detection methods, and have no obvious difference in detection sensitivity and specificity.

The probe with the nucleotide sequence of SEQ ID NO.1 is characterized in that a luminous group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), wherein the specific information is as follows:

FluA-P1（SEQ ID NO .1）：

5’- FAM-GCGAG[THF]ACTGCAGCGTAGACGCTTTGTCCA-BHQ1 -3′

the nucleotide sequence of the probe is SEQ ID NO. 2, the 35 th base T of the 5 'end of the probe marks FAM or other luminescent groups, the 38 th base is replaced by tetrahydrofuran residue (THF), the 40 th base marks BHQ1 or other quenching groups, and the 3' end of the probe is subjected to C3-spacer blocking modification, wherein the specific information is as follows:

FluA-P2（SEQ ID NO .2）：

5’-GTRTTCACGCTCACCGTGCCCAGTGAGCGAGGAC[dT-FAM]GC[THF]G[dC-BHQ]GTAGACGCTTTGTCCA[C3-spacer]-3’

the nucleotide sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4, the target sequence is shown as SEQ ID NO.5, and the specific information is as follows:

FluA-F1（SEQ ID NO .3）： 5’-TGGCTAAAGACAAGACCAATCCTGTCACC -3’；

FluA-R1（SEQ ID NO .4）： 5’-TGCRACYTCYTTAGCCCCATGGAATG -3’。

another object of the present invention is to provide a kit for detecting influenza a virus based on isothermal amplification technology.

The kit comprises a nucleic acid extraction reagent, a isothermal amplification reaction module, positive control and negative control, and the probe and the primer.

Preferably, the isothermal amplification reaction module is a freeze-dried powder reagent of isothermal amplification reaction mixed reagent.

Preferably, the isothermal amplification reaction mixture is an RPA or Recombinase-dependent amplification technique (RDA) isothermal amplification reaction mixture.

It is another object of the present invention to provide a kit for detecting influenza A virus based on the Recombinase-dependent amplification technique (RDA).

The Recombinase-dependent amplification technique (Recombinase-dependent amplification, RDA) is realized by the following technical scheme:

according to the invention, a biological informatics method is utilized to carry out analysis simulation and high-throughput virtual screening on a batch of protein structures, and a large number of biological experiments prove that a new recombinase combination with high stability is finally found. Specifically, the invention develops a novel recombinase composition which is a recombinase KX and an auxiliary protein KY, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, the amino acid sequence of the recombinase KX is shown as SEQ ID NO.7, the nucleotide sequence of the auxiliary protein KY is shown as SEQ ID NO.8, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 9.

The recombinase KX can be used for replacing the recombinase UvsX or RecA in the RPA reaction, and the KY protein can be used for replacing the UvsY protein in the RPA reaction.

The sequence homology of the recombinase KX with the T4UvsX protein is 50% (201/395). Based on the recombinase combination, the team develops a novel detection method and detection system of a recombinase-dependent amplification (RDA) technology with high stability and high specificity. The preparation process of the recombinase KX is simple, the yield and the stability are greatly improved, and the mass production cost is low. And the amplification technology based on the recombinase combination development has the advantages of short required primer (18-30 bp), low requirement on the length of a target sequence and wide applicability. Furthermore, the technology has good detection specificity and high sensitivity on the nucleic acid target sequence, can realize high-sensitivity and high-precision rapid molecular detection under the constant temperature condition of 25-42 ℃, has low detection cost, is convenient and quick to operate, and has wide application prospect.

The recombinant enzyme KX and protein KY are derived from Escherichia phage phT A phage, escherichia phage phT A belongs to the genus Slopekvirus in the subfamily of Tevenvirinae belonging to the family Myoviridae.

The recombinant enzymes KX and protein KY can realize a large amount of soluble expression in escherichia coli.

In particular as an alternative, the preparation method comprises the following steps:

s1, introducing a target gene expression fragment into an expression vector to obtain a recombinant expression vector;

s2, transferring the recombinant expression vector into an expression bacterium to obtain a recombinant engineering bacterium;

s3, carrying out induction culture on the recombinant engineering bacteria, enriching the engineering bacteria, carrying out ultrasonic crushing, and centrifuging to obtain unpurified recombinant enzyme;

s4, purifying the unpurified recombinase through chromatography to obtain the recombinase KX. The purified recombinant enzyme KX does not have the phenomenon of coagulation or precipitation at low temperature.

The target gene expression fragment in the step S1 contains a nucleic acid sequence shown as SEQ ID NO.6, the 5 'end of the target gene expression fragment is provided with a BamHI enzyme cutting site adhesive end, and the 3' end of the target gene expression fragment is provided with a Sall enzyme cutting site adhesive end.

Preferably, the expression vector in step S1 is a pET-28a vector.

Preferably, the expressing bacterium in step S2 is escherichia coli.

The preparation process is simple, the yield and the stability are greatly improved, and the mass production cost is low.

Preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: recombinant enzymes KX, KY protein, gp32 protein, strand displacement DNA polymerase, reverse transcriptase, exonuclease, creatine kinase, creatine phosphate, tris-buffer, potassium acetate or sodium acetate, PEG20000 or PEG35000, DTT, dNTPs, dATP, probes, primer pairs, magnesium acetate. Preferably, the reaction system further comprises a detection template, such as a sample DNA or RNA to be detected.

Preferably, the reaction conditions of the reaction system are 25-42 ℃ for 10-60min.

More preferably, the reaction conditions of the reaction system are 39 ℃ for 30min.

The reaction principle of the recombinase-dependent amplification (RDA) reaction system is as follows: (1) reverse transcription of RNA into DNA; (2) A recombinase-primer complex formed by combining recombinase with a specific primer of 18-30bp, and searching a target site in the double-stranded DNA template; (3) After the recombinase-primer complex recognizes the template specific sequence, localization occurs and strand exchange is initiated, and the single-stranded binding protein is then bound to the D-Loop structure formed by the displaced DNA strand; (4) The dATP conformation in a recombinase-primer complex hydrolysis system is changed, the 3 'end of a primer is exposed after the recombinase is dissociated and is recognized by DNA polymerase, and the DNA polymerase starts DNA synthesis at the 3' end of the primer according to a template sequence; (5) The DNA polymerase has a strand displacement function, and the double-helix DNA structure of the template is continuously unwound while the primer is extended, and the DNA synthesis process is continuously carried out; (6) The two primers are amplified to form a complete amplicon; (7) In the reaction system, dATP is hydrolyzed into recombinase to be changed into dATP, and phosphocreatine can transfer the phosphate group of the phosphocreatine into dATP molecules under the catalysis of creatine kinase to form dATP, so that the level of the dATP in the reaction system is recovered. The above process is repeated continuously, and finally, the efficient amplification of the nucleic acid is realized.

A kit for detecting influenza A virus (FluA) based on a recombinase-dependent amplification technology (RDA) is constructed based on the reaction system and comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, a positive control and a negative control, and the probe and the primer.

Preferably, the RDA isothermal amplification reaction module is freeze-dried powder of RDA isothermal amplification reaction mixed reagent.

Preferably, the RDA isothermal amplification reaction module comprises recombinase KX60-600 ng/mu L, KY protein 16-192 ng/mu L, single-stranded binding protein gp32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, reverse transcriptase 200-U, tris buffer 20-100mM, PEG2.5% -10%, potassium acetate or sodium acetate 0-150mM, dATP1-5mM, dNTPs150-600nM each, DTT1-12mM, probe 150nM-600nM, and primer pair 150-600nM.

Preferably, the Tris-buffer is Tris-tricine.

Preferably, the concentration of Tris-tricine is 100mM.

The nucleic acid extraction reagent comprises Buffer A and Buffer B. Buffer A is sample lysate and contains Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton; buffer B contains Tris Buffer system, potassium chloride and magnesium chloride; the positive control was a target gene plasmid containing influenza a virus (FluA), and the negative control was an empty vector pUC57 plasmid.

It is still another object of the present invention to provide a method for detecting influenza a virus based on a recombinase-dependent amplification technique.

The detection method comprises the following steps: extracting nucleic acid of a sample to be detected, carrying out real-time fluorescence RDA reaction in the presence of a primer pair, a probe and RDA freeze-dried powder reagent of influenza A virus, buffer A and Buffer B by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; the nucleotide sequence of the probe is shown as SEQ ID NO.1 or SEQ ID NO. 2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 10 minutes.

Preferably, the method comprises the following steps:

1) Sample processing

Shaking and mixing 20 mu L of Buffer A and 5 mu L of positive control/negative control/sample to be detected uniformly, and standing at room temperature for 10-15min;

2) System preparation and detection

Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the temperature is 39 ℃ for 1 minute, 30 cycles are carried out, fluorescent signals are collected, and detection is completed within 30 minutes;

3) Result determination

The result is interpreted based on the Time (Tt) at which the fluorescence value generated by the reaction system reaches the Threshold value.

(1) Positive control: typical amplification curves appear, tt values <25min, as effective results;

(2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, which is an effective result;

(3) the sample to be tested:

a. if Tt value is less than 25min, judging positive;

b. if the Tt value is more than or equal to 30min, judging negative;

c. if the Tt value is less than or equal to 25 minutes and less than or equal to 30 minutes, judging the Tt value to be suspicious, and repeating detection to confirm; the detection result is still that the Tt value is less than or equal to 25min and less than 30min, the negative control Tt value should be referred to, and if the negative control Tt value is more than or equal to 30min, the detection result is positive.

The invention has the following beneficial effects:

1. the kit provided by the invention is used for detecting the RNA of the influenza A virus in a nasopharyngeal swab, a nasal cavity flushing liquid or a suction sample, has the characteristics of simplicity in operation, rapidness and sensitivity, provides an effective technical means for on-site rapid detection and screening of the influenza A virus, and has important significance in clinical detection of the influenza A virus.

2. The kit provided by the invention adopts an RDA isothermal amplification detection method, can realize effective amplification of target genes at 37-42 ℃, does not need temperature change, and does not need complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 10 copies/. Mu.l.

3. In the RDA method, the recombinase KX protein and KY protein have high specificity to the target sequence in the amplification process, and only the primer sequence and the template sequence are completely complementary to start the amplification, so that the specificity of the amplification is greatly improved, and the high-efficiency constant-temperature nucleic acid amplification without background is realized.

Drawings

FIG. 1 is a graph showing the results of ATP hydrolysis activities of 4 proteins in the recombinase screening of example 1 of the present invention.

FIG. 2 is an agarose gel diagram of a isothermal amplification reaction of 4 proteins in the recombinase screen of example 1 of the invention.

FIG. 3 is a three-dimensional structure of KX protein in example 1 of the present invention.

FIG. 4 is a three-dimensional block diagram of the KY protein heptamer in example 1 of the present invention.

FIG. 5 is a graph showing the results of the RDA fluorescence assay kit according to example 1 of the present invention.

FIG. 6 is a graph showing the sensitivity test results of the RDA fluorescence assay kit according to example 2 of the present invention.

FIG. 7 is a graph showing the results of the specific test of the RDA fluorescence assay kit according to example 3 of the present invention.

FIG. 8 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.

FIG. 9 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.

FIG. 10 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.

FIG. 11 is a graph showing the results of a 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. It will be apparent to those skilled in the art that various changes, modifications, substitutions, combinations, and simplifications can be made without departing from the spirit and principles of the invention and these are intended to be equivalent arrangements.

Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art. Reagents and materials used in the following examples are commercially available unless otherwise specified.

Unless otherwise indicated, the immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA, etc., employed by this invention are within the skill of the art. See Sambrook (Sambrook), friech (Fritsch) and manitis (Maniatis), molecular cloning: laboratory Manual (MOLEC. Mu.M LAR CLONING: A LABORATORY MANUAL), edit 2 (1989); current protocols of molecular BIOLOGY laboratory Manual (CURRENT PROTOCOLS IN MOLEC μm LAR BIOLOGY) (F.M. Ausubel et al, F.M; ausubel et al, (1987)); series (academic publishing company) of methods in enzymology (METHODS IN ENZYMOLOGY): PCR2 practical methods (PCR 2:A PRARVICAL APPROACH) (M.J. MaxFrson (M.J. MacPherson), B.D. Black (B.D. Hames) and G.R. Taylor (G.R. Taylor) editions (1995)), harlow and Lane editions (1988) antibodies: laboratory Manual (ANTIBODIES, A LABORATORY MANUAL), animal cell culture (ANIMAL CELL C. Mu.M LTURE) (R.I. Fu Lei Xieni (R.I. Freshney) eds. (1987)).

Example 1 establishment of a method for detecting influenza A Virus (FluA) RDA fluorescence assay kit

(1) Acquisition of recombinant enzyme KX and KY proteins

The reported recombinase UvsX has poor stability, is difficult to produce in mass production and store for a long time, and in order to solve the problem, the research and development team finally finds a new recombinase KX and auxiliary protein KY thereof by analyzing and simulating a large quantity of protein structures by using a bioinformatics method.

In this embodiment, the research and development team maps the information of key functional sites in the recombinase structure, such as DNA binding sites, ATP hydrolysis sites, etc., to the three-dimensional protein structure to obtain the information of secondary structure and information of tertiary structure, and constructs a data model for screening the recombinase protein structure by integrating the functional residues, the secondary structure features and the space distance of tertiary structure of the primary structure sequence. Through searching templates matched with the recombinase protein in the primary structure from SwissProt, PDB data, 312 protein sequences are primarily screened out, secondary structure and tertiary structure comparison are respectively carried out, similarity scores are calculated, ranking is carried out according to the similarity scores, and 15 proteins suspected to have the recombinase activity are simulated and screened out.

The 15 proteins are respectively constructed into recombinant protein expression vectors, and after being respectively expressed and purified, the ability of the recombinant protein expression vectors to hydrolyze ATP is detected, wherein 4 proteins have ATP hydrolysis activity and are KX, X-1, X-2 and X-3 proteins respectively. In the experiment, firefly luciferase ATP bioluminescence detection kit is used, and the experiment is carried out strictly according to the operation of the specification, and the result is shown in FIG. 1.

The method comprises the steps of preparing 4 proteins with ATP hydrolytic activity into a constant-temperature amplification system for amplification reaction, wherein the result is shown in figure 2, N is a negative control, P is a positive control amplified by adding T4UvsX, and 1-4 proteins are KX, X-1, X-2 and X-3 respectively, wherein only KX protein has amplification activity. The KX protein is derived from Escherichia phage phT A phage, and the three-dimensional structure diagram is shown in FIG. 3.

In the same way we screened the helper protein KY derived from the Escherichia phage phT a phage for the recombinase KX, the three-dimensional structure of which is shown in figure 4. Wherein the auxiliary protein KY needs to play an active role in the form of heptamers.

Finally obtaining the recombinase KX for RDA amplification, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 7; the nucleotide sequence of the recombinase KY is shown as SEQ ID NO.8, and the amino acid sequence is shown as SEQ ID NO. 9.

(2) Influenza A virus detection primer and probe design and screening

The full gene sequence of influenza A virus was searched by NCBI (www.ncbi.nlm.nih.gov), homology alignment and sequence analysis were performed using Clone manager software and BLAST, and sequences conserved within the species of the pathogen, and interspecies variation were selected as target regions. After the whole genome sequence comparison and homology analysis of various influenza A viruses, finally, a conserved M2 gene is selected as a target gene (reference sequence GenBank accession number: CY 202883.1), and RDA detection primers and probe design are carried out on the target fragment. The DNA plasmid, primer and probe sequence of target gene are synthesized by Shanghai JieRui bioengineering Co.Ltd. The highly conserved sequences of the M2 gene of the influenza A virus are screened as follows:

SEQ ID NO .5：

CAAAGCCGAGATCGCGCAGAGACTTGAAGATGTGTTTGCAGGGAAGAACACCGATCTTGAGGCACTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTTAATGGGAATGGGGATCCAAACAACATGGACAGAGCGGTCAAACTGTACAGGAAGCTTAAAAGGGAGATAACATTCCATGGGGCAAAAGAAGTGGCACTCAGTTATTCTACTGGTGCACTTGCCAGTTGCAT

in the embodiment, the design is carried out by adopting the RDA technology primer design principle, the lengths of the upstream primer and the downstream primer are 18-30bp, 3 primers are respectively designed according to the conserved sequence of the M2 gene of the influenza A virus, and the sequences of the primers are as follows:

the upstream primer FluA-F1: 5'-TGGCTAAAGACAAGACCAATCCTGTCACC-3'

The upstream primer FluA-F2:5 '-GATTTGTRTTCACGCTCACCGTGCCC-3'

Upstream primer FluA-F3: 5'-GACCAATCTTGTCACCTTTGACTAAGGG-3'

Downstream primer FluA-R1:5 '-TGCRACYTCYTTAGCCCCATGGAATG-3'

Downstream primer FluA-R2: 5 '-GCTTCCTGTACAGTTTGACYGCTC-3'

Downstream primer FluA-R3:5 '-TTGTATATGAGRCCCATGCARCTG-3'

The 3 pairs of primers were paired pairwise to form 9 combinations for optimal primer combination screening.

Combination 1: fluA-F1 and FluA-R1; combination 2: fluA-F1 and FluA-R2 combination 3: fluA-F1 and FluA-R3

Combination 4: fluA-F2 and FluA-R1; combination 5: fluA-F2 and FluA-R2 combination 6: fluA-F2 and FluA-R3

Combination 7: fluA-F3 and FluA-R1; combination 8: fluA-F3 and FluA-R2 combination 9: fluA-F3 and FluA-R3

Through a series of experimental screens and evaluations, combination 1 (FluA-F1 and FluA-R1) was determined as the optimal primer set, specifically:

FluA-F1（SEQ ID NO .3）： 5’-TGGCTAAAGACAAGACCAATCCTGTCACC -3’；

FluA-R1（SEQ ID NO .4）： 5’-TGCRACYTCYTTAGCCCCATGGAATG -3’。

in the RDA fluorescence detection technique, two schemes are used to design the RDA fluorescence labeling probe, the first scheme is as follows: the target region is selected to be a 25-35bp conserved sequence, a 5 '-end is marked with a luminescent group, a 3' -end is marked with a quenching group, any position of 5-10 bases is replaced by tetrahydrofuran residue (THF), the nucleotide sequence in the embodiment is a probe of SEQ ID NO.1, the 5 '-end is marked with the luminescent group, the 3' -end is marked with the quenching group, any position of 5-position bases is replaced by tetrahydrofuran residue (THF), and the specific information is as follows:

FluA-P1（SEQ ID NO .1）：

5’- FAM-GCGAG[THF]ACTGCAGCGTAGACGCTTTGTCCA-BHQ1-3′

the second scheme is as follows: the probe length is 46-52 nucleotides, of which at least 30 are located at the 5 'end of the THF site and at least 15 are located at the 3' end. In the probe with the nucleotide sequence of SEQ ID NO. 2, the 35 th base T of the 5 'end marks FAM or other luminescent groups, the 38 th base is replaced by tetrahydrofuran residue (THF), the 40 th base marks BHQ1 or other quenching groups, and the 3' end carries out C3-spacer blocking modification, which has the following specific information:

FluA-P2（SEQ ID NO .2）：

through series experimental comparison, the two probe designs are both suitable for RDA fluorescence detection methods, and have NO obvious difference in detection sensitivity and specificity, wherein the target conserved sequence required by the first probe design is shorter, the requirement on the nucleic acid sequence is low, and in the subsequent examples of the patent, the first probe FluA-P1 (SEQ ID NO. 1) is used as a detection probe to prepare an RDA isothermal amplification reaction system.

(3) Establishment of influenza A virus (FluA) RDA detection method

The patent constructs a kit for detecting influenza A virus (FluA) based on a recombinase dependent amplification technology (RDA), which comprises a nucleic acid extraction reagent, an RDA isothermal amplification reaction module, a positive control and a negative control, wherein the nucleic acid extraction reagent comprises Buffer A and Buffer B, the Buffer A is sample lysate and contains a Tris-HCL Buffer system, naOH, SDS, EDTA, guanidine isothiocyanate, tween80 and triton, and the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; optimal allocation ratio of a reaction system in the RDA isothermal amplification reaction module is shown in table 1, and the optimal allocation ratio comprises the fluorescent labeled probe and the primer; the positive control was a target gene plasmid containing influenza a virus (FluA), and the negative control was an empty vector pUC57 plasmid.

TABLE 1 RDA isothermal amplification reaction module reaction system ratios

Sequence number	Component (A)	Concentration of content
			1	Tris-tricine（PH 7.9）	100mM
2	Potassium acetate	50mM
			3	PEG20000 or PEG35000	5%
4	DTT	2mM
			5	dNTPs	200nM each
6	dATP	2mM
			7	Reverse transcriptase	200U
8	Creatine kinase (Creatine kinase)	0.2mg/ml
			9	Creatine phosphate (Creatine phosphate)	50mM
10	Strand-displacing DNA polymerase	50ng/ul
			11	gp32 protein	300 ng/ul
12	Recombinant enzyme KX	120 ng/ul
			13	Helper protein KY	60ng/ul
14	Exonuclease	50U
			15	Upstream primer	500nM
16	Downstream primer	500nM
			17	Fluorescent-labeled probe	300nM
18	Magnesium acetate	14mM

The reaction conditions of the reaction system are as follows: reacting at 25-42 deg.C for 10-60min.

The optimal reaction conditions are as follows: the reaction was carried out at 37℃for 30min.

In this example, the collected 4 cases were tested by fluorescent quantitative PCR to verify that they were all nasopharyngeal swab/nasal wash samples positive for influenza A virus RNA, using the RDA fluorescence detection kit of this patent.

The specific operation is as follows:

step one, sample processing. Shaking and mixing 20 mu L of Buffer A and 5 mu L of positive control/negative control/sample to be detected uniformly, and standing at room temperature for 10-15min;

and step two, preparing and detecting the system. Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: the fluorescent signal is collected at 39 ℃ for 1 minute and 30 cycles, and the detection can be completed within 30 minutes;

and step three, judging the result.

(3) the sample to be tested:

a. if Tt value is less than 25min, judging positive;

b. if the Tt value is more than or equal to 30min, judging negative;

The detection results are shown in table 2 and fig. 5, and the positive control and the negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25min, and is the content of effective result', and Tt value of each sample is less than 25min, and positive is judged.

The results show that the detection method of the RDA fluorescence detection kit established in the embodiment can detect influenza A virus RNA in nasopharyngeal swab/nasal wash or aspirate.

Table 2 establishment of the method for detecting the kit

Negative control

Positive control

Sample 1

Sample 2

Sample 3

Sample 4

Tt value

-

09:58

11:53

09:56

10:09

09:54

Example 2 RDA fluorescence detection reagent sensitivity test

The positive control was pUC57-M1 plasmid containing the M1 gene of influenza A virus (FluA), and the negative control was pUC57 plasmid as empty vector.

The specific operation is as follows:

firstly, diluting positive control plasmids to 10-4 c, and then diluting the positive control plasmids by 10-time gradient to 10-3 c, 10-2 c and 10-1 c respectively.

And step two, sample processing. Taking 5 mu L of plasmids with each concentration in the step one into an EP tube, simultaneously taking 5 mu L of negative control into another EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;

and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39 ℃ for 1 minute, 30 cycles, where fluorescent signals were collected;

and step four, judging the result. Determination criteria:

(3) the sample to be tested:

a. if Tt value is less than 25min, judging positive;

b. if the Tt value is more than or equal to 30min, judging negative;

The results are shown in Table 3 and FIG. 6. The negative control Tt value has no amplification curve, and accords with the content that the amplification curve does not appear in the judging standard, or the Tt value is more than or equal to 25 min. 10-4 c, 10-3 c, 10-2 c, 10-1 c have Tt values of <25min, and according to the result determination criteria, 10-4 c, 10-3 c, 10-2 c, 10-1 c are positive.

That is, the sensitivity of the RDA fluorescence detection kit reaches 10 copies.

TABLE 3 sensitivity test results

	Negative control	10^4	10^3	10^2	10^1
						Tt value	-	10:14	12:17	12:48	14:00

Example 3 RDA fluorescence assay reagent specificity test

3 samples of 3 influenza A viruses (Influenza A virus, fluA), 1 influenza B viruses (Influenza B virus, fluB) and 1 respiratory syncytial viruses (RespiratorySycytial Virus, RSV) were collected clinically, and 5 samples were tested for specificity by fluorescent quantitative PCR as positive for the corresponding viruses.

The specific operation is as follows:

step one, sample processing. Taking 5 mu L of each positive sample in an EP tube, simultaneously taking 5 mu L of each positive control and negative control of the kit in a new EP tube, respectively adding 20 mu L of Buffer A, shaking and mixing uniformly, and standing at room temperature for 10-15min;

and thirdly, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39. 1 min at C, 30 cycles, where fluorescent signals were collected;

and step four, judging the result. Determination criteria:

(3) the sample to be tested:

a. if Tt value is less than 25min, judging positive;

b. if the Tt value is more than or equal to 30min, judging negative;

The results are shown in Table 4 and FIG. 7. Positive control and negative control match "(1) positive control: typical amplification curves appear, tt values <25min, as effective results; (2) negative control: no amplification curve appears, or Tt value is more than or equal to 25mn, which is the content of effective result. Tt values of the FluA samples are smaller than 25min, and positive results are judged; the Tt values of FluB and RSV were determined to be negative, with no signal detected.

That is, RDA fluorescence detects positive only when the target pathogen is influenza a virus and negative for other viruses.

TABLE 4 specificity test results

Sample name	Tt value	Sample name	Tt value
				Negative control	-	FluA-3	12:17
Positive control	09:40	FluB	-
				FluA-1	10:14	RSV	-
FluA-2	10:11

Example 4 stability test of RDA fluorescence detection kit

The liquid reagent needs to be stored at low temperature and can not be repeatedly frozen and thawed. The kit is characterized in that the RDA fluorescence reaction module is dried into a powdery reagent in vacuum, the freeze-dried powdery reagent can be stored at normal temperature, the cost of cold chain transportation and low-temperature storage is saved, and the operation is simpler. The stability of the RDA fluorescence detection kit was verified in this example.

The specific operation is as follows:

eight-tube containing lyophilized reagents were sealed in aluminum foil bags containing a desiccant and stored in a 37 ℃ incubator. Two reaction tests were taken at day 0, day 30, day 90, and day 180, respectively.

Step one, sample processing. Taking 5 mu L of positive control and negative control of the kit respectively in an EP tube, adding 20 mu L of Buffer A respectively, shaking and mixing uniformly, and standing at room temperature for 10-15min;

and step two, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is: 39. 1 min at C, 30 cycles, where fluorescent signals were collected;

and step three, judging the result. Determination criteria:

(3) the sample to be tested:

a. if Tt value is less than 25min, judging positive;

b. if the Tt value is more than or equal to 30min, judging negative;

The results are shown in Table 5 and FIG. 8, FIG. 9, FIG. 10, and FIG. 11. The freeze-dried powder of the reagent of the RDA fluorescence reaction module stored for 0 day, 30 day, 90 day and 180 day is tested, each Tt value is smaller than 25min, and the detection results of the reagent in the kit in the patent after freeze-drying are positive in 0 day, 30 day, 90 day and 180 day according to the result judgment standard. The reagent in the kit can be stably stored for at least 3 months at 37 ℃ after being freeze-dried.

TABLE 5 preservation stability at 37℃

	Day 0	For 30 days	90 days	180 days
					Negative control	-	-	-	-
Positive control	09:56	10:11	10:53	11.01

Sequence listing

<110> Guangzhou Pushili Hua technology Co., ltd

<120> RDA method and kit for rapid detection of influenza A virus

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> FAM-labeled fluorescent Probe (SEQ ID NO. 1)

<400> 1

gcgaggactg cagcgtagac gctttgtcca 30

<210> 2

<211> 56

<212> DNA

<213> FAM-labeled fluorescent Probe (SEQ ID NO. 2)

<400> 2

gtrttcacgc tcaccgtgcc cagtgagcga ggactgcagc gtagacgctt tgtcca 56

<210> 3

<211> 29

<212> DNA

<213> primer sequence (SEQ ID NO. 3)

<400> 3

tggctaaaga caagaccaat cctgtcacc 29

<210> 4

<211> 26

<212> DNA

<213> primer sequence (SEQ ID NO. 4)

<400> 4

tgcracytcy ttagccccat ggaatg 26

<210> 5

<211> 216

<212> DNA

<213> target sequence (SEQ ID NO. 5)

<400> 5

tggctaaaga caagaccaat cctgtcacct ctgactaagg ggattttggg gtttgtgttc 60

acgctcaccg tgcccagtga gcgaggactg cagcgtagac gctttgtcca aaacgcccta 120

aatgggaatg gagacccaaa caacatggac agggcagtca aactgtacag aaagttgaaa 180

agagagataa cattccatgg ggctaaagaa gttgca 216

<210> 6

<211> 1158

<212> DNA

<213> recombinase KX nucleotide sequence (SEQ ID NO. 6)

<400> 6

atgtcaaaca aagcactact aaaaaaactg atcaaaaact cgaatagcca aactgcatct 60

gtactttctg aaagcgacgt attcaacaat attaccatca cgcgaacccg tgtgccgatt 120

ctgaatctgg cgttgtccgg tgcgtttaac ggtggcctaa cttctggtct tacccttttc 180

gctggcccgt ccaaacactt caaatccaac ttaggtttgc ttactgtagc ggcgtatctc 240

aaaacgtatg aagatgctgt gtgcctgttc tacgattcag aaaaaggtgt tactaaatcc 300

tatctgaaat caatgggtgt tgatccggat cgtgttgtgt atactcgtat cacgacggtc 360

gagcagttgc gtaatgacgt tgtaagccag cttaacgcgc ttgaacgcgg tgataaggtg 420

attgtattcg ttgactcagt aggcaacacg gcaagtaaaa aagaacttgc tgacgcgctt 480

tctgataacg ataaacagga tatgacgcga gcaaaagcat taaaaggtat gttccgtatg 540

gttacgcctt atctggctga cctggatatc ccgatggttt gtatctgtca tacctatgac 600

acacaagaaa tgtacagcaa gaaagttatt tctggtggta ctggtttaat gtattccgct 660

gatactgcga tcatcctggg taaacaacag gtgaaagaag gtactgaggt ggtaggttat 720

gatttcatca tgaatatcga aaaatctcga ttcgtgaaag agaaatcaaa attcccgctg 780

catgttacct atgaaggcgg tattagtatg tattctggcc ttttggatct ggcaatggaa 840

atgaactttg tacagaccgt aaccaaaggc tggcgcaacc gcgctttcct gaataccgag 900

actggcgaac tcgaagttga agaaaagaaa tggcgtgagt cagaaacaaa tagcgttgaa 960

ttctggcgtc ctctgtttac tcatcaacca ttcttgaaag ctatcgaaga aaagtataag 1020

atcccagatc gtgaaatcag tgatggttcc gcgctggaag atttatacag cactgatagc 1080

atcccagatc ctgatctgga tgatgacgat atcccagaat catttgatga tatcgaagaa 1140

aacgacgaaa ttttataa 1158

<210> 7

<211> 385

<212> PRT

<213> recombinase KX amino acid sequence (SEQ ID NO. 7)

<400> 7

Met Ser Asn Lys Ala Leu Leu Lys Lys Leu Ile Lys Asn Ser Asn Ser

1 5 10 15

Gln Thr Ala Ser Val Leu Ser Glu Ser Asp Val Phe Asn Asn Ile Thr

20 25 30

Ile Thr Arg Thr Arg Val Pro Ile Leu Asn Leu Ala Leu Ser Gly Ala

35 40 45

Phe Asn Gly Gly Leu Thr Ser Gly Leu Thr Leu Phe Ala Gly Pro Ser

50 55 60

Lys His Phe Lys Ser Asn Leu Gly Leu Leu Thr Val Ala Ala Tyr Leu

65 70 75 80

Lys Thr Tyr Glu Asp Ala Val Cys Leu Phe Tyr Asp Ser Glu Lys Gly

85 90 95

Val Thr Lys Ser Tyr Leu Lys Ser Met Gly Val Asp Pro Asp Arg Val

100 105 110

Val Tyr Thr Arg Ile Thr Thr Val Glu Gln Leu Arg Asn Asp Val Val

115 120 125

Ser Gln Leu Asn Ala Leu Glu Arg Gly Asp Lys Val Ile Val Phe Val

130 135 140

Asp Ser Val Gly Asn Thr Ala Ser Lys Lys Glu Leu Ala Asp Ala Leu

145 150 155 160

Ser Asp Asn Asp Lys Gln Asp Met Thr Arg Ala Lys Ala Leu Lys Gly

165 170 175

Met Phe Arg Met Val Thr Pro Tyr Leu Ala Asp Leu Asp Ile Pro Met

180 185 190

Val Cys Ile Cys His Thr Tyr Asp Thr Gln Glu Met Tyr Ser Lys Lys

195 200 205

Val Ile Ser Gly Gly Thr Gly Leu Met Tyr Ser Ala Asp Thr Ala Ile

210 215 220

Ile Leu Gly Lys Gln Gln Val Lys Glu Gly Thr Glu Val Val Gly Tyr

225 230 235 240

Asp Phe Ile Met Asn Ile Glu Lys Ser Arg Phe Val Lys Glu Lys Ser

245 250 255

Lys Phe Pro Leu His Val Thr Tyr Glu Gly Gly Ile Ser Met Tyr Ser

260 265 270

Gly Leu Leu Asp Leu Ala Met Glu Met Asn Phe Val Gln Thr Val Thr

275 280 285

Lys Gly Trp Arg Asn Arg Ala Phe Leu Asn Thr Glu Thr Gly Glu Leu

290 295 300

Glu Val Glu Glu Lys Lys Trp Arg Glu Ser Glu Thr Asn Ser Val Glu

305 310 315 320

Phe Trp Arg Pro Leu Phe Thr His Gln Pro Phe Leu Lys Ala Ile Glu

325 330 335

Glu Lys Tyr Lys Ile Pro Asp Arg Glu Ile Ser Asp Gly Ser Ala Leu

340 345 350

Glu Asp Leu Tyr Ser Thr Asp Ser Ile Pro Asp Pro Asp Leu Asp Asp

355 360 365

Asp Asp Ile Pro Glu Ser Phe Asp Asp Ile Glu Glu Asn Asp Glu Ile

370 375 380

Leu

385

<210> 8

<211> 420

<212> DNA

<213> KY protein nucleotide sequence (SEQ ID NO. 8)

<400> 8

atgagtttga aattagaaga tctacaaaat gaacttgaaa aggatatgct gatagatccc 60

ctcaagttgc aatcagaatc agcggatatc ccgaagattt gggctaaatg gcttcgatac 120

cattcaaacg ctaagaaaaa attgatccaa cttcatgcga aaaaagaagc tgatgtgaag 180

gatcgtatgt tgtactacac cggaaggcat gacaaagaaa tgtgcgaagt ggtgtatact 240

gggactactg aaattaaaat cgcgatcgct ggggatccga aaattgtaga aaccaacaag 300

ctgatccagt attatgacat ggtggtagat ttcaccagca aagcactgga tatcgtcaaa 360

aacaaaggat actctatcaa aaacatgtta gagatccgta aattagaaag tggtgcataa 420

<210> 9

<211> 139

<212> PRT

<213> KY protein amino acid sequence (SEQ ID NO. 9)

<400> 9

Met Ser Leu Lys Leu Glu Asp Leu Gln Asn Glu Leu Glu Lys Asp Met

1 5 10 15

Leu Ile Asp Pro Leu Lys Leu Gln Ser Glu Ser Ala Asp Ile Pro Lys

20 25 30

Ile Trp Ala Lys Trp Leu Arg Tyr His Ser Asn Ala Lys Lys Lys Leu

35 40 45

Ile Gln Leu His Ala Lys Lys Glu Ala Asp Val Lys Asp Arg Met Leu

50 55 60

Tyr Tyr Thr Gly Arg His Asp Lys Glu Met Cys Glu Val Val Tyr Thr

65 70 75 80

Gly Thr Thr Glu Ile Lys Ile Ala Ile Ala Gly Asp Pro Lys Ile Val

85 90 95

Glu Thr Asn Lys Leu Ile Gln Tyr Tyr Asp Met Val Val Asp Phe Thr

100 105 110

Ser Lys Ala Leu Asp Ile Val Lys Asn Lys Gly Tyr Ser Ile Lys Asn

115 120 125

Met Leu Glu Ile Arg Lys Leu Glu Ser Gly Ala

130 135

Claims

1. An RDA kit for detecting influenza a virus, comprising a nucleic acid extraction reagent, a isothermal amplification reaction reagent, a positive control, and a negative control; the isothermal amplification reaction reagent comprises recombinant enzyme KX60-600 ng/mu L, KY protein 16-192 ng/mu L, single-stranded binding protein gp32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8mg/ml, creatine phosphate 25-75mM, reverse transcriptase 200-U, tris buffer 20-100mM, PEG2.5% -10%, potassium acetate or potassium chloride 0-150mM, dATP1-5mM, dNTPs150-600nM, DTT1-12mM, fluorescent labeled probe 150nM-600nM, and primer 150-600nM;

the nucleotide sequence of the probe is shown as SEQ ID NO.1, the 5 'end of the probe is marked with a luminous group, the 3' end is marked with a quenching group, and the 5 th base position is replaced by tetrahydrofuran residue (THF); the nucleotide sequences of the primers are shown as SEQ ID NO.3 and SEQ ID NO.4, and the target sequence is shown as SEQ ID NO. 5;

the amino acid sequence of the recombinase KX is shown as SEQ ID NO.7, and the amino acid sequence of the KY protein is shown as SEQ ID NO. 9.

2. The RDA kit of claim 1, wherein the nucleic acid extraction reagent comprises Buffer a and Buffer b, wherein the Buffer a is a sample lysate comprising Tris-HCL Buffer system, naOH, SDS, EDTA, guanidinium isothiocyanate, tween80, and triton; the BufferB contains a Tris buffer system, potassium chloride and magnesium chloride; the positive control is a plasmid containing influenza A virus target genes, and the negative control is an empty vector pUC57 plasmid.

3. A method for detecting influenza a virus for non-disease diagnosis, comprising the steps of:

taking bufferA from the kit according to claim 2, respectively vibrating and uniformly mixing the bufferA with a positive control, a negative control and a sample to be detected, and standing at room temperature for 10-15min; adding BufferB, adding a constant-temperature amplification reaction reagent into the mixed solution after shaking and mixing uniformly, collecting fluorescent signals after shaking and centrifuging, wherein the reaction temperature is 25-42 ℃, the reaction time is more than 15 minutes, and analyzing a sample to be detected according to an amplification curve.

4. The detection method according to claim 3, wherein the reaction temperature is 39℃and the reaction time is 30 minutes.